Phenotypic Mutation 'macro-2'

• Allele: macro-2
• Mutation Type: start codon destroyed
• Chromosome: 16
• Coordinate: 91,180,787 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Ifnar2
• Gene Name: interferon (alpha and beta) receptor 2
• Synonym(s): Ifnar-2
• Chromosomal Location: 91,169,671-91,202,477 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Multiple transcript variants encoding at least two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice with mutations of this gene have defects in immune responses involving, variously, NK cells, CD4+ and CD8+ T cells and B cells in response to induced and transplanted tumors, viruses, and double stranded DNA. These defects include diminished secretion of type I and type II interferons. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Methionine changed to Valine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: O35664
• SMART Domains: Protein: ENSMUSP00000023693; Gene: ENSMUSG00000022971; AA Change: M1V

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	9	118	8.9e-18	PFAM
Pfam:Interfer-bind	132	231	9.2e-19	PFAM
low complexity region	315	326	N/A	INTRINSIC
low complexity region	361	389	N/A	INTRINSIC
low complexity region	476	485	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000086443; Gene: ENSMUSG00000022971; AA Change: M1V

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	9	118	2.9e-18	PFAM
Pfam:Interfer-bind	132	231	1.5e-17	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000113358; Gene: ENSMUSG00000022971; AA Change: M1V

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	9	118	2.9e-18	PFAM
Pfam:Interfer-bind	132	231	1.5e-17	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000134796; Gene: ENSMUSG00000022971

Domain	Start	End	E-Value	Type
Pfam:Interfer-bind	30	117	3.6e-16	PFAM

• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.148)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 031072-UCD
• Last Updated: 2018-08-24 3:19 PM by Diantha La Vine
• Record Created: unknown
• Record Posted: 2009-03-13
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Sungyong Won, Celine Eidenschenk, Owen Siggs, Bruce Beutler

Accession Number

NCBI RefSeq: NM_010509; MGI: 1098243

Alleles Listed at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(9) Chemically induced(1)

Phenotypic Description

Macro-2 was discovered in an ex vivo macrophage screen for control of viral infection.  Macrophages from ENU-mutagenized G3 mice were infected with mouse cytomegalovirus (MCMV), influenza virus, Rift Valley Fever virus (RVFV), and an adenoviral vector and examined for effective viral clearance.  Peritoneal macrophages from Macro-2 mice were found to be permissive to all viral infections (Figure 1A).  Macro-2 macrophages are also defective in producing type I interferon (IFN) in response to double-stranded DNA (Double-stranded DNA Macrophage Screen) (Figure 1B).

Nature of Mutation

The Ifnar2 gene on chromosome 16 of macro-2 mice was sequenced, and an A to G transition was identified in exon 2 (of 9 total exons) at position 221 of the Ifnar2 cDNA.

 

206 TAAGAGCTGAGCAGGATGCGTTCACGGTGCACC

1   ………………………………………-M--R--S--R--C--T-

 

The mutated nucleotide is indicated in red lettering, and results in a conversion of the methionine start site to a valine of the IFNAR2 protein.

Protein Prediction

Figure 2. Domain structure of IFNAR2. IFNAR2 belongs to the class II helical cytokine receptor (hCR) family. The extracellular ligand-binding region of IFNAR1 contains two fibronectin type III subdomains known as SD1 and SD2. The micro-2 mutation results in a conversion of the methionine start site to a valine of the IFNAR2 protein.

Ifnar2 encodes a 513 amino acid protein that, along with IFNAR1 (please see the record for macro-1), forms the heterodimeric type I interferon (IFN) receptor (IFNAR) (Figure 2) (1-5).  The IFNAR complex binds to all type I interferons including 13 IFN-α subtypes, as well as IFN-β, w, ε, ω, κ and others in some species.  Type I IFNs consist of five α-helices (A-E), which are linked by one overhand loop (AB loop) and three shorter segments (BC, CD, and DE loops).  Helices A, B, C, and E are arranged in an antiparallel fashion (6).  Type I IFNs are hypothesized to bind to IFNAR1 and IFNAR2 on opposing surfaces (7-9). 

 

Figure 3. A, Schematic drawing depicting the organization of the IFNAR1 and IFNAR2 extracellular domains bound to type I IFN. IFNAR1 domains are green; IFNAR2 domains are blue; type I IFN is in pink. The location of the residue altered by the macro-1 mutation is indicated by a red asterisk. Model is based on Li et al J. Mol. Biol. 377, 715-724 (2008). B, NMR structure of the human IFNAR2 extracellular domain complexed with IFNa2. The two extracellular domains of IFNAR2 are labeled, and the three residues that are most critical for binding IFNa2 are shown in yellow (see text). UCSF Chimera model is based on PDB 2HYM, Chill et al. Protein Science 15, 2656-2668 (2006). This image is interactive. Click on the 3D structure to view it rotate.

Both IFNAR1 and IFNAR2 belong to the class II helical cytokine receptor (hCR) family, which includes receptors for type II IFN, tissue factor (TF), and interleukin (IL)-10.  The extracellular ligand-binding regions of these receptors all share fibronectin type III (FBN-III) domains with an immunoglobin (Ig)-like fold and two conserved disulfide bonds (10).  Most of these receptors, including IFNAR2, contain two of these domains, each containing ~100 amino acids with seven β-strands and connecting loops, while IFNAR1 has four of these domains (7).  Unlike IFNAR1, IFNAR2 binds to type I IFNs with high affinity (11).  However, binding of ligand to IFNAR1 is necessary to form the proper ligand-receptor complex (Figure 3).  NMR has been used to model the interaction of IFNα2 with human IFNAR2, demonstrating that IFNAR2 displays an interdomain angle of 90^o that is unlike the conserved class II hCR angle of 120^o (12).  IFNAR2 has also been found to differentially bind to various type I IFNs.  For IFNα2, the ligand binding site of human IFNAR2 is composed largely of aliphatic hydrophobic amino acids.  The core of the IFNAR2 ligand binding domain contains the three highly conserved residues Thr44, Met46 and Lys48, while His76, Glu77, Tyr81, Trp100, Ile103 and Asp106 facilitate IFN binding (12-14).  The interaction of human IFNAR2 with IFNβ involves residues Ile45 and Trp100, with minor contributions from Thr44, Met46, Ser47 and Ile103 (14).  Upon type I IFN binding to IFNAR2, the N-terminal FBN-III domain of IFNAR1 is thought to form a lid over the bound ligand (10;15).  

