Phenotypic Mutation 'Baby'

• Allele: Baby
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 23,165,052 bp (GRCm39)
• Base Change: T ⇒ G (forward strand)
• Gene: Ikbkb
• Gene Name: inhibitor of kappaB kinase beta
• Synonym(s): IKK[b], IKK-beta, IKK-2, IKK2, IKKbeta
• Chromosomal Location: 23,149,228-23,196,605 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene phosphorylates the inhibitor in the inhibitor/NF-kappa-B complex, causing dissociation of the inhibitor and activation of NF-kappa-B. The encoded protein itself is found in a complex of proteins. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Sep 2011] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit liver degeneration and die in midgestation. Conditional mutations that lack gene expression in lymphoid cells or epidermal keratinocytes exhibit B and T cell deficits and skin inflammation, respectively. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Leucine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000033939] [ENSMUSP00000064235] [ENSMUSP00000138156 ^†] [ENSMUSP00000138378 ^†] † probably from a misspliced transcript
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000033939; Gene: ENSMUSG00000031537; AA Change: I243L

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	15	247	1.2e-38	PFAM
Pfam:Pkinase	15	296	1.2e-54	PFAM
Pfam:Kdo	31	176	1.3e-7	PFAM
IKKbetaNEMObind	705	742	4.71e-16	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
  (Using ENSMUST00000033939)
• SMART Domains: Protein: ENSMUSP00000064235; Gene: ENSMUSG00000031537; AA Change: I243L

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	15	247	7.3e-39	PFAM
Pfam:Pkinase	15	296	6.9e-56	PFAM
Pfam:Kdo	44	177	3e-8	PFAM
IKKbetaNEMObind	705	737	1.83e-4	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
  (Using ENSMUST00000063401)
• SMART Domains: Protein: ENSMUSP00000138156; Gene: ENSMUSG00000031537; AA Change: I243L

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	15	248	2.8e-38	PFAM
Pfam:Pkinase	15	296	2.5e-55	PFAM
Pfam:Kdo	43	177	1.4e-7	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000125314)
• SMART Domains: Protein: ENSMUSP00000138378; Gene: ENSMUSG00000031537; AA Change: I243L

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	15	248	2.8e-38	PFAM
Pfam:Pkinase	15	296	2.5e-55	PFAM
Pfam:Kdo	43	177	1.4e-7	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
  (Using ENSMUST00000135326)
• Meta Mutation Damage Score: 0.3228
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:26 PM by Anne Murray
• Record Created: 2019-04-04 7:59 AM by Bruce Beutler
• Record Posted: 2019-04-19
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001159774, NM_010546; MGI:1338071

Alleles Listed at MGI

All Mutations and Alleles(19) : Chemically induced (ENU)(1) Gene trapped(2) Targeted(12) Transgenic(4)

Phenotypic Description

Figure 1. Baby mice exhibit decreased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Baby phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6738, some of which showed reduced frequencies of central memory CD4 T cells in CD4 T cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced central memory CD4 T cell frequency using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 56 mutations (X-axis) identified in the G1 male of pedigree R6738. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. The reduced central memory CD4 T cell frequency phenotype was linked by continuous variable mapping to a mutation in Ikbkb:  an A to C transversion at base pair 22,675,036 (v38) on chromosome 8, or base pair 31,556 in the GenBank genomic region NC_000074. Linkage was found with a dominant model of inheritance, wherein seven variant homozygotes and 21 heterozygous mice departed phenotypically from 12 homozygous reference mice with a P value of 2.047 x 10^-7 (Figure 2).  

The mutation corresponds to residue 859 in the mRNA sequence NM_001159774 (variant 1) within exon 9 of 22 total exons.

844 AAGAGCGAAGTGGACATCGTTGTTAGTGAAGAC 238 -K--S--E--V--D--I--V--V--S--E--D-

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine to leucine substitution at position 243 (I243L) in both isoforms of the inhibitor of kappa-B kinase-β (IKK-β; alternatively, IKK-2) protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 0.782).

