Phenotypic Mutation 'lucky' (pdf version)
Allelelucky
Mutation Type nonsense
Chromosome11
Coordinate103,249,558 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Map3k14
Gene Name mitogen-activated protein kinase kinase kinase 14
Synonym(s) Nik
Chromosomal Location 103,219,762-103,267,472 bp (-)
MGI Phenotype Homozygotes for a spontaneous mutation exhibit deficiencies in cellular and humoral immunity, susceptibility to infections, absence of lymph nodes and Peyer's patches, failure of isotype switching, and inflammation of exocrine organs.
Accession Number

NCBI RefSeq: NM_016896; MGI: 1858204

Mapped Yes 
Amino Acid Change Arginine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
R396* in Ensembl: ENSMUSP00000021324 (fasta)
Gene Model not available
PDB Structure
Crystal structure of apo murine Nf-kappaB inducing kinase (NIK) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) bound to a 6-alkynylindoline (cmp1) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) bound to a 2-(aminothiazoly)phenol (cmp2) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) V408L bound to a 2-(aminothiazolyl)phenol (cmp3) [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
low complexity region 134 153 N/A INTRINSIC
Pfam:Pkinase 402 653 2.5e-39 PFAM
Pfam:Pkinase_Tyr 402 653 1.2e-21 PFAM
Blast:STYKc 661 810 N/A BLAST
Phenotypic Category decrease in B cells, hematopoietic system, immune system, T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance 100% 
Alleles Listed at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(1) Spontaneous(1) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Map3k14 APN 11 103227579 missense probably damaging 1.00
IGL00590:Map3k14 APN 11 103237554 missense probably damaging 1.00
IGL03065:Map3k14 APN 11 103225101 missense probably damaging 1.00
R0020:Map3k14 UTSW 11 103227674 missense probably damaging 0.99
R0070:Map3k14 UTSW 11 103239554 critical splice acceptor site probably null
R0294:Map3k14 UTSW 11 103227137 missense possibly damaging 0.80
R0624:Map3k14 UTSW 11 103242291 missense possibly damaging 0.77
R0734:Map3k14 UTSW 11 103227000 missense probably benign 0.00
R1015:Map3k14 UTSW 11 103225300 missense probably damaging 1.00
R1170:Map3k14 UTSW 11 103238917 splice donor site noncoding transcript
R1487:Map3k14 UTSW 11 103225337 missense possibly damaging 0.48
R2204:Map3k14 UTSW 11 103239454 missense possibly damaging 0.82
R2880:Map3k14 UTSW 11 103221032 missense probably damaging 1.00
R4429:Map3k14 UTSW 11 103227584 missense probably damaging 1.00
R4624:Map3k14 UTSW 11 103231101 missense probably damaging 1.00
R4967:Map3k14 UTSW 11 103239531 missense probably benign 0.00
R5098:Map3k14 UTSW 11 103224359 missense probably damaging 1.00
R5148:Map3k14 UTSW 11 103239332 missense probably benign
R5208:Map3k14 UTSW 11 103239146 missense probably damaging 0.98
R5480:Map3k14 UTSW 11 103239504 missense probably benign 0.03
T0970:Map3k14 UTSW 11 103224298 nonsense probably null
X0023:Map3k14 UTSW 11 103239822 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 031808-UCD
Last Updated 04/06/2017 1:01 PM by Katherine Timer
Record Created unknown
Record Posted 08/25/2009
Phenotypic Description
Lucky mice were identified in a T-dependent humoral response screen for mutations that abrogate the humoral immune response to model antigens encoded by a recombinant suicide vector based on the Semliki Forest Virus (rSFV). ENU-mutagenized G3 mice, along with wild type controls, were injected intraperitoneally with 2x106 infectious units (IU) of rSFV encoding the model antigen, beta-galactosidase (rSFV-GAL). Two weeks later, the mice were boosted with the same dose of rSFV-GAL. On day 28, serum levels of GAL-specific IgG were measured. The index mouse, B6004, failed to produce a detectable GAL-specific IgG response (Figure 1).
 
Flow cytometric analysis of peripheral blood lymphocytes revealed that the index mouse and two additional G3 siblings had a significant reduction of peripheral B cells. The B cells that were present in the blood of these mice expressed high levels of surface IgM and lacked surface expression of CD23 and CD21/CD35 (Figure 1).  This surface phenotype is consistent with a block in B cell development from the transitional T1 stage to the T2 stage [for a review of B cell development see (1)]. This step in B cell development is an important checkpoint for deleting autoreactive B cells before they acquire the ability to enter lymphoid follicles and complete their development into mature B cells.
 
