Allele | bandit | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 12 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 24,628,025 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ T (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Grhl1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | grainyhead like transcription factor 1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | p70 MGR, Tcfcp2l2, p61 MGR, LBP-32 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 24,622,282-24,667,390 bp (+) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein can exist as a homodimer or can form heterodimers with sister-of-mammalian grainyhead or brother-of-mammalian grainyhead. This protein functions as a transcription factor during development. [provided by RefSeq, Jun 2009] PHENOTYPE: Mice homozygous for a null allele display alopecia or sparse hair, abnormal hair follicle root sheaths, thickening of the cornified layer on the paws, and postnatal growth retardation. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Arginine changed to Isoleucine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q921D9 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000020985 Gene: ENSMUSG00000020656
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000082689 Gene: ENSMUSG00000020656 AA Change: R72I
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Sperm, gDNA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 032641-UNC | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2016-05-13 3:09 PM by Stephen Lyon | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2009-10-27 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The bandit phenotype was detected in a G3 mouse and is characterized by small body size and patchy fur over the body, with fur remaining on the face (Figure 1). Homozygous bandit mice had normal serum iron concentration; occult blood was not detected in the feces. No abnormalities were found in the hematology profile. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
The bandit mutation was mapped to Chromosome 12. Grhl1 was identified as a candidate within the critical region because knockout of the gene in mice causes a phenotype similar to bandit (1). An A to T transversion was found at position 25,262,891 of the C57BL/6J mouse genomic DNA sequence of Chromosome 12, within exon 3 of the Grhl1 gene (exons 1-3 are not included in the NCBI Genbank annotation of the genomic DNA sequence of Grhl1, region NC_000078). Two isoforms of Grhl1 are expressed due to alternative splicing. Isoform 1 is the full length variant in which 16 exons are incorporated into a processed mRNA 3435 base pairs in length, encoding a 618 amino acid protein. Isoform 2 is transcribed to incorporate 14 exons (exons 4-16 plus one unique exon) and yields a processed mRNA 3066 base pairs in length, encoding a 536 amino acid protein. The residue mutated in bandit mice corresponds to nucleotide 366 in the mRNA sequence of Grhl1 isoform 1. The mutation occurs in exon 3, which is absent from and therefore predicted not to affect isoform 2.
isoform 1:
<--exon 2 exon 3-->
351 TACTACAAG GTCCCCAGAGAGCGCCGGTCATCA
67 -Y--Y--K- -V--P--R--E--R--R--S--S-
The mutated nucleotide is indicated in red lettering, and converts arginine 72 of the Grhl1 protein (isoform 1) to a stop.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Grhl1 is a member of the Grainyhead (GRH) family of transcription factors, named for a Drosophila gene that when mutated results in fly embryos with grainy and discontinuous head skeletons, flimsy cuticles, and patchy tracheal tubes (2). GRH transcription factors, acting both as repressors and activators, function in a wide variety of physiological processes during development and in mature organisms from fungi to humans (see Background). The family is divided into two subfamilies grouped by sequence similarity of their DNA binding and oligomerization domains (Table 1) (3;4). Some similarity also exists in the sequences of DNA binding domains between subfamilies, but not in the sequences of oligomerization domains (3). Drosophila Grainyhead (also designated NTF-1 or Elf-1) belongs to the GRH subfamily (2;5), while Drosophila CP2 aligns with the LSF/CP2 subfamily (4).
