Phenotypic Mutation 'maladaptive' (pdf version)
Allelemaladaptive
Mutation Type nonsense
Chromosome2
Coordinate101,645,647 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Rag1
Gene Name recombination activating gene 1
Synonym(s) Rag-1
Chromosomal Location 101,638,282-101,649,501 bp (-)
MGI Phenotype Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination.
Accession Number

NCBI RefSeq: NM_009019; MGI: 97848

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
Y886* in Ensembl: ENSMUSP00000077584 (fasta)
Gene Model not available
PDB Structure
RAG1 DIMERIZATION DOMAIN [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the core RAG1/2 recombinase [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
low complexity region 243 253 N/A INTRINSIC
RING 290 328 1.39e-3 SMART
ZnF_C2H2 353 376 2.61e1 SMART
ZnF_C2H2 725 750 7e1 SMART
Phenotypic Category decrease in B cells, decrease in CD4+ T cells, decrease in CD8+ T cells, hematopoietic system, immune system, RVFV susceptibility
Penetrance 100% 
Alleles Listed at MGI
All alleles(8) : Targeted, knock-out(2) Targeted, other(5) Chemically induced(1)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rag1 APN 2 101642388 missense probably damaging 1.00
IGL01125:Rag1 APN 2 101642001 missense probably damaging 0.99
IGL01836:Rag1 APN 2 101641894 missense probably damaging 1.00
IGL02216:Rag1 APN 2 101643381 missense possibly damaging 0.91
IGL02271:Rag1 APN 2 101643388 missense probably damaging 0.99
IGL02293:Rag1 APN 2 101643046 missense probably benign 0.39
IGL02601:Rag1 APN 2 101642673 missense probably damaging 1.00
huckle UTSW 2 101641223 nonsense
R0658:Rag1 UTSW 2 101642683 missense probably damaging 0.99
R1126:Rag1 UTSW 2 101642689 missense probably damaging 1.00
R1177:Rag1 UTSW 2 101642278 missense probably benign 0.10
R1319:Rag1 UTSW 2 101643192 missense probably damaging 1.00
R1513:Rag1 UTSW 2 101642991 missense possibly damaging 0.95
R1859:Rag1 UTSW 2 101644062 missense probably benign 0.03
R2218:Rag1 UTSW 2 101644146 missense probably benign
R3932:Rag1 UTSW 2 101643039 missense probably damaging 1.00
R4127:Rag1 UTSW 2 101642071 missense probably damaging 1.00
R4365:Rag1 UTSW 2 101642943 missense probably damaging 1.00
R4620:Rag1 UTSW 2 101643680 missense probably damaging 1.00
R4815:Rag1 UTSW 2 101643516 missense probably damaging 0.99
R5070:Rag1 UTSW 2 101642311 missense probably damaging 1.00
R5209:Rag1 UTSW 2 101644215 missense probably benign 0.01
R5239:Rag1 UTSW 2 101642955 missense possibly damaging 0.91
R5390:Rag1 UTSW 2 101642734 missense probably benign
R5607:Rag1 UTSW 2 101643792 missense probably damaging 1.00
R5607_K:Rag1 UTSW 2 101643792 missense probably damaging 1.00
R5607_Q:Rag1 UTSW 2 101643792 missense probably damaging 1.00
X0018:Rag1 UTSW 2 101643597 missense probably damaging 1.00
X0018:Rag1 UTSW 2 101644547 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 031719-UCD
Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created unknown
Record Posted 07/16/2009
Phenotypic Description
Maladaptive was identified among ENU-mutagenized G3 mice with near complete deficiencies of CD8+ and CD4+ T cells in the blood (Figure 1A).  CD19+B220+ B cells were also absent (Figure 1B). Affected mice were adoptively transferred with CD45.1 splenocytes, and maintained on TMS antibiotic water.
Nature of Mutation
The maladaptive mutation was mapped to Chromosome 2, and the candidate genes Rag1 and Rag2 were directly sequenced. A C to A transversion at position 2783 was identified in the Rag1 transcript, within exon 2 of 2 total exons.
 