Further phenotypic analysis of homozygous lucky animals revealed a lack of secondary lymphoid organs.
Nature of Mutation
The lucky mutation was mapped to Chromosome 11, and corresponds to a C to T transversion at position 1269 of the Map3k14 gene in exon 6 of 16 total exons.
 
1254 GTGGATTATGAGTATCGAGAAGAGGTCCACTGG
391 -V--D--Y--E--Y--R--E--E--V--H--W-
 
The mutated nucleotide is indicated in red lettering, and causes an arginine to stop conversion at amino acid 396 of the MAP3K14 protein.
Protein Prediction
The protein encoded by the Map3k14 gene is known as the NF-κB inducing kinase (NIK) (2). In mice, this protein is 942 amino acids long and has 84% identity with its human homologue (Figure 2) (3). NIK is a serine/threonine kinase belonging to the mitogen-activated protein kinase kinase kinase (MAP3K) family of proteins. The kinase domain of NIK spans amino acids 367-580 (3), and like other kinase domains contains motifs critical for ATP binding, substrate binding and catalysis (4). These include a conserved ATP-binding lysine, a glycine-rich loop also involved in ATP binding and phosphoryl transfer (amino acids 408-416), the magnesium-binding loop or subdomain VII, the activation loop, and subdomain VIII.  Mutation of the ATP-binding lysine (amino acid 431) and an adjacent lysine (amino acid 432), abolishes NIK kinase activity (2).  Activation of most protein kinases also requires phosphorylation of a residue in the activation loop. In NIK, this residue is T559. NIK can also form oligomers through multiple regions of its kinase domain (5).
 
Figure 2. Domain structure of NIK.  The lucky mutation is an arginine to premature stop at amino acid 396 (red asterisk). NRD= Negative-regulatory domain; NLS= Nuclear localization signal; PRR= Proline-rich repeat motif; GRL= Glycine-rich loop; NES=Nuclear export signal
Like other protein kinases, NIK interacts with and phosphorylates a number of substrates. These include the IκB kinase IKK-1 (or IKK-α) (6;7), members of the NF-κB protein family including p100, p65, and c-Rel (8-11) (see Background), the cytosolic bacterial sensor NOD2 (12), transcription factors such as PU.1 (13), and Down syndrome candidate region 1 (DSCR1) (14). In some cell lines, NIK is able to activate the MEK/extracellular signal regulated kinase (ERK) MAPK pathway (15;16). NIK also associates with adaptor proteins of the TNF receptor associated factor (TRAF) family including TRAF2, TRAF3, TRAF5 and TRAF6 (2;17;18). TRAF2/5/6 and IKK-1 associate with NIK through its C-terminal region (amino acids 626-942 for TRAF and amino acids 730-942 for IKK-1) (2;5;6;17), while TRAF3 interacts with NIK through an N-terminal region (amino acids 30-120) (18). The N-terminus of NIK has also been shown to interact with a novel protein NIPB (for NIK and IKK-β binding protein) (19), and NIK can bind to another novel protein known as TRAFs and NIK-associated protein (TNAP) (20). Finally, NIK has been shown to interact with epidermal growth factor (EGF)/heregulin receptors and adaptor proteins necessary for signaling, such as receptor interacting protein (RIP) and growth factor receptor bound (Grb) 7 (21;22)
 
The NIK N-terminal region also contains a negative-regulatory domain (NRD) in its N-terminus (amino acids 121-321) that interacts with the NIK C-terminal region, thus inhibiting binding to IKK-1. The NRD consists of a basic motif (amino acids 127-146) that is similar to the basic region of basic leucine zipper (bZIP) motifs present in some transcription factors, as well as a proline-rich repeat motif located between amino acids 250 and 320. The latter region is composed of five short repeats, which share the consensus sequence PXPXPX (23).
 
NIK contains a conventional nuclear localization signal (NLS) at amino acids 143-149 (2;24), which partially overlaps with the NRD basic motif. Typically, this signal consists of one or more short sequences of positively charged lysines or argines. The NLS contains a nucleolar sub-motif at amino acids 143-146 (25). A nuclear export signal (NES), consisting of short stretches of hydrophobic residues such as leucine or isoleucine, is located in the NIK C-terminus at amino acids 790-800 (24).
 