Table 1. Mammalian GRH transcription factors
GRH transcription factors from both subfamilies typically possess DNA binding, oligomerization, and transactivation domains as determined by deletion and mutational analysis of CP2 and Grainyhead, the best studied members of the family (6-10). The DNA binding regions of Grainyhead and CP2 encompass ~250 amino acids in the C-terminal and N-terminal halves of these proteins, respectively (6;7;9). Although the Grainyhead DNA binding domain was reported to show minimal similarity to a region of MyoD and myogenin with helix-loop-helix structure (22% over 90 amino acids) (5;11), the Grainyhead/CP2 domain is much larger. No similarity to other known DNA binding motifs is observed, but computer modeling using fold recognition and protein structure prediction programs suggests a fold homologous to that of the p53 core domain (12). Characterization of the preferred binding site of CP2 based on the known sequences of binding sites within the α-globin and SV40 gene promoters demonstrated that CP2 binds to a pair of directly repeated sequences with consensus CNRG-N6-CNRG, where N is any nucleotide and R is a purine (13-15). The spacing of the repeated elements is restricted to position the repeats on the same face of the DNA helix. Grainyhead binds to a similar repeated sequence, CTGG, within the gene promoters of Ultrabithorax (Ubx), dopa decarboxylase (Ddc), and fushi tarazu (ftz) (5).
GRH proteins function as homodimers or oligomers of members from the same subfamily. Using deletion mutants in crosslinking, GST pull-down, and yeast two-hybrid experiments, the oligomerization domains of Grainyhead and CP2 were mapped to an ~80-100 amino acid region that may partially overlap with the C-terminal portion of the DNA binding domain (6;7;9). In CP2, the domain displays similarity to the sterile alpha motif (SAM), which has been shown to mediate homo- and hetero-oligomerization (12;16). Despite 29% sequence identity in their oligomerization domains, Grainyhead has been shown to form dimers (9) whereas CP2 forms tetramers on DNA (6). These findings are consistent with intrinsic (perhaps structural) differences between the oligomerization domains of proteins from the two GRH subfamilies, which do not hetero-oligomerize across subfamily boundaries (4;7). Similarity between the subfamilies may reflect similarity in recognition of the consensus binding site within the DNA.
Mapping of the transactivation domain of Grainyhead using deletion constructs demonstrated that an N-terminal 56 amino acid region functions as the minimal activation domain (9). Grainyhead has been reported to interact with components of the TFIID complex to mediate transactivation (17).
The bandit mutation, a premature stop, lies in exon 3 of the full length isoform 1, within the region defined by transcriptional reporter assay as the transactivation domain.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization |
In situ hybridization in mouse embryonic tissue demonstrates Grhl1 expression predominantly in the epidermis (4). Grhl1 is detectable in the surface ectoderm at embryonic day 10.5 (19), and in the skin and developing hair germs by embryonic day 15.5 (1). In postnatal animals, expression of Grhl1 is restricted to the suprabasal layers of the skin and to the hair follicles (1). Grhl1 is presumed to localize in the nucleus, like Grainyhead (11) and Grhl3 (20).
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
Drosophila Grainyhead
Grainyhead was first identified in Drosophila through its ability to bind to a cis element mediating transcriptional activation of the dopa decarboxylase (Ddc) gene (5;11;21). The gene, initially named Elf-1 (element I-binding activity) or NTF-1 (neuronal transcription factor 1), was later shown to be identical to Grainyhead (grh) (2), a previously identified embryonic lethal locus on Chromosome 2 (22). Grainyhead mutant flies die at the end of embryogenesis with normal segmentation but altered head skeleton and cuticular structures. The head skeleton has a granular appearance, and the cuticle is bulging, distended, and easily ruptured (2). Other cuticular structures such as mouth hooks and denticles are also affected. The tracheal network appears patchy, resulting from failure of an overextended and elaborated tracheal tree to fill with gas (23). Consistent with an important role for Grainyhead in cuticle formation, impaired wound healing of the larval cuticle is observed in grh mutant flies (24).