2766 GAGCTCATGGACCTTTACCTGAAGATGAAACCC
881  -E--L--M--D--L--Y--L--K--M--K--P-
 
The mutated nucleotide is indicated in red lettering, and converts codon 886 (tyrosine) to a stop codon.
Protein Prediction
Figure 2. Domain structure of RAG1. The positions of catalytic triad residues are shown above the diagram. The central domain contains binding sites for the RSS heptamer and for RAG2, as well as a zinc finger motif (ZFB, hatched box). The C-terminal domain (C-term) binds DNA in a non-sequence-specific manner, and may mediate dimerization. The position of the maladaptive mutation is indicated. ZDD, zinc-binding dimerization domain; RING, RING finger domain; ZFA, C2H2 zinc finger motif A; NBR, nonamer binding region; ZFB, zinc finger motif B. This image is interactive. Click on the image to view other mutations found in RAG1 (red). Click on the mutations for more specific information.  
The recombination activating gene 1 (RAG1) and RAG2 proteins carry out the first enzymatic step of V(D)J recombination, the process by which the variable region of antigen receptor genes is assembled in developing B and T lymphocytes. Presumably because of its great benefits to an organism, all jawed vertebrates have evolved to utilize the same basic mechanism of antigen receptor gene assembly by V(D)J recombination, and accordingly possess highly similar RAG proteins. Among sharks, fishes, amphibians, birds, and mammals, there is 50 to 90% conservation of RAG protein sequences (1). Interestingly, the nearest living phylogenetic relatives of jawed vertebrates, the jawless vertebrates (lampreys and hagfish), assemble their variable lymphocyte receptors (VLR) from sequence-diverse leucine-rich-repeat (LRR) coding units and an invariant sequence encoding a stalk region, rather than from TCR and Ig V, D, and J genes [reviewed in (2)]. The identity of the recombinase in these animals remains under investigation. 
 
The unusual structure of the RAG locus is present in most vertebrate genomes. Within the locus, the genes encoding RAG1 and RAG2 lie immediately adjacent to each other (separated by only a few kb), are convergently transcribed, and have an exceptionally compact organization with the entire open reading frame of each gene contained in a single exon (3;4). Only the RAG genes of zebrafish and rainbow trout are known to contain introns (5;6).
 
Mouse RAG1 consists of 1040 amino acids (Figure 2). However, deletion of 383 amino acids from the N-terminus and 32 amino acids from the C-terminus still yields an active protein capable of recombining a plasmid substrate (7;8). Most biochemical studies have utilized this truncated “core region” since the full-length protein has proven to be difficult to express and purify due to insolubility and a tendency to bind tightly to nuclear structures (9). Similarly, studies with RAG2 use a core region consisting of the N-terminal 383 amino acids out of the full-length 527 (10;11).
 
Recombination of the antigen receptor genes is specifically directed to the coding elements by a recombination signal sequence (RSS) flanking each variable (V), diversity (D), and joining (J) encoding gene segment. Each RSS consists of moderately well conserved heptamer (CACAGTG) and nonamer (ACAAAAACC) sequences separated by 12 or 23 (±1) base pairs of nonconserved spacer DNA (designated a 12- or 23-RSS, respectively). During the first phase of V(D)J recombination, a complex containing RAG1 and RAG2 recognize, bind, and catalyze two double-stranded DNA cleavages between the RSS heptamer and the flanking coding sequence (see Background for details). A catalytic triad of acidic residues (D600, D708, E962; called the DDE motif) has been shown to constitute the active site for DNA cleavage in core RAG1, and has also been found in several transposase and integrase proteins (12-14). The DDE motif coordinates one or two divalent metal ions (Mg2+ for RAG1) in the active site. Mutation of any of these three residues abrogates recombination in vivo, and DNA cleavage by the purified protein in vitro, while binding to RSS remains intact (12-14). D600 and D708 are implicated in direct metal binding, whereas the function of E962 is less clear. Mutation of E962 renders the protein inactive for recombination, but does not affect iron-mediated DNA cleavage (13).
 