Protein Prediction

Figure 3. Protein domain organization of IKK-2. IKK-2 has a kinase domain, C-terminal dimerization domain (SDD), a leucine zipper, a helix-loop-helix (HLH) domain, and a NEMO binding domain (NBD). The Baby mutation results in an isoleucine to leucine substitution at position 243 (I243L). The image is interactive; click the other mutations to view more information.

IKK-2 is a component of the IKK complex, which is necessary for NF-κB activation. The IKK complex is composed of two highly homologous catalytic subunits (IKK-1 (alternatively, IKK-α) and IKK-2), the regulatory subunit NEMO (or IKK-γ; see the record for panr2) that links the catalytic subunits to upstream activators and signaling complexes, and less well-characterized accessory proteins such as HSP90, Cdc37, and ELKS [for review see (1;2)]. 

Similar to IKK-1, IKK-2 has a kinase domain (amino acids 15-300), a C-terminal α-helical scaffold/dimerization domain (SDD; amino acids 408-664) that mediates homo- and heterodimerization of IKK-2, a leucine zipper (LZ; amino acids 458-479), a helix-loop-helix (HLH) region (amino acids 603-642), and a NEMO binding domain (NBD; amino acids 737-742) (Figure 3) (3;4). Unique to IKK-2 is a ubiquitin-like domain (ULD; amino acids 307-384), which is essential for the kinase activity of IKK-2 (5;6). Mutations within the ULD result in an inability of the IKK complex to activate NF-κB in response IL-1 and TNF (see the record for Panr1). Leu353 within the ULD is required for the dissociation of IKK-2 from the p65 NF-κB subunits after the phosphorylation and degradation of IκBα. Both the ULD and the SDD mediate the exact positioning of the IκBα substrate.

The Baby mutation results in an isoleucine to leucine substitution at position 243 (I243L) within the kinase domain in the IKK-2 protein.

Please see the record Impaired for more information about Ikbkb.

Putative Mechanism

The NF-κB signaling pathway functions in essentially all mammalian cell types and is activated in response to injury, infection, inflammation and other stressful conditions requiring rapid reprogramming of gene expression. NF-κB regulates both innate and adaptive immune responses, including those mediated by the toll-like receptors (TLRs), TNF receptors, the IL-1 receptor, and the B and T cell receptors (BCR and TCR, respectively). In the resting cell, NF-κB dimers are kept inactive in the cytoplasm through their association with IκB inhibitory molecules, including p105 and p100.  In response to stimulation, IκBs are phosphorylated by the IKK complex at conserved serine residues (2). This modification induces the K48-linked polyubiquitination of IκB molecules and subsequent recognition by the 26S proteasome as substrates for proteolysis.  Degradation of IκBs allows the NF-κB dimers to translocate into the nucleus, where they are able to activate the transcription of target genes, including various cytokines [for review see (7)].

Genetic studies have demonstrated that the IKK-2 and NEMO subunits of IKK are required for NF-κB activation by most stimuli (i.e., canonical stimulation) including inflammatory cytokines (IL-1 and TNFα), endotoxins (e.g., lipopolysaccharide), viral infection, exposure to double-strand RNA, and UV-irradiation (8). Although NEMO binds preferentially to IKK-2, it can interact with IKK-1 (9), providing some functional redundancy between the two kinases (10). In addition to activating the canonical NF-κB pathway, IKK-2 and NEMO are necessary to activate the tumor progression locus 2 (TPL2; see the record for Sluggish), a MAP3 kinase that activates the MEK/ERK pathway in response to TLR, TNF-α, and CD40 signaling (11). The IKK complex also plays an important role in the production of type I IFNs upstream of the IKK-related kinases IKK-i/ε and TANK-binding kinase 1 (TBK1; see the record for Pioneer), and downstream of the RNA helicase RIG-I, which detects RNA virus infection intracellularly (12).   

Mutations in IKBKB has been linked to immunodeficiency 15 (IMD15; OMIM: #615592) (13;14). IMD15 is characterized by early-onset bacterial, fungal, and viral infections as well as a failure to thrive. Patients with IMD15 exhibit hypo- or agammaglobulinemia with relatively normal numbers of B and T cells. Differentiation and activation of immune cells in patients with IMD15 are impaired (14).