 

The IFNAR receptor is typical of class II hCRs and lacks intrinsic kinase activity. Instead, the intracellular domains of the IFNAR receptor subunits are associated with Janus activating kinases (JAKs) that phosphorylate receptors and signal transducing molecules [reviewed in (16;17)] (see Background).  IFNAR2 is able to recruit JAK1, while IFNAR1 binds to tyrosine kinase 2 (TYK2) (18-21).  The human IFNAR2 intracellular domain contains a proline-rich sequence (box 1 motif) close to the transmembrane domain (residues 291-296) that has been shown to recruit and activate tyrosine kinases in other cytokine receptors (2).  This motif is not well-conserved in mouse IFNAR2, although this region is still proline-rich.  IFNAR2 contains several tyrosine residues that become phosphorylated by activated JAK1, and then are able to recruit signal transduction molecules such as signal transducer and activator of transcription (STAT) 1 (see the records for domino and poison) and STAT2 (18;21;22).  Mutational analysis of tyrosine residues in human IFNAR2 suggests that phosphorylated Tyr337 and Tyr512 play redundant roles in the recruitment and activation of STATs (21), while a similar mutational analysis of mouse IFNAR2 suggests that Tyr510 (corresponding to human Tyr512) plays a critical role in recruiting and activating STATs in response to type I IFN binding, while Tyr335 (corresponding to human Tyr337) plays a minor role (18).  Some studies suggest that JAK1, STAT1, and STAT2 are preassociated with IFNAR2 and do not require IFNAR2 to be phosphorylated (23;24).  STAT2 is recruited by both IFNAR subunits, but the STAT2 binding to IFNAR2 is stronger (25), suggesting IFNAR2 may normally have a more prominent role in STAT2 recruitment and activation.  However, STAT2 interaction with IFNAR2 may not be necessary for IFN signaling (24).    

 

In addition to JAK/STATs, IFNAR2 also associates with other factors that are important in signal transduction (see Background).  Phosphorylation of human IFNAR2 on Ser364 and Ser384 in two adjacent proline box motifs allows binding to CREB-binding protein (CBP), which then is able to acetylate IFNAR2 on Lys399.  Acetylated Lys399 is a docking site for interferon regulatory factor 9 (IRF9), while phosphorylation of the adjacent Ser400 strengthens this interaction leading to the formation of the ISGF3 complex (26).  Neither Ser364 nor Ser384 are conserved in mouse IFNAR2, although a number of serine residues as well as Lys399 and its adjacent serine are present.  Additionally, amino acids 300-346 of human IFNAR2 associate with receptor for activated C-kinase 1 (RACK1) (27), which plays a role in activating protein kinase C.  IFNAR2 also associates with the negative regulator of type I IFN signaling UBP43, which interferes with the interaction of JAK1 with IFNAR2 (28).  Furthermore, a region corresponding to amino acids 346-417 of human IFNAR2 was found to negatively regulate type I IFN by associating with an unidentified protein tyrosine phosphatase (29).       

 

In humans, four IFNAR2 transcripts produce three protein isoforms by exon skipping, alternative splicing, and differential usage of polyadenylation sites (3).  The human protein isoforms of IFNAR2 include a long, transmembrane form (IFNAR2c) that forms the functional type I IFN receptor, along with IFNAR1.  The other two human IFNAR2 isoforms include sIFNAR2a, which lacks the transmembrane domain and is soluble and IFNAR2b, a short, transmembrane isoform (Figure 3).  Although the mouse Ifnar2 gene does not encode a short, transmembrane isoform, two Ifnar2 transcripts (sIfnar2a and sIfnar2a’) are generated by alternative splicing and produce two soluble isoforms, in addition to the Ifnar2 transcript producing the complete receptor (5).  sIFNAR2a, the most abundant isoform, contains the complete extracellular domain of IFNAR2 and reads through the splice site in exon 7 to produce a transcript encoding 12 unique and mostly hydrophobic C-terminal residues, while sIFnar2a’ is generated from a transcript missing 128 nucleotides after codon 236 of Ifnar2.  The transmembrane-encoding exon 8 is skipped, leading to a frameshift, the generation of 11 unique C-terminal amino acids and a premature stop codon.  The soluble form of mouse IFNAR2 has been shown to bind type I IFNs and can even form a type I IFN complex with IFNAR1 (30).

 

The residue mutated in macro-2 mice is the methionine start site.  Presumably, mutation of this residue prevents IFNAR2 translation.

Expression/Localization

Ifnar2 transcripts are expressed in all tissues, organs and most cell lines, but the transmembrane and soluble Ifnar2 mRNAs are differentially expressed and regulated (30;31).  Mouse Ifnar2 expression is regulated by three regions that either confer basal expression, inducible expression by interferons, or are involved in negative regulation (31).  In general the mRNA for soluble IFNAR2a is more abundant than that encoding the full-length receptor, although the ratio is nearly 1:1 in hemopoietic tissues (30).  Ratios of more than 10:1 were observed in the small intestine, liver and fat.  Ifnar2 mRNA (for all isoforms) is ubiquitously expressed as early as embryonic day 10.  The mRNA ratio of soluble to full-length isoforms is generally much lower than in adults. 

 

Soluble IFNAR2 proteins are present in serum, urine, saliva and the peritoneal fluid of both humans and mice (30;32).

Background

Type I IFNs are a critical class of cytokines that have potent antiviral, growth-inhibitory, anti-tumorigenic and immunomodulatory functions [reviewed in (6;33)].  Classically, the production of type I IFNs (notably IFN-α/β) in response to viral infections is considered to be essential for antiviral defense, a role highlighted by the phenotype of Ifnar1 and Ifnar2 knockout mice that lack type I IFN signaling (7;34-36).  The production of type I IFNs in response to viral infection leads to inhibition of viral propagation and increases the vulnerability of infected cells to virus-induced apoptosis (37), a mechanism that is suggested to limit viral spread and may also increase the delivery of antigen to professional antigen-presenting cells (APCs) and be important to the onset of adaptive immunity.  Type I IFNs activate natural killer (NK) cells, macrophages and dendritic cells (DCs), all of which play an essential role in the innate immune system (38;39).  In addition to their antiviral effects, type I IFNs are also produced in response infection with bacterial pathogens and have an important role in the host response to bacterial infection, although type I IFN signaling has been demonstrated to increase susceptibility to certain bacterial infections in mice [reviewed by (40)].  The antiproliferative and apoptotic effects of type I IFNs on macrophages may be the reason why type I IFNs promote susceptibility to certain bacterial infections (41). 