During development of the newly fertilized fly embryo, Grainyhead is initially involved in dorsal/ventral patterning through repression of decapentaplegic and zerknüllt gene transcription (25). Grainyhead also mediates localized repression of the tailless gene in the central portion of the embryo, restricting tailless expression to the poles during early embryogenesis (26). Embryonic patterning defects are not observed in grh mutant embryos due to maternal provision of grh mRNA to oocytes and early embryos (25;26). Instead, the cuticular defects observed later in embryonic development are thought to arise from aberrant regulation of Grainyhead targets in the epidermis (responsible for embryonic cuticle secretion) where Grainyhead is predominantly expressed (11). The epidermal expression of Ddc, required for production of dopamine and subsequently quinones that crosslink cuticular proteins, is abrogated in grh mutant embryos, resulting in weakening of the cuticle and defective cuticle wound healing (24;27). However, expression of engrailed (28), ftz, and Ubx (5;29), genes responsive to Grainyhead regulation in vitro, was not affected in grh mutant fly embryos (2). Grainyhead has been shown to regulate PCNA expression in vitro (30), and to cooperate synergistically with Suppressor of Hairless [Su(H)] to activate transcription in response to Notch signaling during cell fate decisions in vivo (31).
Central nervous system (CNS) development in Drosophila requires Grainyhead. An isoform of Grainyhead generated by alternative splicing is specifically expressed in neuroblasts during embryogenesis (11;32), and is activated there during late stages of neuroblast lineage development (33). Deficiency of this isoform results in pupal and adult lethality with flies demonstrating uncoordinated movements (32). Grainyhead is the last gene to be activated in the temporal sequence of transcription factor activation in neuroblasts, and has been shown to regulate neuroblast mitotic activity during larval stages, in particular to either terminate (in the abdomen) or prolong proliferation (in the thorax) (33-36).
Mammalian GRH proteins
Members of the LSF/CP2 subfamily of GRH transcription factors are ubiquitously expressed and regulate transcription in a variety of settings. The most extensively studied member, CP2, was identified as a factor binding to elements in the simian virus 40 (SV40) late promoter and in the human immunodeficiency virus type 1 (HIV-1) promoter (37;38). Further study demonstrated that CP2 binds near the transcription start site of the HIV-1 long terminal repeat (LTR) and represses transcription by inhibiting the binding of TFIID to the TATA box (8;39), and by preserving higher order nucleosome structure through the recruitment of histone deacetylase 1 in cooperation with the transcription factor YY1 (40). In addition, CP2 can restrict HIV-1 transcription at the level of elongation by reducing RNA polymerase processivity (41). The repression of HIV-1 transcription by CP2 has been postulated as a mechanism underlying the establishment of virological latency in vivo.
CP2 binds to the regulatory regions of diverse genes. For example, CP2 activates transcription of multiple erythroid-specific genes and all globin genes (10;14;42;43), and mediates hemoglobin switching as part of the stage selector protein complex that regulates developmental globin expression (44;45). In T cells, CP2 DNA-binding activity is increased upon cell activation with PMA/ionomycin, an effect that may be regulated by ERK phosphorylation of CP2 (46;47). CP2 has also been shown to bind to the interleukin (IL)-4 promoter in T helper cells (48). Notably, CP2 deficient mice grow and develop normally, and display normal hematopoietic differentiation, globin gene expression, and immunological responses to mitogenic T cell and B cell stimulation (49). LBP-1a (also known as Ubp1 and NF2d9), which is 72% identical to CP2 in amino acid sequence and can bind to known CP2 consensus sites, is thought to compensate for the loss of CP2 function. LBP-1a deficient mice die at embryonic day 11.5, with defects in blood vessels of the placenta (50). CP2 is reported to bind in vitro to the promoters of c-fos, ornithine decarboxylase (47), major histocompatibility class II (51), thymidylate synthase (6), and P450scc genes (52).
