Phenotypic Mutation 'want_to'

• Allele: want_to
• Mutation Type: missense
• Chromosome: 1
• Coordinate: 36,821,598 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Zap70
• Gene Name: zeta-chain (TCR) associated protein kinase
• Synonym(s): ZAP-70, TZK, Srk
• Chromosomal Location: 36,800,879-36,821,899 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] ; PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000027291]
• AlphaFold: P43404
• SMART Domains: Protein: ENSMUSP00000027291; Gene: ENSMUSG00000026117; AA Change: Y597C

Domain	Start	End	E-Value	Type
SH2	8	93	6.73e-25	SMART
SH2	161	245	1.59e-26	SMART
low complexity region	257	265	N/A	INTRINSIC
TyrKc	337	592	1e-128	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000027291)
• Meta Mutation Damage Score: 0.2894
• Is this an essential gene?: Possibly nonessential (E-score: 0.322)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:28 PM by Anne Murray
• Record Created: 2019-02-28 10:03 PM by Bruce Beutler
• Record Posted: 2019-03-07
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_009539 (variant 1), NM_001289612 (variant 2), NM_001289765 (variant 3), NM_001289766 (variant 4); MGI: 99613

Alleles Listed at MGI

All Mutations and Alleles(32) : Chemically induced (ENU)(11) Chemically induced (other)(1) Gene trapped(1) Spontaneous(2) Targeted (12) Transgenic(5)

Phenotypic Description

Figure 1. Want_to mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Want_to mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The want_to phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6694, some of which showed reduced frequencies of naïve CD8 T cells in CD8 T cells (Figure 1) with concomitant increased frequencies of central memory CD8 T cells in CD8 T cells (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the increased central memory CD8 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 42 mutations (X-axis) identified in the G1 male of pedigree R6694. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 42 mutations. Both of the above anomalies were linked by continuous variable mapping to mutations a mutation in Zap70: an A to G transition at base pair 36,782,517 (v38) on chromosome 1, or base pair 20,720 in the GenBank genomic region NC_000067 encoding Zap70.  The strongest association was found with a recessive model of inheritance to the normalized central memory CD8 T cell frequency, wherein 12 variant homozygotes departed phenotypically from 13 homozygous reference mice and 28 heterozygous mice with a P value of 3.068 x 10^-11 (Figure 3).

The mutation corresponds to residue 1,952 in the mRNA sequence NM_001289766 within exon 13 of 13 total exons.

1936 ATGCGGAACTATTACTACAGCCTGGCCAGCCGG 592  -M--R--N--Y--Y--Y--S--L--A--S--R-

The mutated nucleotide is indicated in red. The mutation results in a tyrosine to cysteine substitution at position 597 (Y597C) in the ZAP70 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 4. Structure of ZAP-70. Mouse Zap-70 is a 618 amino acid protein tyrosine kinasen (PTK) that consists of two N-terminal Src-homology 2 (SH2) domains and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A (IDA), while the region between the second SH2 and catalytic domains is known as interdomain B (IDB). The aspartic acid (D) of the residue 459 is the proton acceptor during the catalytic cycle. Several tyrosine (Y) residues located within interdomain B are phosphorylated following TCR stimulation (291, 314, and 318). Phosphorylation of Tyr 492 is required for ZAP-70 activation, while Tyr 491 phosphorylation negatively regulates ZAP-70 function. The want_to mutation causes a tyrosine to cysteine substitution at position 597. The 3D structure is human ZAP70. UCSF Chimera structure based on PDB 2OZO. This image is interactive. Other mutations found in ZAP-70 are noted in red. Click on the mutations for more specific information. Click on the 3D structure to view it rotate.

The ζ-associated protein of 70 kDa (ZAP-70) is a protein tyrosine kinase (PTK) that binds to the doubly phosphorylated immunoreceptor tyrosine-based activation motifs (ITAMS) of ζ and CD3ε chains of the T cell receptor (TCR; see the record for tumormouse). ZAP70 consists of two N-terminal Src-homology 2 (SH2) domains at amino acids and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A, while the region between the second SH2 and catalytic domains is known as interdomain B (2). The two SH2 domains of mouse ZAP-70 occur at amino acids 10-102 and 163-254, and work cooperatively to bind to the phosphorylated tyrosines of an ITAM sequence [(D/E)xxYxxI/Lx_(6-8)YxxI/L].

The want_to mutation results in a tyrosine to cysteine substitution at position 597 (Y597C); Tyr597 is within the kinase domain.

Please see the record for murdock for more information about Zap70.