 

All cell types that are susceptible to viral infection are able to release type I IFNs.  However, in the immune system, plasmacytoid dendritic cells (pDCs) produce the largest amounts of IFN-α/β in response to nucleic acids derived from pathogenic organisms [reviewed by (42)].  In general, the induction of type I IFN genes is transcriptionally controlled and depends on two members of the IFN regulatory factor (IRF) family, IRF-3 and IRF-7.  In response to microbial infections, these factors become phosphorylated, undergo nuclear translocation and induce transcription of genes encoding members of the IFN-α/β family (43).  IRF-3 is relatively specific in its induction of the solitary Ifnβ gene; IRF-7 is relatively specific for induction of the Ifnα cluster.  Upstream of these events, the recognition of various pathogens leading to type I IFN induction occurs through the toll-like receptors (TLRs) as well as the nucleic-acid cytosolic sensors retinoic acid-inducible gene 1 (RIG-1) and melanoma differentiation-associated protein 5 (MDA5) (43;44).  The TLRs engage various adaptors including myeloid differentiation (MyD) 88 (see pococurante and lackadaisical), TIRAP for toll-interleukin 1 receptor domain containing adaptor protein (also called MAL for MyD88 adaptor-like) (see torpid), TRIF for Toll-interleukin 1 receptor (TIR) domain-containing adaptor inducing IFN-β (also known as TICAM-1 for TIR domain-containing adaptor molecule-1) (see Lps2), and TRAM for TRIF related adaptor molecule (also called TICAM-2) (see Tram KO).  With the exception of TLR3, which signals solely by activating TRIF, all TLRs recruit MyD88, which triggers signaling pathways leading to nuclear translocation of NF-κB and phosphorylation of IRF-7 (43).  Both the MyD88-dependent and TRIF mediated pathways are used by TLR4 (44).  The TRIF pathway mediates the phosphorylation of IRF-3 by activating the TANK-binding kinase 1 (TBK1) and IκB kinase (IKK)-i/ε (45).  Interestingly, pDCs produce both IFN-α/β, while conventional or myeloid DCs produce only IFN-β.  Differences in expression of the receptors that sense viral components play a major role in these differences (42).  TLR7 and TLR9 are the critical sensing components in pDCs and result in the activation of the MyD88/IRF-7 pathway in the endosomal compartment, while type I IFN production in cDCs is generally MyD88-independent/IRF-3 dependent and occurs through TLR3, TLR4 and the nucleic-acid cytosolic sensors (17;42).

Figure 4. Diagram of the type I interferon receptor complex composed of IFNAR1 and IFNAR2 and type I IFN signaling pathways. The extracellular regions of the IFNAR receptor subunits consist of Fibronectin III domains, which are labeled as subdomain (SD) 1-4 in IFNAR1. The intracelluar regions of the IFNAR receptor subunits can interact with several factors that are important from type I IFN signaling. IFNAR1 and 2 contain proline-rich regions that bind to JAK tyrosine kinases (TYK2 binds to IFNAR1 and JAK1 binds to IFNAR2.) Phosphorylation of the IFNAR intracellular domains by these kinases leads to the activation of STATs, which are then able to form homo- and heterodimeric complexes. The interaction of SOCS1 with IFNAR1 inhibits STAT activation, while UBP43 binds to the JAK1 binding site. The STAT1/STAT2 heterodimer forms the ISGF3 complex with IRF9 that translocates into the nucleus where it activates genes containing the IFN-stimulated response element (ISRE). STAT1/STAT1 homodimers can activate genes containing the IFN-γ-activated sequence (GAS). The JAK kinases also activate other substrates, which initiate many pathways. For example, phosyphorylation of insulin receptor substrate (IRS) proteins leads to PI3K activation, wh ich has multiple downstream effectors. Phosphorylation of guanine nucleotide exchange factor (VAV) leads to activation of the small G protein, RAC1, which in turn activates MAP kinase pathways leading to p38 activation. Other factors that are activated in response to type I IFNs include the transcription factor NF-κB, which is downstream of PI3k or TRAF2, and AP1, which is activated by the ERK pathway. Please see text for further details. This image is interactive. Click on the image to view mutations within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

Type I IFN signaling modulates the expression of hundreds of IFN-stimulated genes (ISGs), accounting for the diverse biological properties of these cytokines and their highly pleiotropic and diverse effects.  Some of these antimicrobial gene products include proteins that can bind directly to viral RNA and inactivate it.  Other type I IFN-induced proteins affect the intracellular transport of viral particles, regulate transcription and translation and induce apoptosis.  ISGs also include MHC class I, which contribute to T cell responses (40).  Type I IFNs induce ISGs by activating several signal transduction pathways including the classical JAK/STAT signaling pathway (Figure 4).  As discussed above, the IFNAR receptor associates with protein tyrosine kinases including JAK1 in the case of IFNAR2 and TYK2 in the case of IFNAR1.  Binding of ligand to the IFNAR complex results in conformational changes that juxtapose these protein tyrosine kinases, resulting in auto and cross-phosphorylation and activation [reviewed by (17;46)].  Phosphorylation of critical tyrosine residues on the IFNAR receptor results in recruitment of signal transducing molecules such as STAT1 and STAT2 to the complex (18-21;23).  Phosphorylation of these signal transducing molecules by the IFNAR-associated protein kinases results in formation of STAT1/STAT2 heterodimers and STAT1 homodimers that dissociate from the receptor and translocate into the nucleus to form transcriptional complexes with other factors.  STAT1/STAT2 heterodimers, along with IRF-9, forms the IFN-stimulated gene factor 3 (ISGF3) complex that binds to upstream regulatory consensus sequences (IFN-stimulated response elements or ISRE) of type I IFN-inducible genes to initiate transcription.  ISGF3 regulates the transcription of IRF-7 (47;48), providing the type I IFN system a positive feedback loop that allows massive amplification of the type I IFN response.  STAT1 homodimers stimulate the transcription of genes containing the IFN-γ-activated sequence (GAS) (49). 

 

In addition to the positive feedback loop mediated by ISGF3-induction of IRF-7, constitutively low levels of IFN-α/β have been found to be expressed in several cell types and appear to be a prerequisite for enhanced production of type I IFNs in response to stimuli.  These low levels of IFN-α/β do not significantly activate downstream signaling events through IFNAR, but they do maintain tyrosine phosphorylation on IFNAR1, allowing for more efficient recruitment of STAT1 (50).  Basal levels of IFN-α/β are also correlated with IRF-7 expression, providing another mechanism for more efficient induction of type I IFN upon infection (17).  Constitutive IFN-α/β signaling appears to be required for more efficient type II IFN (IFN-γ) signaling as IFNAR1-deficient cells have a defective IFN-γ response associated with impaired dimerization of STAT1. 