The lucky mutation results in the generation of a stop codon at amino acid 396, thus truncating the protein close to the N-terminus of its kinase domain. It is unknown whether the truncated protein is normally expressed.
Expression/Localization
NIK mRNA has been reported to be ubiquitously expressed at low levels in mouse and human tissues (2;26). NIK expression levels are also low in most cell types (27), but high levels of NIK are expressed in melanoma cell lines (16). According to SymAtlas, several tissues and cell types express higher levels of NIK mRNA. B cells express high levels of NIK mRNA in humans, while lymph nodes, spleen, and follicular B cells express high levels of NIK mRNA in mice.
 
Subcellularly, NIK protein is predominantly localized to the cytoplasm in cell lines and unstimulated macrophages (24;28). In endotoxin treated macrophages, NIK translocates to the nucleus (28), and NIK undergoes nucleocytoplasmic shuttling (24). NIK has also been shown to localize to the nucleolus (25)
Background
The NF-κB signaling pathway functions in essentially all mammalian cell types and is activated in response to injury, infection, inflammation and other stressful conditions requiring rapid reprogramming of gene expression (Figure 3).  The NF-κB family of transcription factors consists of the evolutionary conserved proteins p65/RelA, c-Rel, RelB, p50 (derived from the p105 precursor) and p52 (derived from the p100 precursor; see the record for xander). Typically, the rapid and transient activation of NF-κB complexes in response to a wide range of stimuli such as proinflammatory cytokines tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and CD40L (see the record for walla), DNA damaging agents, Toll-like receptor (TLR) agonists or viruses is regulated by the canonical NF-κB pathway. In the resting cell, NF-κB dimers are kept inactive in the cytoplasm through their association with IκB inhibitory molecules, including p105 and p100. In response to stimulation, IκBs are phosphorylated by the IκB kinase (IKK) complex, composed of IKK-1 (or IKK-α), IKK-2 (or IKK-β) and IKK-γ, at conserved serine residues (please see the record for panr2).  This modification induces the K48-linked polyubiquitination of IκB molecules and subsequent recognition by the 26S proteasome as substrates for proteolysis.  Degradation of IκBs allows the NF-κB dimers to translocate into the nucleus, where they are able to activate the transcription of target genes, including various cytokines [for review see (27)].
 
Some of the inducers of the canonical NF-κB pathway are also able to trigger an additional pathway by activating NIK and IKK-1 (27), known as the non-canonical or non-canonical NF-κB pathway. This pathway drives the post-translational processing of p100 to mature p52 (29), and appears to be mostly restricted to a subset of tumor necrosis factor (TNF) receptors including lymphotoxin-β receptor (LTβR), B cell activating receptor (BAFFR), CD40, and receptor activator of NF-κB (RANK) (8;30-35). These receptors are involved in secondary lymphoid organ (SLO) development, B cell differentiation, survival and homeostasis, and in osteoclastogenesis (27), and bind to TRAF proteins to regulate NIK activity.  TRAF2 and TRAF5 positively regulate NIK activity under certain conditions (2;17), but in other contexts, TRAF2 and TRAF3 form a complex with NIK to  mediate NIK degradation (18;36-38). After stimulation with BAFFR/CD40, the complex is destabilized by TRAF2/3 degradation, permitting the release of NIK from the complex (36-38). The TRAFs and NIK-associated protein (TNAP) may also play a role as it interacts with TRAF2, TRAF3 and NIK, and can suppress NIK activity (20). Once NIK is activated, it is able to bind to and phosphorylate several substrates including IKK-1 and p100, and serves as a docking molecule between IKK-1 and p100 (8;39;40). Once p100 is phosphorylated by IKK-1, it is polyubiquitinated and processed to p52 (40;41). The non-canonical NF-κB pathway is generally slower than the activation of the canonical pathway, leading to delayed activation of nuclear p52-containing complexes such as p52/RelB.  p52 also pairs with p65 (RelA) and c-Rel, but these complexes are controlled by IκB molecules, and are downstream of both the canonical and non-canonical NF-κB pathways (27).
Figure 3. Canonical and non-canonical NF-κB signaling pathways. In the canonical pathway, several membrane receptors, including TNFR (tumor-necrosis factor receptor), IL-1R (interleukin-1 receptor) and TLRs (toll-like receptors), signal through kinases and adaptors (TRAFs), resulting in IKK activation. This activation occurs after the K63 ubiquitination of TRAFs and RIP. TAK1 and its adaptor proteins TAB1 and TAB2 bind ubiquitin chains to TRAF and NEMO (IKKγ) resulting in the activation of the IKK complex (NEMO, IKKα and IKKβ). Ubiquitination can be inhibited by deubiquitinating enzymes (DUB). Stimulation of the T-cell receptor (TCR) and B-cell receptor (BCR) results in the recruitment of Src and Syk family kinases. These kinases activate a phosphorylation cascade which leads to the activation of protein kinase C (PKC). The phosphorylation of CARMA1 (CARD (caspase-recruitment domain)-MAGUK (membrane-associated guanylate kinase) protein 1) recruits BCL 10 (B-cell lymphoma 10) and MALT1 (mucosa-associated lymphoid tissue lymphoma translocation gene 1), forming the CBM complex and activating the IKK complex. The IKK complex phosphorylates both IκB, p105 and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles) by 26S proteasome. Degradation of IκB releases activated NF-κB dimers for translocation to the nucleus. A subset of TNFRs such as the lymphotoxin-β receptor (LT-βR),CD40, B-cell-activating factor receptor (BAFFR) and receptor activator of Nf-κB (RANK) can activate the canonical or non-canonical NF-κB signaling pathways. In the non-canonical pathway, the receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination, enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKα which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the 26S proteasomal degradation of p100 and the processing of p52. P52 and RelB are released for translocation to the nucleus. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