The core region of RAG1 contains several domains that mediate binding to RSSs and to RAG2. The N-terminus of core RAG1 (amino acids 384-454 in the full length protein) contains the nonamer-binding region (NBR), which binds to the RSS nonamer (15;16) as well as to the high mobility group proteins HMG1 and HMG2 (17). HMG1, 2 facilitate the bending of RSS DNA between the heptamer and nonamer, and enhance binding of RAG1 to the RSS. X-ray crystallographic studies of the NBR in complex with DNA demonstrate that it forms a dimer that holds closely together two nonamer elements, with each NBR contacting both DNA molecules (Figure 3, PDB ID 3GNA) (18).
 
Amino acids 528-760 constitute the central domain of core RAG1, which contains a binding site for the RSS heptamer (19). Affinity is much stronger for the RSS heptamer when it is single stranded as opposed to double stranded, suggesting that ssDNA is an important structural intermediate during the cleavage phase of V(D)J recombination (20).  Also present in the central domain is a classic C2H2 zinc finger (amino acids 723-754; designated ZFB) that interacts with core RAG2 (21). The C-terminal portion of core RAG1 (amino acids 761-979) binds to dsDNA in a non-sequence-specific manner cooperatively and with high affinity, and self-associates to form dimers (19).  Protein-DNA cross-linking studies have shown that a C-terminal fragment of core RAG1 associates with coding sequence flanking the RSS heptamer (22).
 
The non-core regions of RAG1 (amino acids 1-383 and 1009-1040) influence the catalytic efficiency of V(D)J recombination and the resulting gene products (23;24). Residues 1-264 of RAG1 contain a proposed zinc-binding site, and three basic regions that associate with SRP1 (suppressor of RNA polymerase 1), a protein that promotes nuclear transport (16;25). Residues 265-380 contain a zinc-binding dimerization domain (ZDD), which encompasses a zinc RING finger motif (amino acids 288-339) and a C2H2 zinc finger domain (amino acids 349-378; designated ZFA) (26).  The crystal structure of the monomeric and dimeric RAG1 ZDD reveals the presence of four zinc ions per monomer (Figure 4, PDB ID 1RMD) (27). The secondary structural folds of the RING finger and ZFA motifs in RAG1 are quite similar to those of other such motifs. In addition to participating in dimerization, the RING finger motif of RAG1 has been shown to mediate E3 ubiquitin ligase activity towards a peptide substrate in vitro, but the physiological substrates of this activity remain unknown (28).
 