 

Unique among all the cytokines, type I IFNs are able to promote the activation of all seven STAT family members resulting in the formation of a number of homo- and heterodimer combinations and differing gene induction responses.  The particular STAT(s) activated, STAT complexes formed, and the biological activities evoked are dependent on a variety of factors including cell type, cytokine milieu and stimulus [reviewed in (33)].  Indeed, some of the particular STATs have opposing activities and may compete with each other for binding to IFNAR and other STATs.  For instance, activated STAT1 is known to promote antiproliferative and apoptotic effects (51), while STAT4 promotes survival and proliferation in CD8⁺ T cells, particularly those with low levels of STAT1 (52-54).  In CD4⁺ T cells, activation of STAT3 and 5 in the presence of low STAT1 levels is necessary for the antiapoptotic and mitogenic effects of type I IFN (51), although STAT3 has also been shown to mediate apoptotic effects in still other cell types (55).  Unlike T cells, the activation of STAT1 in NK cells does not promote apoptosis, but is necessary for NK cytotoxicity (56).  Through these opposing effects, type I IFNs can mediate both the destruction of virally infected cells, while promoting the function of cells that are critical for mounting an appropriate immune response.   

 

In addition to the classical JAK-STAT pathway, type I IFN signaling through IFNAR is able to induce several other pathways that can act either in conjunction with STATs or independently [reviewed in (16;33))] (Figure 2).  For instance, some IRF family members can induce gene transcription independently of STATs in response to type I IFN signaling (ie IRF-1; mutated in Endeka) (57).  Additionally, type I IFN signaling activates p38 mitogen-activated protein kinase (MAPK), phosphatidylinositol (PI) 3-kinase (PI3K), and extracellular signal regulated kinase (ERK), kinases that are known to be involved in the activation of a variety of critical factors including the transcription factors NF-κB and activator protein (AP)-1, and the serine/threonine kinases protein kinase B (PKB or Akt) and the mammalian target of rapamycin(MTOR).  Indeed, NF-κB is activated by type I IFNs both through the classical NF-κB pathway involving the IκB kinase (IKK) complex as well as an alternative pathway involving NF-κB inducing kinase (NIK) and TNF receptor associated factor (TRAF) 2 (see the record for panr2) (58).  All of these pathways have been shown to be critical for many of the biological effects of type I IFNs including growth inhibition and antiviral responses. 

 

The responses to type I IFNs are negatively regulated by several mechanisms.  Some of these include the receptor subunits, including dephosphorylation of critical tyrosine residues and receptor internalization and degradation.  Other mechanisms include dephosphorylation of JAKs and STATs by several phosphatases.  In addition, the association of IFNAR1 with SOCS1 prevents the tyrosine phosphorylation of STATs (36), and the association of IFNAR2 with UBP43 interferes with JAK1 interaction (28).  Further downstream, the inhibition of STAT functions in the nucleus by protein inhibitors of activated STATs (PIAS) proteins occurs (59).  Many viruses have similarly found a way to prevent host antiviral responses by producing factors that inhibit the production of type I IFNs as well as type I IFN signaling [reviewed in (17)].  For example, poxvirus encodes a soluble protein that binds with high affinity to type I IFNs, thus neutralizing type I IFN signaling (60), while the V proteins of paramyxoviruses prevent the activation of STAT proteins through a variety of mechanisms including proteasomal degradation, inhibition of phosphorylation, sequestration, and blockage of nuclear translocation (17).

 

Due to their potent antiviral and anti-proliferative effects, type I IFNs are widely used to treat certain viral infections and cancers.  In addition, type I IFNs have been found to play important roles in the etiology of some autoimmune diseases [reviewed in (46)].  For instance, type I IFNs are widely used for the treatment of multiple sclerosis (MS), a chronic autoimmune demyelinating disease characterized by the infiltration of inflammatory cells, including macrophages and T cells, into the CNS resulting in the destruction of axonal myelin sheaths (61).  In an animal model of MS, animals deficient in IFN-β or IFNAR1 show an increased level of disease (62-64).  The mechanisms underlying this involvement are not well understood, but appear to involve TRIF-dependent induction of type I IFN and subsequent inhibition of the development of a certain T cell subtype (Th17 cells) through IFNAR-dependent signaling in macrophages (63).  Although another study studying IFNAR1-deficient mice in the same animal model of MS did not find a connection with Th17 cells, the absence of IFNAR1 on myeloid cells specifically led to severe disease and increased lethality (64).  Mice with a B or T cell-specific IFNAR1 deficiency did not show increased disease levels.  These results suggest that type I IFN signaling through IFNAR in myeloid cells plays a protective role against the development of multiple sclerosis.  By contrast, excess type I IFNs and IFN-stimulated gene expression have been linked to the pathogenesis of other autoimmune diseases such as systemic lupus erythematosus (SLE) and insulin-dependent diabetes mellitus (IDDM) [reviewed by (46)].  Furthermore, IFN-α treatment for viral infections and tumors can sometimes induce these diseases as well as other autoimmune symptoms.  The mechanisms behind these effects are not well understood, but likely include enhanced DC maturation and function, promotion of T and B cell differentiation, proliferation and survival, and changes in cytokine expression (46).    

 

Polymorphisms in the human IFNAR2 and IFNAR1 genes have been implicated in a number of diseases [reviewed in (7)].  IFNAR2 polymorphisms include susceptibility to multiple sclerosis (65), and hepatitis B and C (64;66). Cells from Down syndrome patients are more sensitive to type I IFN treatment due to trisomy of Chromosome 21, which carries the gene complex containing both IFNAR genes.  Accordingly, patients with Down syndrome have an aberrant immune response (67).  Increased levels of soluble IFNAR2a have been reported in many chronic viral infections, cancers and other diseases (68-70), and was correlated with a decreased response to IFN therapy in one study (68).  Furthermore, in vitro experiments demonstrated that sIFNAR2 was able to inhibit IFN signaling in wild type cells.  However, in primary thymocytes from Ifnar2^-/- mice sIFNAR2 was able to bind to type I IFNs and generate an antiproliferative signal (30), and another study demonstrated that ovine soluble IFNAR2 was able to mediate antiviral activity (71).  Thus, whether soluble IFNAR2 isoforms behave as agonists or antagonists of type I IFN signaling remains uncertain. 

 

Human deficiencies in proteins that are involved in the type I IFN response, including various STATs (see records for domino and poison) and TYK2, result in immunodeficiency (72-74).  TYK2 deficiency in humans confirms the essential role TYK2 plays in type I IFN signaling, in contrast to results from mice that suggests that TYK2 plays a minor role in the type I IFN response (75).