Putative Mechanism

Signaling through the T cell receptor (TCR) plays a critical role at multiple stages of thymocyte differentiation, T-cell activation, and homeostasis [reviewed in (3;4)]. Syk and ZAP-70 function as critical mediators of pre-TCR and TCR signaling, with ZAP-70 having a predominant role in mature T cells (4;5). Once activated, ZAP-70 and Syk interact with and phosphorylate a number of substrates important for TCR signaling including the adaptor proteins the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76) (6;7). Once phosphorylated, these two adaptors serve as docking sites and organize a number of effector molecules into the correct spatiotemporal manner to allow the activation of multiple signaling pathways. Zap70 knockout mice display an arrest of T cell development at the DP stage, the second critical checkpoint important during αβ T cell development due to defective TCR-mediated selection and signaling at this stage (5;8). Although ZAP-70 has a critical role in T cell development and function, it also plays a role downstream of the BCR and in NK cells. Zap70 knockout mice display normal B cell development, mount normal antibody responses and also proliferate appropriately to various stimuli (9).  The phenotype of the want_to mice is similar to loss-of-function alleles of Zap70.

Primers

PCR Primer
want_to_pcr_F: GCAGCTTTGCTTGTTAAGGC
want_to_pcr_R: AGCCCACTGGTGATGTTTAC

Sequencing Primer
want_to_seq_F: TTCCATCCATCTCATACCAAGGAG
want_to_seq_R: GGTGATGTTTACCAATATCCCATCAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 423 nucleotides is amplified (chromosome 1, + strand):

1   gcagctttgc ttgttaaggc tgggcgcccc agaattccat ccatctcata ccaaggagac
61  ctcatccaac agccctccct cctctgagcc ccaaaagtct gccccaactc cctatccctt
121 ggtacctttc tgccctctgg ctgaggctgg gttctgggtc ttcccaacag gtgggaggat
181 cgccccgact tcctgactgt ggaacaacgt atgcggaact attactacag cctggccagc
241 cgggccgagg gacccccaca gtgtgaacag gtggccgagg ctgcatgtgg ctgagcccca
301 agcctcccta caccctctgt ccaggatgac ctgtgttcag gagccctatc gactgtccca
361 tgtgattcgc cccgccccat gggctggggc tgatgggata ttggtaaaca tcaccagtgg
421 gct

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Adzhubei, I. A., Schmidt, S., Peshkin, L., Ramensky, V. E., Gerasimova, A., Bork, P., Kondrashov, A. S., and Sunyaev, S. R. (2010) A Method and Server for Predicting Damaging Missense Mutations. Nat Methods. 7, 248-249.

  2. Au-Yeung, B. B., Deindl, S., Hsu, L. Y., Palacios, E. H., Levin, S. E., Kuriyan, J., and Weiss, A. (2009) The Structure, Regulation, and Function of ZAP-70. Immunol Rev. 228, 41-57.

  3. Zamoyska, R., Basson, A., Filby, A., Legname, G., Lovatt, M., and Seddon, B. (2003) The Influence of the Src-Family Kinases, Lck and Fyn, on T Cell Differentiation, Survival and Activation. Immunol Rev. 191, 107-118.

  4. Palacios, E. H., and Weiss, A. (2004) Function of the Src-Family Kinases, Lck and Fyn, in T-Cell Development and Activation. Oncogene. 23, 7990-8000.

  5. Kadlecek, T. A., van Oers, N. S., Lefrancois, L., Olson, S., Finlay, D., Chu, D. H., Connolly, K., Killeen, N., and Weiss, A. (1998) Differential Requirements for ZAP-70 in TCR Signaling and T Cell Development. J Immunol. 161, 4688-4694.

  6. Bubeck Wardenburg, J., Fu, C., Jackman, J. K., Flotow, H., Wilkinson, S. E., Williams, D. H., Johnson, R., Kong, G., Chan, A. C., and Findell, P. R. (1996) Phosphorylation of SLP-76 by the ZAP-70 Protein-Tyrosine Kinase is Required for T-Cell Receptor Function. J Biol Chem. 271, 19641-19644.

  7. Zhang, W., Sloan-Lancaster, J., Kitchen, J., Trible, R. P., and Samelson, L. E. (1998) LAT: The ZAP-70 Tyrosine Kinase Substrate that Links T Cell Receptor to Cellular Activation. Cell. 92, 83-92.

  8. Negishi, I., Motoyama, N., Nakayama, K., Nakayama, K., Senju, S., Hatakeyama, S., Zhang, Q., Chan, A. C., and Loh, D. Y. (1995) Essential Role for ZAP-70 in both Positive and Negative Selection of Thymocytes. Nature. 376, 435-438.

  9. Fallah-Arani, F., Schweighoffer, E., Vanes, L., and Tybulewicz, V. L. (2008) Redundant Role for Zap70 in B Cell Development and Activation. Eur J Immunol. 38, 1721-1733.