Ikbkb-deficient (Ikbkb^-/-) mice are embryonically lethal by embryonic day 13 (E13), mainly due to TNF-induced hepatocyte apoptosis (15;16). B-cell-specific knockouts of both IKK-2 and NEMO resulted in a lack of B cells in the spleen, suggesting that canonical NF-κB activation is required for the maintenance of mature B cells (17). IKK-2 function in follicular and marginal zone B cells is essential for B cell development (17). B cell specific deletion of Ikbkb resulted in reduced frequencies of peripheral B cells due to defects in cell survival (18). In addition, immune responses to LPS, anti-CD40, and anti-IgM were impaired compared to that in wild-type mice (18). Mice with T-cell-restricted NEMO ablation or with replacement of IKK-2 with a kinase-dead mutant prevented survival of peripheral T cells (19). In addition, IKK-2 in T cells is essential for the development of natural killer T (NKT) cells and CD4⁺/CD25⁺ regulatory T cells (20).

The Baby mice exhibited defects in T cell frequencies in the peripheral blood under normal conditions, indicating that IKK-2^Baby lost some function in T cells. B cell development in the Baby mice appeared normal, indicating some residual IKK-2^Baby function in B cells.

Primers

PCR Primer
Baby_pcr_F: TCAATCACAGGATGGTGTTCTG
Baby_pcr_R: ACTCCTGCTGAACTCAATGC

Sequencing Primer
Baby_seq_F: TCAAAAGTTATGCATGGGCCTG
Baby_seq_R: CTGCTGAACTCAATGCTTAGAGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 580 nucleotides is amplified (chromosome 8, - strand):

1   actcctgctg aactcaatgc ttagagctaa gcccctaacc acagtgccga ccactcacaa
61  acactcagag aagcatccta gcagcatgct gcccaccgtt ttccaaaaga atagtcgtga
121 agtgacatta cacgtgtaaa ccgggtactt gccactgagt gacataaagg acatcttaaa
181 atgacaccta caggcactcc aaagtccggc agaagagcga agtggacatc gttgttagtg
241 aagacttgaa tggagcagtg aagttttcaa gttcgctacc cttccccaat aatcttaaca
301 ggtaaggccg tggggcatca gtcttataga tcttcttcgc ctctgtttag agctacaggt
361 ttgagataac agctgactct tttttacttt aattttatac gtttgagtga ctggtgcctg
421 tggaagccag aggaatagtc agatctctgg aactggagtt agagatgact gtgaactgcc
481 gtgtgggtgt tgggaaccaa ccctagctct taagcactga gccatctcca ggcccatgca
541 taacttttga atagatatca gaacaccatc ctgtgattga 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Yamaoka, S., Courtois, G., Bessia, C., Whiteside, S. T., Weil, R., Agou, F., Kirk, H. E., Kay, R. J., and Israel, A. (1998) Complementation Cloning of NEMO, a Component of the IkappaB Kinase Complex Essential for NF-kappaB Activation. Cell. 93, 1231-1240.

  2. Scheidereit, C. (2006) IkappaB Kinase Complexes: Gateways to NF-kappaB Activation and Transcription. Oncogene. 25, 6685-6705.

  3. Liu, S., Misquitta, Y. R., Olland, A., Johnson, M. A., Kelleher, K. S., Kriz, R., Lin, L. L., Stahl, M., and Mosyak, L. (2013) Crystal Structure of a Human IkappaB Kinase Beta Asymmetric Dimer. J Biol Chem. 288, 22758-22767.

  4. Xu, G., Lo, Y. C., Li, Q., Napolitano, G., Wu, X., Jiang, X., Dreano, M., Karin, M., and Wu, H. (2011) Crystal Structure of Inhibitor of kappaB Kinase Beta. Nature. 472, 325-330.

  5. Zhang, Y., Otero, J. E., and Abu-Amer, Y. (2013) Ubiquitin-Like Domain of IKKbeta Regulates Osteoclastogenesis and Osteolysis. Calcif Tissue Int. 93, 78-85.

  6. May, M. J., Larsen, S. E., Shim, J. H., Madge, L. A., and Ghosh, S. (2004) A Novel Ubiquitin-Like Domain in IkappaB Kinase Beta is Required for Functional Activity of the Kinase. J Biol Chem. 279, 45528-45539.