Putative Mechanism

As the macro-2 mutant was discovered in an ex vivo macrophage screen, it is not known whether macro-2 mice have a similar phenotype to those of Ifnar2 knockout animals.  The permissiveness of homozygous macro-2 macrophages to viral infections suggests that IFNAR function in these cells is severely affected, and that the macro-2 mutation may be equivalent to a severely hypomorphic or null allele.  However, the effects of this mutation in NK cells and DCs have not been tested.  Macro-2 macrophages also produce lower levels of type I IFN relative to wild type macrophages in response to certain stimuli, perhaps due to the lack of the positive feedback loop through IRF-7 (47;48). 

 

The macro-2 mutation affects the methionine start site of IFNAR2, and likely prevents protein translation.  It is possible an alternative start site is used and some functional protein expressed in macro-2 mutants.  No alternative in-frame start sites are present upstream of the Ifnar2 ATG start site, but the IFNAR2 protein has another methionine seventy-three amino acids downstream from the first methionine.  Thus, minor amounts of IFNAR2 protein missing the first seventy-two amino acids are likely to be produced in homozygous macro-2 mutants.  The deleted amino acids include most of the residues that are critical for binding to type I IFNS (12-14).  It is likely this altered IFNAR2 would be defective in IFN binding and not responsive to type I IFN stimulation, although dominant negative effects from the intact intracellular domain may be possible.

Primers

Primers cannot be located by automatic search.

Genotyping

Macro-2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Macro-2(F): 5’- TTGATACCACAGCGGAAGGTGAGC -3’

Macro-2(R): 5’- AACCATAGGCGGGACACATTAACTG -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               8

 

Primers for sequencing

Macro2_seq(F): 5’- CCTCTCTGCTTAGAGGACAGATG -3’

Macro2_seq(R): 5’- CAAGGCCGTTTCCTGAATATG -3’

 

The following sequence of 1002 nucleotides (from Genbank genomic region NC_000082 for linear DNA sequence of Ifnar2) is amplified:

 

10580                     t tgataccaca gcggaaggtg agctaagcaa gtcccaggga

10621 tcaaggaagg actgaaacca gaatttggct actttttaat ttatttttaa agacaggtag

10681 ctcctctagc tggcttcaaa cttgctatgt agccgaggat gaccttgaat gcctgacctt

10741 tcccccacct ctctgcttag aggacagatg tgacacgcac agtaaactca tgcaagttta

10801 accctaatcc taaccaatcc agggctacca cggggccgca tctgcagcta aatctggctc

10861 gttcttactc gtctctcgtt agcgtgtatg tgtctatcat gtaaattaca atataattgg

10921 gtgcttctga gttttgacca actcaatatt gatctctttc aggtgtgaga gcagaaaaac

10981 ggacttaaga gctgagcagg atgcgttcac ggtgcaccgt ctctgccgtc ggtctcctca

11041 gcttgtgtct tgtgggtaag ggctacttct cagcacagcc cttagaggag aaagcctctg

11101 tttctgtcat cacagagagc cctggtgtgg agcagcacac tgatgtccat atctggagaa

11161 cccagatcag cacggccagc atcaggcacc ccacgggggt cttccccttc attttagcta

11221 agccagaata atataggcta cagccatatt caggaaacgg ccttgtttat aattcaaagg

11281 gttgcggctc tgcacaccct gaatctcacg cccggtggcg tttagaaggt ggccatccct

11341 ttatctcttc ccatataaac taacttgaaa aatccatccc tacacattga tttatactct

11401 tcctttcttt ttagccctta tcttttctat atctgtattt cttcacgtcc tttctgttcc

11461 ttcctctgaa ctgtttgaat tccacaatgt catctctccc attcattgtc ctcagcggat

11521 ccaggagtat gacaaatgtc tcagtgtgga catccacagt taatgtgtcc cgcctatggt

11581 t

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is shown in red text.

References

   1.  Novick, D., Cohen, B., and Rubinstein, M. (1994) The Human Interferon alpha/beta Receptor: Characterization and Molecular Cloning. Cell. 77, 391-400.

   2.  Domanski, P., Witte, M., Kellum, M., Rubinstein, M., Hackett, R., Pitha, P., and Colamonici, O. R. (1995) Cloning and Expression of a Long Form of the Beta Subunit of the Interferon Alpha Beta Receptor that is Required for Signaling. J. Biol. Chem. 270, 21606-21611.

   3.  Lutfalla, G., Holland, S. J., Cinato, E., Monneron, D., Reboul, J., Rogers, N. C., Smith, J. M., Stark, G. R., Gardiner, K., and Mogensen, K. E. (1995) Mutant U5A Cells are Complemented by an Interferon-Alpha Beta Receptor Subunit Generated by Alternative Processing of a New Member of a Cytokine Receptor Gene Cluster. EMBO J. 14, 5100-5108.

   4.  Kim, S. H., Cohen, B., Novick, D., and Rubinstein, M. (1997) Mammalian Type I Interferon Receptors Consists of Two Subunits: IFNaR1 and IFNaR2. Gene. 196, 279-286.

   5.  Owczarek, C. M., Hwang, S. Y., Holland, K. A., Gulluyan, L. M., Tavaria, M., Weaver, B., Reich, N. C., Kola, I., and Hertzog, P. J. (1997) Cloning and Characterization of Soluble and Transmembrane Isoforms of a Novel Component of the Murine Type I Interferon Receptor, IFNAR 2. J. Biol. Chem. 272, 23865-23870.

   6.  Pestka, S., Krause, C. D., and Walter, M. R. (2004) Interferons, interferon-like cytokines, and their receptors, Immunol. Rev. 202, 8-32.

   7.  de Weerd, N. A., Samarajiwa, S. A., and Hertzog, P. J. (2007) Type I interferon receptors: biochemistry and biological functions, J Biol. Chem. 282, 20053-20057.  

   8.  Uze, G., Di, M. S., Mouchel-Vielh, E., Monneron, D., Bandu, M. T., Horisberger, M. A., Dorques, A., Lutfalla, G., and Mogensen, K. E. (1994) Domains of interaction between alpha interferon and its receptor components, J Mol. Biol. 243, 245-257.

   9.  Runkel, L., deDios, C., Karpusas, M., Betzenhauser, M., Muldowney, C., Zafari, M., Benjamin, C. D., Miller, S., Hochman, P. S., and Whitty, A. (2000) Systematic mutational mapping of sites on human interferon-beta-1a that are important for receptor binding and functional activity, Biochemistry 39, 2538-2551.