The closest mammalian homologues of Drosophila Grainyhead are Grhl1, Grhl2, and Grhl3, only recently identified by database searches for mammalian proteins with sequence similarity to Grainyhead (4;20;53). These three proteins form the GRH subfamily. Similar to Grainyhead, the mammalian proteins are not ubiquitously expressed, but display restricted expression predominantly in tissues derived from the ectoderm; all three genes are highly expressed in the embryonic epidermis, although at differing levels and times (19). The function of Grainyhead in the development and maintenance of the Drosophila cuticle is conserved in mice by Grhl3. Grhl3-/- mice display defective skin barrier function, deficient wound repair, and reduced expression of multiple genes linked to epidermal terminal differentiation and barrier function, including transglutaminase I, the key enzyme involved in crosslinking structural components of the superficial epidermis (18;54;55). Thus, the role of Ghrl3 is analogous to that of Grainyhead in the regulation of Ddc in the fly cuticle. Expression of the three Grhls is also observed in non-ectoderm-derived tissues, including brain, heart, lung, and kidney (19;53). Grhl3 is essential for neural tube closure during mouse embryonic development (56).
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism |
The bandit mutation creates a premature stop codon in the transactivation domain of the full length Grhl1 isoform 1. The shorter isoform 2 is not predicted to be affected by the bandit mutation, but protein expression of this isoform has not been examined in bandit mice. The phenotype of homozygous bandit mice closely resembles that of Grhl1 null mice, in which targeted deletion of exons 1 and 2 results in a confirmed lack of expression of both Grhl1 isoforms. This is consistent with a complete lack of protein expression resulting from the early stop codon in bandit homozygotes. The function of isoform 2, if expressed, is apparently insufficient to rescue the phenotype of homozygous bandit mice.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping |
Bandit genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
Primers
bandit (F): 5’- TGCCTGTTTGGACCATGTCTCAGC -3’
bandit (R): 5’-GGGTCTCAATGCAGATGAGCAAACAC -3’
PCR program
1) 95°C 2:00
2) 95°C 0:30
3) 56°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 29X
6) 72°C 7:00
7) 4°C ∞
Primers for sequencing
bandit_seq(F): 5’- CCCAGCATTTAGGAGCATTG -3’
bandit_seq(R): 5’- ACCAGTAGAGGTTGGTGCTC -3’
The following sequence of 941 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 12, bases 25,262,288 to 25,263,228) is amplified:
tg cctgtttgga ccatgtctca gctgggttaa
tgtcacggtg taccagtgtc atttttccag cttttcagct ctggggcaaa gaaaagggga
gtcagacaag gagtggaatg gagccagaga gatggcccag catttaggag cattggctgc
tctttcagag gaccctggtt cagttcccag cacccacatg gtgactcaaa gccatctcta
actgcagttc cagggtatcc gatgcattct tctgaccctg ggcaccattc acacatgtgg
tatacagaca taggtacagg ccaaacattc atacatgaaa aaaccaaaat acatacctta
aattttaaag aagaaagaaa tctttactcc cactataaag taagtttgtg atcccacaag
tctatttggc agttgctctt taccggttgc tgtggtgatc agactgttgg ctccttgagg
gcagatgttg cccagggctc agcaggtagt caggagatga gtgaaccaaa gagcatcctg
agaaatgaaa ggtttcttct tcaggtgaag aaggcttctc ccctgaataa ggactgagtc
cctctcattg atgttgacac tttaggtccc cagagagcgc cggtcatcag ccgtaaagcc
cgagggagag cacccagagc cagagcacag caaaaggtga gtgctcccta cagcagcaca
gcagcagaca ggtgatgaca agtgaagagg cagggctttg ccaagcagac ccgggaagct
cctggtgggt gagaccgtag agggacctct gtcacctcag ggtcagattc tgttgctgat
ttgcctctga gaagttatgt ttatttagtc tgtgttcccc ttcccagaaa acatgagcac
caacctctac tggtccggag ggaggtttta ataaaagcct ggagtgtttg ctcatctgca
ttgagaccc
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References |
22. Nusslein-Volhard, C., Wieschaus, E., and Kluding, H. (1984) Mutations Affecting the Pattern of the Larval Cuticle in Drosophila Melanogaster. Wilhelms Roux's Arch Dev Biol. 193, 267-282.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Eva Marie Y. Moresco | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Amanda L. Blasius, Xin Du, Bruce Beutler |