The maladaptive mutation creates a premature stop codon that would truncate the protein after amino acid 885, which lies within the C-terminal domain of core RAG1. The resulting protein lacks 155 and 123 amino acids, respectively, compared to the full length and core RAG1 protein sequences.
Expression/Localization
Northern blot analysis demonstrates that RAG1 transcript is expressed in the thymus and bone marrow, specifically only in immature B and T cells (3;4). This finding is supported by experiments in B and T cell lines, in which RAG1 mRNA is detected only in pre-B and pre-T cell lines (3). In the thymus, RAG1 mRNA is expressed by T cell receptor (TCR)- and TCR+ thymocytes, but among TCR+ cells expression is restricted to immature CD4+CD8+ double positive cells (29). RAG1 expression is absent from CD4+ or CD8+ single positive thymocytes. TCR signal transduction results in downregulation of RAG1 expression (29). During mouse embryonic development, RAG1 transcript is detectable at all stages, but increases between gestational days 12 and 18, concomitant with the development and proliferation of lymphoid cells in fetal liver and thymus (3). Detection of low levels of RAG1 transcript in neurons of embryonic and postnatal mice has been reported (30). However, the central nervous system has not been found to carry out the same site-specific gene recombination that occurs in lymphocytes, and a neuronal function for RAG1 has not been described (31).
Background
Immunoglobulin and T cell receptor loci consist of linear arrays of gene segments that require combinatorial assembly to form functional coding sequences. In mammals, antigen receptor loci are arranged in the translocon configuration, in which large numbers of V gene segments are grouped together upstream of a group of D gene segments, which lie upstream of a group of J gene segments. These arrays lie transcriptionally upstream of a constant (C) region gene. The seven antigen receptor loci in mammals [the immunoglobulin (Ig) H, κ, and λ loci, and the TCR α, β, γ, and δ loci] contain sets of V and J segments, while the IgH, TCRβ, and TCRδ loci additionally have D segments located between the V and J segments. In general, any D segment can be joined to any J segment, and any V segment can be joined to any (D)J segment. During lymphoid cell development, V-J or V-D-J segments of Ig or TCR loci are joined by the process of V(D)J recombination to generate a variable region exon, which is subsequently linked to the C region gene by RNA splicing. Ultimately, pre-B cells and thymocytes can survive to maturity only if they successfully carry out V(D)J recombinations that will give them in-frame Ig and TCR chains, to be assembled into the final B cell receptor (BCR) and TCR complexes. Ig and TCR loci may contain numerous segments of one type that combine to produce a diverse repertoire of Ig and TCR chains, allowing the adaptive immune system to respond to numerous different antigens. Locus-specific somatic hypermutation also contributes to Ig diversity in B cells (32).
 
The RAG1 and RAG2 proteins are the only lymphoid-specific factors required for V(D)J recombination, permitting recombination of test substrates when coexpressed in non-lymphoid cells (4). Conversely, mice lacking either RAG1 or RAG2 are completely deficient in V(D)J recombination (33;34). As mentioned above (Protein Prediction), the RSS flanking each V, D, or J segment serves as the recognition site for the RAG proteins. Recombination is restricted by the 12/23 rule, which requires that gene segments to be joined are flanked by RSSs with different spacer lengths (35). RSS spacer lengths are positioned within the genomic loci such that recombination will generate products that could be functional (e.g. V-J joining, but not V-V or J-J joining). RSSs are highly conserved, with the same recognition motifs utilized by species from sharks to humans, although some variation is tolerated and may influence the usage of particular gene segments (36). V(D)J recombination is controlled through regulation of RAG1 and RAG2 expression, which is restricted to lymphoid cells during early development, and through regulation of DNA accessibility to the recombination machinery. Accessibility is governed by many of the same elements affecting transcription, including enhancer sequences, histone acetylation, and methylation [reviewed in (37)].
 
The process of V(D)J recombination can be conceptually divided into two phases (Figure 5). In the first phase, RAG proteins catalyze coupled cleavage at a 12/23 RSS pair, making two double stranded DNA cuts between each RSS and its adjacent coding segment. The second phase involves the processing and repair of RAG-induced DNA double strand breaks. These two phases are discussed below in greater detail.
 
RAG1 and RAG2 are both necessary and sufficient to complete the first phase of V(D)J recombination. First, a complex containing RAG1 and RAG2 binds one RSS. This RAG-RSS complex then captures the second RSS (of the gene segment to be joined) in a process known as synapsis. 12/23 RSS pairs are preferred over 12/12 or 23/23 pairs by RAG1/2 (38;39), a preference that is enhanced by the presence of HMG1 or HMG2 (40;41). Within the synaptic complex, RAG1 and RAG2 have been shown to contact both the heptamer and nonamer sequences of an RSS [for a detailed discussion of RAG-RSS contacts see (42)]. Cleavage by RAG1/2 occurs between the RSS heptamer and flanking coding sequence, and proceeds in two steps (43) (Figure 6). A nick is made at the 5’ end of the RSS heptamer, leaving a 5’-phosphoryl group on the RSS and a 3’-hydroxyl group on the coding end. The second step is a hairpinning step in which the 3’-hydroxyl on the coding end attacks a phosphodiester bond on the opposite strand, joining the 3’-hydroxyl to the phosphoryl group at the same nucleotide position on the other strand. DNA cleavage is completed within the synaptic complex, as reflected by the requirement for a 12/23 RSS pair at the final hairpinning step (39;44). The product of this first phase of V(D)J recombination is the “cleaved signal complex,” which contains four DNA ends: two blunt 5’-phosphorylated signal ends, and two coding ends terminating in DNA hairpin structures.
 