 10.  Cajean-Feroldi, C., Nosal, F., Nardeux, P. C., Gallet, X., Guymarho, J., Baychelier, F., Sempe, P., Tovey, M. G., Escary, J. L., and Eid, P. (2004) Identification of residues of the IFNAR1 chain of the type I human interferon receptor critical for ligand binding and biological activity, Biochemistry 43, 12498-12512.

 11.  Jaks, E., Gavutis, M., Uze, G., Martal, J., and Piehler, J. (2007) Differential receptor subunit affinities of type I interferons govern differential signal activation, J Mol. Biol. 366, 525-539.

 12.  Chill, J. H., Quadt, S. R., Levy, R., Schreiber, G., and Anglister, J. (2003) The Human Type I Interferon Receptor: NMR Structure Reveals the Molecular Basis of Ligand Binding. Structure. 11, 791-802.

 13.  Lewerenz, M., Mogensen, K. E., and Uze, G. (1998) Shared Receptor Components but Distinct Complexes for Alpha and Beta Interferons. J. Mol. Biol. 282, 585-599.

 14.  Piehler, J., and Schreiber, G. (1999) Mutational and Structural Analysis of the Binding Interface between Type I Interferons and their Receptor Ifnar2. J. Mol. Biol. 294, 223-237.

 15.  Cohen, B., Novick, D., Barak, S., and Rubinstein, M. (1995) Ligand-Induced Association of the Type I Interferon Receptor Components. Mol. Cell. Biol. 15, 4208-4214.

 16.  Platanias, L. C. (2005) Mechanisms of type-I- and type-II-interferon-mediated signalling, Nat. Rev. Immunol. 5, 375-386.

 17.  Takaoka, A. and Yanai, H. (2006) Interferon signalling network in innate defence, Cell Microbiol. 8, 907-922.

 18.  Zhao, W., Lee, C., Piganis, R., Plumlee, C., de, W. N., Hertzog, P. J., and Schindler, C. (2008) A conserved IFN-alpha receptor tyrosine motif directs the biological response to type I IFNs, J Immunol. 180, 5483-5489.

 19.  Colamonici, O., Yan, H., Domanski, P., Handa, R., Smalley, D., Mullersman, J., Witte, M., Krishnan, K., and Krolewski, J. (1994) Direct binding to and tyrosine phosphorylation of the alpha subunit of the type I interferon receptor by p135tyk2 tyrosine kinase, Mol. Cell Biol. 14, 8133-8142.

 20.  Yan, H., Krishnan, K., Lim, J. T., Contillo, L. G., and Krolewski, J. J. (1996) Molecular characterization of an alpha interferon receptor 1 subunit (IFNaR1) domain required for TYK2 binding and signal transduction, Mol. Cell Biol. 16, 2074-2082.

 21.  Wagner, T. C., Velichko, S., Vogel, D., Rani, M. R., Leung, S., Ransohoff, R. M., Stark, G. R., Perez, H. D., and Croze, E. (2002) Interferon Signaling is Dependent on Specific Tyrosines Located within the Intracellular Domain of IFNAR2c. Expression of IFNAR2c Tyrosine Mutants in U5A Cells. J. Biol. Chem. 277, 1493-1499.

 22.  Nadeau, O. W., Domanski, P., Usacheva, A., Uddin, S., Platanias, L. C., Pitha, P., Raz, R., Levy, D., Majchrzak, B., Fish, E., and Colamonici, O. R. (1999) The Proximal Tyrosines of the Cytoplasmic Domain of the Beta Chain of the Type I Interferon Receptor are Essential for Signal Transducer and Activator of Transcription (Stat) 2 Activation. Evidence that Two Stat2 Sites are Required to Reach a Threshold of Interferon Alpha-Induced Stat2 Tyrosine Phosphorylation that Allows Normal Formation of Interferon-Stimulated Gene Factor 3. J. Biol. Chem. 274, 4045-4052.

 23.  Li, X., Leung, S., Kerr, I. M., and Stark, G. R. (1997) Functional subdomains of STAT2 required for preassociation with the alpha interferon receptor and for signaling, Mol. Cell Biol. 17, 2048-2056.

 24.  Nguyen, V. P., Saleh, A. Z., Arch, A. E., Yan, H., Piazza, F., Kim, J., and Krolewski, J. J. (2002) Stat2 Binding to the Interferon-Alpha Receptor 2 Subunit is Not Required for Interferon-Alpha Signaling. J. Biol. Chem. 277, 9713-9721.

 25.  Saleh, A. Z., Nguyen, V. P., and Krolewski, J. J. (2002) Affinity of Stat2 for the Subunits of the Interferon Alpha Receptor. Biochemistry. 41, 11261-11268.

 26.  Tang, X., Gao, J. S., Guan, Y. J., McLane, K. E., Yuan, Z. L., Ramratnam, B., and Chin, Y. E. (2007) Acetylation-Dependent Signal Transduction for Type I Interferon Receptor. Cell. 131, 93-105.

 27.  Croze, E., Usacheva, A., Asarnow, D., Minshall, R. D., Perez, H. D., and Colamonici, O. (2000) Receptor for Activated C-Kinase (RACK-1), a WD Motif-Containing Protein, Specifically Associates with the Human Type I IFN Receptor. J. Immunol. 165, 5127-5132.

 28.  Malakhova, O. A., Kim, K. I., Luo, J. K., Zou, W., Kumar, K. G., Fuchs, S. Y., Shuai, K., and Zhang, D. E. (2006) UBP43 is a Novel Regulator of Interferon Signaling Independent of its ISG15 Isopeptidase Activity. EMBO J. 25, 2358-2367.

 29.  Platanias, L. C., Domanski, P., Nadeau, O. W., Yi, T., Uddin, S., Fish, E., Neel, B. G., and Colamonici, O. R. (1998) Identification of a Domain in the Beta Subunit of the Type I Interferon (IFN) Receptor that Exhibits a Negative Regulatory Effect in the Growth Inhibitory Action of Type I IFNs. J. Biol. Chem. 273, 5577-5581.

 30.  Hardy, M. P., Owczarek, C. M., Trajanovska, S., Liu, X., Kola, I., and Hertzog, P. J. (2001) The Soluble Murine Type I Interferon Receptor Ifnar-2 is Present in Serum, is Independently Regulated, and has both Agonistic and Antagonistic Properties. Blood. 97, 473-482.

 31.  Hardy, M. P., Hertzog, P. J., and Owczarek, C. M. (2002) Multiple Regions within the Promoter of the Murine Ifnar-2 Gene Confer Basal and Inducible Expression. Biochem. J. 365, 355-367.

 32.  Novick, D., Cohen, B., and Rubinstein, M. (1992) Soluble Interferon-Alpha Receptor Molecules are Present in Body Fluids. FEBS Lett. 314, 445-448.