  7. Hayden, M. S., and Ghosh, S. (2008) Shared Principles in NF-kappaB Signaling. Cell. 132, 344-362.

  8. Li, Z. W., Chu, W., Hu, Y., Delhase, M., Deerinck, T., Ellisman, M., Johnson, R., and Karin, M. (1999) The IKKbeta Subunit of IkappaB Kinase (IKK) is Essential for Nuclear Factor kappaB Activation and Prevention of Apoptosis. J Exp Med. 189, 1839-1845.

  9. Rothwarf, D. M., Zandi, E., Natoli, G., and Karin, M. (1998) IKK-Gamma is an Essential Regulatory Subunit of the IkappaB Kinase Complex. Nature. 395, 297-300.

  10. Li, Q., Estepa, G., Memet, S., Israel, A., and Verma, I. M. (2000) Complete Lack of NF-kappaB Activity in IKK1 and IKK2 Double-Deficient Mice: Additional Defect in Neurulation. Genes Dev. 14, 1729-1733.

  11. Waterfield, M., Jin, W., Reiley, W., Zhang, M., and Sun, S. C. (2004) IkappaB Kinase is an Essential Component of the Tpl2 Signaling Pathway. Mol Cell Biol. 24, 6040-6048.

  12. Zhao, T., Yang, L., Sun, Q., Arguello, M., Ballard, D. W., Hiscott, J., and Lin, R. (2007) The NEMO Adaptor Bridges the Nuclear Factor-kappaB and Interferon Regulatory Factor Signaling Pathways. Nat Immunol. 8, 592-600.

  13. Nielsen, C., Jakobsen, M. A., Larsen, M. J., Muller, A. C., Hansen, S., Lillevang, S. T., Fisker, N., and Barington, T. (2014) Immunodeficiency Associated with a Nonsense Mutation of IKBKB. J Clin Immunol. 34, 916-921.

  14. Pannicke, U., Baumann, B., Fuchs, S., Henneke, P., Rensing-Ehl, A., Rizzi, M., Janda, A., Hese, K., Schlesier, M., Holzmann, K., Borte, S., Laux, C., Rump, E. M., Rosenberg, A., Zelinski, T., Schrezenmeier, H., Wirth, T., Ehl, S., Schroeder, M. L., and Schwarz, K. (2013) Deficiency of Innate and Acquired Immunity Caused by an IKBKB Mutation. N Engl J Med. 369, 2504-2514.

  15. Li, Q., Van Antwerp, D., Mercurio, F., Lee, K. F., and Verma, I. M. (1999) Severe Liver Degeneration in Mice Lacking the IkappaB Kinase 2 Gene. Science. 284, 321-325.

  16. Tanaka, M., Fuentes, M. E., Yamaguchi, K., Durnin, M. H., Dalrymple, S. A., Hardy, K. L., and Goeddel, D. V. (1999) Embryonic Lethality, Liver Degeneration, and Impaired NF-Kappa B Activation in IKK-Beta-Deficient Mice. Immunity. 10, 421-429.

  17. Pasparakis, M., Schmidt-Supprian, M., and Rajewsky, K. (2002) IkappaB Kinase Signaling is Essential for Maintenance of Mature B Cells. J Exp Med. 196, 743-752.

  18. Li, Z. W., Omori, S. A., Labuda, T., Karin, M., and Rickert, R. C. (2003) IKK Beta is Required for Peripheral B Cell Survival and Proliferation. J Immunol. 170, 4630-4637.

  19. Schmidt-Supprian, M., Courtois, G., Tian, J., Coyle, A. J., Israel, A., Rajewsky, K., and Pasparakis, M. (2003) Mature T Cells Depend on Signaling through the IKK Complex. Immunity. 19, 377-389.

  20. Schmidt-Supprian, M., Tian, J., Grant, E. P., Pasparakis, M., Maehr, R., Ovaa, H., Ploegh, H. L., Coyle, A. J., and Rajewsky, K. (2004) Differential Dependence of CD4+CD25+ Regulatory and Natural Killer-Like T Cells on Signals Leading to NF-kappaB Activation. Proc Natl Acad Sci U S A. 101, 4566-4571.