 
Alymphoplasia (aly) mice, which are homozygous for a point mutation in Map3k14 (3), exhibit deficiencies in cellular and humoral immunity, susceptibility to infections, absence of SLOs, defects in thymic and splenic architecture, abnormal B cell development, failure of isotype switching, and inflammation of exocrine organs (42-46). In addition, these animals have mammary gland defects (47), and demonstrate progressive neurological abnormalities leading to hind-limb paralysis (42). A targeted knockout of Map3k14 produced animals with very similar phenotypes (9). The phenotypes of animals with Map3k14 mutations resemble some of those found in Nfκb2 knockout mice lacking the p100 and p52 proteins (48;49), RelB-deficient mice (50;51), IKK-1-deficient animals (52;53), Ltβr knockouts (54), BAFFR-deficient mice (55;56), and RANK mutants (57;58). These mouse models have clarified the role of the non-canonical NF-κB pathway in several critical biological processes. 
 
One of the most striking phenotypes of Map3k14 mutants is the lack or disturbance of SLO development, including lymph nodes (LNs), Peyer’s Patches (PPs) and spleen. SLOs provide an environment that enables lymphocytes to interact with each other, with accessory cells, and with antigens, resulting in the initiation of antigen-specific primary immune responses. All SLOs contain specific B cell and T cell areas, through which lymphocytes continuously recirculate, and are able to interact with antigen-presenting cells (APCs). In these tissues, immunization results in the appearance of germinal centers (GCs) that are sites of intense B cell proliferation, selection, maturation and death during antibody responses. The development of lymphoid tissues involves the interaction between hematopoietic progenitor cells and mesenchymal progenitor cells. This interaction is dependent on LTβR signaling through NIK and IKK-1 to activate the p52/RelB dimer, although canonical NF-κB signaling also plays a role and some functional redundancy exists (27). RANK-deficient mice also exhibit a lack of LNs although other SLO development is normal (57;58), suggesting a specific role for RANK in LN development. The same signaling pathway is important for the maturation, but not the initiation of PP development (27), and is critical for the formation of GCs in the spleen (48;59-61)
 
The non-canonical NF-κB pathway is also involved in thymic organogenesis and self-tolerance. The development and organization of the thymus are the result of interactions between maturing thymocytes and epithelial and dendritic cells (DCs). Subsets of thymic epithelial cells (TECs) require the non-canonical NF-κB pathway for proper development and maturation, and mutations in Ltβr, Map3k14, and Ikkα all disturb thymic architecture (42;62;63). LTβR-deficient mice exhibit thymic defects that are less severe than those found in alymphoplasia animals, suggesting that additional signals induce the non-canonical NF-κB pathway during thymic development (62).
 