 33.  van Boxel-Dezaire, A. H., Rani, M. R., and Stark, G. R. (2006) Complex modulation of cell type-specific signaling in response to type I interferons, Immunity 25, 361-372.

 34.  Hwang, S. Y., Hertzog, P. J., Holland, K. A., Sumarsono, S. H., Tymms, M. J., Hamilton, J. A., Whitty, G., Bertoncello, I., and Kola, I. (1995) A null mutation in the gene encoding a type I interferon receptor component eliminates antiproliferative and antiviral responses to interferons alpha and beta and alters macrophage responses, Proc. Natl. Acad. Sci. U. S A 92, 11284-11288.

 35.  Muller, U., Steinhoff, U., Reis, L. F., Hemmi, S., Pavlovic, J., Zinkernagel, R. M., and Aguet, M. (1994) Functional role of type I and type II interferons in antiviral defense, Science 264, 1918-1921.

 36.  Fenner, J. E., Starr, R., Cornish, A. L., Zhang, J. G., Metcalf, D., Schreiber, R. D., Sheehan, K., Hilton, D. J., Alexander, W. S., and Hertzog, P. J. (2006) Suppressor of cytokine signaling 1 regulates the immune response to infection by a unique inhibition of type I interferon activity, Nat. Immunol. 7, 33-39.

 37.  Tanaka, N., Sato, M., Lamphier, M. S., Nozawa, H., Oda, E., Noguchi, S., Schreiber, R. D., Tsujimoto, Y., and Taniguchi, T. (1998) Type I interferons are essential mediators of apoptotic death in virally infected cells, Genes Cells 3, 29-37.

 38.  Pestka, S., Langer, J. A., Zoon, K. C., and Samuel, C. E. (1987) Interferons and their actions, Annu. Rev. Biochem. 56, 727-777.

 39.  Biron, C. A., Nguyen, K. B., Pien, G. C., Cousens, L. P., and Salazar-Mather, T. P. (1999) Natural killer cells in antiviral defense: function and regulation by innate cytokines, Annu. Rev. Immunol. 17, 189-220.

 40.  Decker, T., Muller, M., and Stockinger, S. (2005) The yin and yang of type I interferon activity in bacterial infection, Nat. Rev. Immunol. 5, 675-687.

 41.  Qiu, H., Fan, Y., Joyee, A. G., Wang, S., Han, X., Bai, H., Jiao, L., Van, R. N., and Yang, X. (2008) Type I IFNs enhance susceptibility to Chlamydia muridarum lung infection by enhancing apoptosis of local macrophages, J Immunol. 181, 2092-2102.

 42.  Kaisho, T. (2008) Type I interferon production by nucleic acid-stimulated dendritic cells, Front Biosci. 13, 6034-6042.

 43.  Honda, K., Ohba, Y., Yanai, H., Negishi, H., Mizutani, T., Takaoka, A., Taya, C., and Taniguchi, T. (2005) Spatiotemporal regulation of MyD88-IRF-7 signalling for robust type-I interferon induction, Nature 434, 1035-1040.

 44.  Kawai, T. and Akira, S. (2006) Innate immune recognition of viral infection, Nat. Immunol. 7, 131-137.

 45.  Sharma, S., tenOever, B. R., Grandvaux, N., Zhou, G. P., Lin, R., and Hiscott, J. (2003) Triggering the interferon antiviral response through an IKK-related pathway, Science 300, 1148-1151.

 46.  Theofilopoulos, A. N., Baccala, R., Beutler, B., and Kono, D. H. (2005) Type I Interferons (a/b) in Immunity and Autoimmunity, Annu. Rev. Immunol.

 47.  Marie, I., Durbin, J. E., and Levy, D. E. (1998) Differential viral induction of distinct interferon-alpha genes by positive feedback through interferon regulatory factor-7, EMBO J 17, 6660-6669.

 48.  Sato, M., Hata, N., Asagiri, M., Nakaya, T., Taniguchi, T., and Tanaka, N. (1998) Positive feedback regulation of type I IFN genes by the IFN-inducible transcription factor IRF-7, FEBS Lett 441, 106-110.

 49.  Decker, T., Lew, D. J., and Darnell, J. E., Jr. (1991) Two distinct alpha-interferon-dependent signal transduction pathways may contribute to activation of transcription of the guanylate-binding protein gene, Mol. Cell Biol. 11, 5147-5153.

 50.  Takaoka, A., Mitani, Y., Suemori, H., Sato, M., Yokochi, T., Noguchi, S., Tanaka, N., and Taniguchi, T. (2000) Cross talk between interferon-gamma and -alpha/beta signaling components in caveolar membrane domains, Science 288, 2357-2360.

 51.  Tanabe, Y., Nishibori, T., Su, L., Arduini, R. M., Baker, D. P., and David, M. (2005) Cutting edge: role of STAT1, STAT3, and STAT5 in IFN-alpha beta responses in T lymphocytes, J Immunol. 174, 609-613.

 52.  Curtsinger, J. M., Valenzuela, J. O., Agarwal, P., Lins, D., and Mescher, M. F. (2005) Type I IFNs provide a third signal to CD8 T cells to stimulate clonal expansion and differentiation, J Immunol. 174, 4465-4469.

 53.  Garcia-Sastre, A. and Biron, C. A. (2006) Type 1 interferons and the virus-host relationship: a lesson in detente, Science 312, 879-882.

 54.  Gil, M. P., Salomon, R., Louten, J., and Biron, C. A. (2006) Modulation of STAT1 protein levels: a mechanism shaping CD8 T-cell responses in vivo, Blood 107, 987-993.

 55.  Gamero, A. M., Potla, R., Wegrzyn, J., Szelag, M., Edling, A. E., Shimoda, K., Link, D. C., Dulak, J., Baker, D. P., Tanabe, Y., Grayson, J. M., and Larner, A. C. (2006) Activation of Tyk2 and Stat3 is required for the apoptotic actions of interferon-beta in primary pro-B cells, J Biol. Chem. 281, 16238-16244.

 56.  Liang, S., Wei, H., Sun, R., and Tian, Z. (2003) IFNalpha regulates NK cell cytotoxicity through STAT1 pathway, Cytokine 23, 190-199.

 57.  Wong, L. H., Sim, H., Chatterjee-Kishore, M., Hatzinisiriou, I., Devenish, R. J., Stark, G., and Ralph, S. J. (2002) Isolation and characterization of a human STAT1 gene regulatory element. Inducibility by interferon (IFN) types I and II and role of IFN regulatory factor-1, J Biol. Chem. 277, 19408-19417.