During the second phase of V(D)J recombination, RAG1 and RAG2 work together with DNA repair proteins to process and ligate coding ends to form a coding joint, and ligate signal ends to form a signal joint. This phase requires ubiquitously expressed DNA repair factors of the non-homologous end joining (NHEJ) pathway, including the three components of the DNA-dependent protein kinase (Ku70, Ku80, and the catalytic subunit DNA-PKcs), the Artemis protein, and the XRCC4-DNA ligase IV complex (37). Mutations in any of these proteins abrogate or impair V(D)J recombination and lymphocyte development in mice and humans. RAG1 itself is required during the process of joint formation, as evidenced by point mutations that prevent joining but do not affect cleavage (45;46)
 
Signal joint formation is the simpler of the two joining processes, involving direct ligation of two blunt ends.  Ku70 and Ku80 bind to the DNA ends, which are joined together by the XRCC4-DNA ligase IV complex. Coding end joining is more complex, permitting the introduction of junctional diversity through the addition or deletion of nucleotides before end ligation (35;47;48). Both DNA-PKcs and Artemis are required primarily during coding end, but not signal end joining (49;50). Ku70 and Ku80 bind to coding ends and are thought to recruit and activate the serine/threonine kinase DNA-PKcs (51). DNA-PKcs forms a complex with and phosphorylates Artemis, activating the nuclease function of Artemis to nick the hairpin structures of coding ends (52;53). The open coding ends can then undergo non-templated insertions of up to 15 nucleotides carried out by the enzyme terminal deoxynucleotidyl transferase (TdT), which is expressed in developing lymphoid cells (54). Mice lacking TdT have a diminished diversity in their repertoire of B and T cell antigen receptors, specifically in N region deiversity at the junctions of rearranged TCR and Ig gene segments (55;56). Templated insertions (known as palindromic, or P, insertions) may also occur as a result of off-center nicking of the hairpin structure, which leaves a short single stranded extension that is filled in before end joining (57;58). Nucleotide deletion is observed as well, but the responsible enzyme remains unknown. The XRCC4-DNA ligase IV complex performs the final ligation step in coding joint formation (59;60).  Typically, the orientation of the RSSs is such that the joined coding segments are retained in the chromosome, while the signal joint is excised in a circular DNA that is later lost from the cell (61;62).
 