In addition to their general defects in SLO and thymic differentiation, mice with Map3k14 mutations also display phenotypes intrinsic to specific immune cell populations (27). The non-canonical NF-κB pathway is important in B cell maturation and homeostasis (1;32), DC proliferation and differentiation (64-66), and Th17 development (67). NIK and IKK-1 appear to be dispensable for early B cell development in the bone marrow, but further maturation in the spleen to mature follicular B cells and non-circulating marginal zone B (MZB) cells is affected in Map3k14, Ikk-α, and Nfkb2 mutant animals (1;48;49;60;68). This process was shown to be largely dependent on signaling through BAFFR, which was also shown to be important for B cell maintenance (32). CD40, which has roles in B cell function and homeostasis, may also function upstream of NIK in B cells (69)Alymphoplasia dendritic cells (DCs) are reduced in number in the peripheral lymphoid organs, and have a reduced ability to induce both regulatory T (Treg) cell proliferation and to present antigens to cytotoxic T cells (64-66). Both CD40 and LTβR induction of the non-canonical NF-κB pathway were shown to be important for DC proliferation and differentiation (65;66). These DC defects result in a reduction of peripheral Tregs in alymphoplasia mice. As Tregs are necessary to maintain immunological tolerance by suppressing autoreactive T cells and shutting down T-cell mediated immunity, it is likely the autoimmune inflammations observed in the exocrine organs of alymphoplasia mice are due to the reduction in Treg cell number (45;64)
 
Besides NF-κB activation, IKK-1 activity was shown to be critical for type I interferon (IFN) production by activating interferon factor (IRF) 7 downstream of TLR7 or TLR9 (70). Type I IFNs are a critical class of cytokines that have potent antiviral, growth-inhibitory and immunomodulatory functions, and are transcriptionally controlled by activated IRF3 or IRF7 [for review see (71)]. The regulation of type I IFN by IKK-1 may be independent of NIK function as splenic cells from alymphoplasia mice produced normal amounts of TLR7 or TLR9-induced IFN-α (70). However, other research using Map3k14 knockout cell lines suggests that NIK functions upstream of IKK-1 to activate both IRF3 and IRF7, and may be important for an appropriate cellular antiviral response (72)
 
There are no known human mutations of MAP3K14. However, NF-κB signaling is often activated in and contributes to various human diseases including cancer and inflammatory disorders. Several studies suggest that EGFR receptors, which are often overexpressed on tumor cells, can activate NF-κB pathways that are dependent on NIK (21;22). Additionally, the non-canonical NF-κB pathway is activated by some oncogenic viruses, such as Epstein-Barr virus (EBV) (30) or human T-cell leukemia virus type I (HTLV-I) (73). The bacterium Helicobacter pylori, which has been shown to be the cause of various human gastric diseases, also activates the non-canonical NF-κB pathway by activating NIK (74). The non-canonical NF-κB pathway contributes to the development of inflammatory disorders and autoimmune diseases by being necessary for tertiary lymphoid organ (TLO) development under control of LTβR signaling, and being activated by overexpression of the pro-survival cytokine BAFFR leading to survival of unwanted autoantibody producing B cells (27). TLOs are organized T- and B-cell areas that form at sites of chronic inflammation (75). They are often found in patients suffering from inflammatory disorders such as rheumatoid arthritis, multiple sclerosis, ulcerative colitis, chronic hepatitis C and Sjogren’s syndrome (OMIM %270150), which is an inflammation of exocrine organs. Interestingly, alymphoplasia mice have been suggested to be a model for the latter disease as they exhibit exocrine organ inflammation and a reduced number of Tregs (45;64) (see above). NIK-deficient animals have been shown to be resistant to the induction of rheumatoid arthritis due to a defect in osteoclastogenesis in response to RANK signaling (76), and to experimental autoimmune encephalomyelitis due to the reduction in Th17 cells (67).
Putative Mechanism
Alymphoplasia mice contain a G to R change at amino acid 855 of NIK to produce a protein that retains kinase function, but is defective in IKK-1 and TRAF2 binding.  This protein is apparently able to function normally to produce type I IFNs (70). However, the similarity of phenotypes between alymphoplasia mice and Map3k14 knockout animals (3;9), suggests that the IKK-1/TRAF-interacting C-terminal domain of NIK is essential for its role in the non-canonical NF-κB pathway.  It is likely that the abnormal protein resulting from the lucky mutation, which would be truncated in the kinase domain, is similarly nonfunctional. Lucky mice appear to have highly similar phenotypes to both alymphoplasia animals and Map3k14 knockout mice (3;9), as they are unable to mount appropriate antibody responses, display defects in B cell maturation and exhibit a lack of secondary lymphoid organs. 
 