 58.  Yang, C. H., Murti, A., Pfeffer, S. R., Fan, M., Du, Z., and Pfeffer, L. M. (2008) The role of TRAF2 binding to the type I interferon receptor in alternative NF kappaB activation and antiviral response, J Biol. Chem. 283, 14309-14316.

 59.  Chung, C. D., Liao, J., Liu, B., Rao, X., Jay, P., Berta, P., and Shuai, K. (1997) Specific inhibition of Stat3 signal transduction by PIAS3, Science 278, 1803-1805.

 60.  Symons, J. A., Alcami, A., and Smith, G. L. (1995) Vaccinia virus encodes a soluble type I interferon receptor of novel structure and broad species specificity, Cell 81, 551-560.

 61.  Hafler, D. A. (2004) Multiple sclerosis, J Clin. Invest 113, 788-794.

 62.  Teige, I., Treschow, A., Teige, A., Mattsson, R., Navikas, V., Leanderson, T., Holmdahl, R., and Issazadeh-Navikas, S. (2003) IFN-beta gene deletion leads to augmented and chronic demyelinating experimental autoimmune encephalomyelitis, J Immunol. 170, 4776-4784.

 63.  Guo, B., Chang, E. Y., and Cheng, G. (2008) The type I IFN induction pathway constrains Th17-mediated autoimmune inflammation in mice, J Clin. Invest 118, 1680-1690.

 64.  Prinz, M., Schmidt, H., Mildner, A., Knobeloch, K. P., Hanisch, U. K., Raasch, J., Merkler, D., Detje, C., Gutcher, I., Mages, J., Lang, R., Martin, R., Gold, R., Becher, B., Bruck, W., and Kalinke, U. (2008) Distinct and nonredundant in vivo functions of IFNAR on myeloid cells limit autoimmunity in the central nervous system, Immunity 28, 675-686.

 65.  Leyva, L., Fernandez, O., Fedetz, M., Blanco, E., Fernandez, V. E., Oliver, B., Leon, A., Pinto-Medel, M. J., Mayorga, C., Guerrero, M., Luque, G., Alcina, A., and Matesanz, F. (2005) IFNAR1 and IFNAR2 polymorphisms confer susceptibility to multiple sclerosis but not to interferon-beta treatment response, J Neuroimmunol. 163, 165-171.

 66.  Frodsham, A. J., Zhang, L., Dumpis, U., Taib, N. A., Best, S., Durham, A., Hennig, B. J., Hellier, S., Knapp, S., Wright, M., Chiaramonte, M., Bell, J. I., Graves, M., Whittle, H. C., Thomas, H. C., Thursz, M. R., and Hill, A. V. (2006) Class II Cytokine Receptor Gene Cluster is a Major Locus for Hepatitis B Persistence. Proc. Natl. Acad. Sci. U. S. A. 103, 9148-9153.

 67.  Kola, I. and Hertzog, P. J. (1997) Animal models in the study of the biological function of genes on human chromosome 21 and their role in the pathophysiology of Down syndrome, Hum. Mol. Genet 6, 1713-1727.

 68.  Mizukoshi, E., Kaneko, S., Kaji, K., Terasaki, S., Matsushita, E., Muraguchi, M., Ohmoto, Y., and Kobayashi, K. (1999) Serum Levels of Soluble Interferon Alfa/Beta Receptor as an Inhibitory Factor of Interferon in the Patients with Chronic Hepatitis C. Hepatology. 30, 1325-1331.

 69.  Ambrus JL, S., Dembinski, W., Ambrus, J. L.,Jr, Sykes, D. E., Akhter, S., Kulaylat, M. N., Islam, A., and Chadha, K. C. (2003) Free Interferon-alpha/beta Receptors in the Circulation of Patients with Adenocarcinoma. Cancer. 98, 2730-2733.

 70.  Saito, T., Ji, G., Shinzawa, H., Okumoto, K., Hattori, E., Adachi, T., Takeda, T., Sugahara, K., Ito, J. I., Watanabe, H., Saito, K., Togashi, H., Ishii, K., Matsuura, T., Inageda, K., Muramatsu, M., and Kawata, S. (2004) Genetic variations in humans associated with differences in the course of hepatitis C, Biochem. Biophys. Res. Commun. 317, 335-341.

 71.  Han, C. S., Chen, Y., Ezashi, T., and Roberts, R. M. (2001) Antiviral Activities of the Soluble Extracellular Domains of Type I Interferon Receptors. Proc. Natl. Acad. Sci. U. S. A. 98, 6138-6143.

 72.  Dupuis, S., Jouanguy, E., Al-Hajjar, S., Fieschi, C., Al-Mohsen, I. Z., Al-Jumaah, S., Yang, K., Chapgier, A., Eidenschenk, C., Eid, P., Al, G. A., Tufenkeji, H., Frayha, H., Al-Gazlan, S., Al-Rayes, H., Schreiber, R. D., Gresser, I., and Casanova, J. L. (2003) Impaired response to interferon-alpha/beta and lethal viral disease in human STAT1 deficiency, Nat. Genet 33, 388-391.

 73.  Minegishi, Y., Saito, M., Tsuchiya, S., Tsuge, I., Takada, H., Hara, T., Kawamura, N., Ariga, T., Pasic, S., Stojkovic, O., Metin, A., and Karasuyama, H. (2007) Dominant-negative mutations in the DNA-binding domain of STAT3 cause hyper-IgE syndrome, Nature 448, 1058-1062.

 74.  Minegishi, Y., Saito, M., Morio, T., Watanabe, K., Agematsu, K., Tsuchiya, S., Takada, H., Hara, T., Kawamura, N., Ariga, T., Kaneko, H., Kondo, N., Tsuge, I., Yachie, A., Sakiyama, Y., Iwata, T., Bessho, F., Ohishi, T., Joh, K., Imai, K., Kogawa, K., Shinohara, M., Fujieda, M., Wakiguchi, H., Pasic, S., Abinun, M., Ochs, H. D., Renner, E. D., Jansson, A., Belohradsky, B. H., Metin, A., Shimizu, N., Mizutani, S., Miyawaki, T., Nonoyama, S., and Karasuyama, H. (2006) Human tyrosine kinase 2 deficiency reveals its requisite roles in multiple cytokine signals involved in innate and acquired immunity, Immunity 25, 745-755.

 75.  Karaghiosoff, M., Neubauer, H., Lassnig, C., Kovarik, P., Schindler, H., Pircher, H., McCoy, B., Bogdan, C., Decker, T., Brem, G., Pfeffer, K., and Muller, M. (2000) Partial impairment of cytokine responses in Tyk2-deficient mice, Immunity 13, 549-560.