Human severe combined immune deficiency (SCID), in which B cells and T cells are reduced or absent, often result from defects in V(D)J recombination (OMIM #601457) (63). Null mutations in RAG1 or RAG2 underlie approximately half of the human T cell-negative, B cell-negative SCIDs (64). Affected patients begin to have problems with oral candidiasis, diarrhea, and failure to thrive in the first months of life, and are later identified after several more months of persistent infections by opportunistic organisms. In contrast, hypomorphic mutations in RAG1 or RAG2 cause Omenn syndrome (OMIM #603554), an autosomal recessive SCID characterized by enlarged lymphoid tissue, severe erythroderma, hypereosinophilia, elevated serum IgE, few B cells, and oligoclonal expansion of T cells. The inflammation observed in patients with Omenn syndrome is thought to be triggered by clonally expanded, activated T cells that secrete cytokines that promote autoimmune and allergic inflammatory responses (65). A recent report describes a recessive human RAG1 hypomorphic mutation causing oligoclonal expansion of TCRγδ T cells combined with TCRαβ T cell lymphopenia, cytomegalovirus infection, and autoimmunity (66). Human mutations in Artemis, nonhomologous end-joining factor 1 (NHEJ1), ligase IV, and DNA-PKcs also give rise to a T cell-negative, B cell-negative SCID phenotype (49;67-69). SCIDs caused by mutations in these molecules, or of unknown etiology, account for approximately 8% of all SCIDs (63).
Putative Mechanism
The maladaptive mutation creates a premature stop codon truncating the RAG1 protein after amino acid 885. Previous studies have shown that RAG1 C-terminal deletions of amino acids 994-1040, or 699-1040 abolished all recombination activity towards a plasmid substrate in vitro (7;8). In contrast, deletions of 1009-1040 or 1023-1040 resulted in proteins with normal or increased recombination activity. Even if stable RAG1 protein expression is achieved in maladaptive mice, the mutation is predicted to abrogate all recombination activity of RAG1. Consistent with this hypothesis, maladaptive mice recapitulate the B cell-negative, T cell-negative phenotype of Rag1-/- mice.
Primers Primers cannot be located by automatic search.
Genotyping
Maladaptive genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers
maladaptive (F): 5’- TCTTCAGGGGCACTGGATACGATG -3’
maladaptive (R): 5’- TCAATGCCCAAAGGGTCCCCTAAG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
maladaptive_seq(F): 5’- AAGCTTCTGGCTCAGTCTAC -3’
maladaptive_seq(R): 5’- TACAGCCAGTGATGTTTCAGGAC -3’
 
The following sequence of 985 nucleotides (from Genbank genomic region NC_000068 for linear genomic sequence of Rag1, minus strand)) is amplified:
 
6839                                                                tc
6841 ttcaggggca ctggatacga tgaaaaactt gtccgggaag tagaaggctt ggaagcttct
6901 ggctcagtct acatctgtac actctgtgac accacccgtt tggaagcctc tcagaatctt
6961 gtcttccact ccataaccag aagccacgcc gagaacctgc agcgctatga ggtctggcgg
7021 tccaatccgt atcatgagtc cgtggaagag ctccgggacc gggtgaaagg ggtctctgcc
7081 aaacctttca tcgagacagt cccttccata gatgcgcttc actgtgacat tggcaatgca
7141 gctgaattct ataagatttt ccagctggag ataggggaag tgtataaaca tcccaatgcc
7201 tctaaagagg aaaggaagag atggcaggcc acgctggaca aacatctccg gaaaaggatg
7261 aacttaaaac caatcatgag gatgaatggc aactttgccc ggaagcttat gacccaagag
7321 actgtagacg cagtttgtga gttaattcct tctgaggaga ggcatgaagc tctcagggag
7381 ctcatggacc tttacctgaa gatgaaaccc gtgtggcgct cttcatgtcc cgctaaagag
7441 tgtccagagt ccctctgtca gtacagtttc aactcacagc gtttcgcgga actcctctcc
7501 accaagttca aatatagata cgagggcaaa atcaccaatt actttcacaa aaccttggca
7561 catgtccctg aaattattga aagggatggc tctatcgggg cctgggcaag tgagggaaat
7621 gaatcgggta acaagctgtt tagacggttt cggaaaatga atgccaggca gtccaagtgc
7681 tatgagatgg aagatgtcct gaaacatcac tggctgtata cttcaaaata cctccagaag
7741 tttatgaatg ctcataacgc gttaaaaagc tctgggttta ccatgaactc aaaggagacc
7801 ttaggggacc ctttgggcat tga
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is indicated in red.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsOwen M. Siggs, Bruce Beutler
Edit History
01/28/2011 6:59 PM (current)
01/04/2011 9:11 AM
10/08/2010 1:07 PM
10/08/2010 1:06 PM
10/08/2010 1:04 PM
10/07/2010 3:32 PM
10/07/2010 3:30 PM
10/06/2010 4:28 PM
02/03/2010 5:15 PM