Although the lucky mutation results in truncation of the NIK kinase prior to the kinase domain, it is possible that expression of this protein may behave as a dominant-negative due to the retention of the N-terminal domain, which can bind to several proteins including its own C-terminal domain (see Protein Prediction). Overexpression of C-terminally truncated and kinase-dead NIK constructs can prevent NF-κB activation in vitro (2). However, the recessive nature of both the alymphoplasia and lucky mutations suggests that in most contexts these proteins do not behave in a dominant-negative fashion in vivo.
 
As a MAP3 kinase, NIK may have some overlapping functions with related proteins particularly MAP3K8, which is also known as TPL2 or COT (mutated in Sluggish). TPL2 functions downstream of TLR and TNF-α signaling, and activates the MEK/ERK pathway (77). In some cell lines, NIK is also able to activate the MEK/ERK pathway (15). TPL2 has been shown to interact with and activate NIK in vitro (78), and is upstream of NIK activation of the canonical NF-κB pathway in response to both CD3/CD28 (necessary for full T cell activation) and EBV stimulation (11;79-81). In addition, both kinases are implicated in canonical NF-κB activation in response to CD40 stimulation (82;83).  
Primers Primers cannot be located by automatic search.
Genotyping
Lucky genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Lucky(F): 5’- TGAGTGAAAATGTCCCGTGAGCAG -3’
Lucky(R): 5’- TGCATACCAAGGGCAGCAATCAG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Lucky_seq(F): 5’- GCACCAGATCTCATTATACGTGG -3’
Lucky_seq(R): 5’- TCAGGGTCTCACAGCATAGTC -3’
 
The following sequence of 1140 nucleotides (from Genbank genomic region NC_000077 for linear DNA sequence of Map3k14) is amplified:
 
29106      tgagt gaaaatgtcc cgtgagcaga ggatgccgtc ctccctctcc ctccctccca
29161 catctccctt ttccttcagt tctctgcctg aataactttg gaacctgaag cgatttgttc
29221 aacttgaggg attgattcta ttcactttta ataacggtgc ttgcccctgt ctcttcaacc
29281 ttggagttac tgagttatat gtcccattat caaggttgtt ggcgactctg cttctcatcg
29341 caggaattat ctgcctaccc caccccccag gcagcctatg gtggccacct ttgccattta
29401 agatttaagt atacagcact ctgcctgcag gccagaagag ggcaccagat ctcattatac
29461 gtggttatga gccaccgcgt ggttgctggg aattgaactc aggcgctcca gaagagcaag
29521 cagtcagtgc tcttaacctc tgaggcatct ccccagcccc acctttgtct tcttattccc
29581 ctaaacccct tttggcctgt cttccttatc atcgcgctgt agggctggta gtctctttag
29641 atgtggtggc catccagcca ccagagccct agctattgac tagagagcct tccccactgc
29701 agtcctctgt ccctctgctg cccaggtcac tggtactgac ctcctcctcc tcctcttcaa
29761 ccccagaaac tcaagccagt ggattatgag tatcgagaag aggtccactg gatgacacac
29821 cagcctcggg tgggcagagg ctccttcggc gaggtccaca gaatgaagga caagcagaca
29881 ggcttccagt gtgctgtcaa aaaggtatgc cgaggtgata caccactggg ctggcaccca
29941 aatttccaac actggggagg ctgaggcagg aggatgacca tggatcctag gccagctggg
30001 actatgctgt gagaccctga cttggaaaaa aaaaattaca tagtaggtag aactctgggg
30061 agctgaaagg gaagccacac aggggctgct gccttccacc tcagctttct gtcagcaaca
30121 gtcatggggt atccggggct ctcccttgat ggttggcacc ctagctgctc tcgggtcagc
30181 tggagctgga agggagccgt ctggtgtgtc acatggcctg gcctgattgc tgcccttggt
30241 atgca
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is shown in red text.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsCarrie N. Arnold, Bruce Beutler
Edit History
02/10/2011 9:30 AM (current)
08/09/2010 12:53 PM
07/08/2010 9:50 AM
07/08/2010 9:49 AM
05/12/2010 8:41 AM
05/12/2010 8:40 AM
04/21/2010 5:13 PM
03/10/2010 2:47 PM
03/08/2010 10:06 AM
03/05/2010 8:30 AM