Phenotypic Mutation 'Mesopotamia'

• Allele: Mesopotamia
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 121,888,737 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Prkcb
• Gene Name: protein kinase C, beta
• Synonym(s): Prkcb1, A130082F03Rik, Prkcb2, Pkcb, PKC-Beta
• Chromosomal Location: 121,888,327-122,233,625 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a null allele exhibit impaired humoral immune responses, altered proliferative responses of B cells to various stimuli, abnormal vascular wound healing, and deficits in contextual and cued fear conditioning. ENU-induced mutations leadto impaired T cell-independent IgM responses. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Threonine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000064812] [ENSMUSP00000070019] [ENSMUSP00000138788 ^†] † probably from a misspliced transcript
• AlphaFold: P68404
• SMART Domains: Protein: ENSMUSP00000064812; Gene: ENSMUSG00000052889; AA Change: I57T

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
C1	37	86	7.11e-16	SMART
C1	102	151	1.42e-15	SMART
C2	172	275	1.05e-23	SMART
S_TKc	342	600	4.36e-97	SMART
S_TK_X	601	664	9.86e-27	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000064921)
• SMART Domains: Protein: ENSMUSP00000070019; Gene: ENSMUSG00000052889; AA Change: I57T

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
C1	37	86	7.11e-16	SMART
C1	102	151	1.42e-15	SMART
C2	172	275	1.05e-23	SMART
S_TKc	342	600	4.36e-97	SMART
S_TK_X	601	663	6.27e-20	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000064989)
• SMART Domains: Protein: ENSMUSP00000138788; Gene: ENSMUSG00000052889; AA Change: I57T

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
C1	37	86	7.11e-16	SMART
C1	102	151	1.42e-15	SMART
C2	172	275	1.05e-23	SMART
S_TKc	342	600	4.36e-97	SMART
S_TK_X	601	663	6.27e-20	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000143692)
• Meta Mutation Damage Score: 0.7720
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:26 PM by Anne Murray
• Record Created: 2019-05-10 1:46 PM by Bruce Beutler
• Record Posted: 2019-05-17
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Jin Huk Choi, Xue Zhong, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_008855; MGI: 97596

Alleles Listed at MGI

All mutations/alleles(5) : Chemically induced (ENU)(2) Targeted(3)

Phenotypic Description

Figure 1. Mesopotamia mice exhibit reduced peripheral blood B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Mesopotamia mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Mesopotamia mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Mesopotamia mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Mesopotamia mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Mesopotamia mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Mesopotamia phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R6590, some of which showed reduced B to T cell ratios (Figure 1) as well as reduced frequencies of B1 cells (Figure 2) with concomitant increased frequencies of T cells (Figure 3), CD4+ T cells (Figure 4), CD8+ T cells (Figure 5), and central memory CD8 T cells in CD8 T cells (Figure 6), all in the peripheral blood.

Nature of Mutation

Figure 7. Linkage mapping of the reduced B1 cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 28 mutations (X-axis) identified in the G1 male of pedigree R6590. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 28 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Prkcb: a T to C transition at base pair 122,289,514 (v38) on chromosome 7, or base pair 390 in the GenBank genomic region NC_000073. The strongest association was found with an additive model of inheritance to the reduced B1 cell frequency phenotype (P = 1.11 x 10^-23), wherein six homozygous variant mice and 19 heterozygous mice departed phenotypically from 20 homozygous reference mice (Figure 7).   The mutation corresponds to residue 390 in the mRNA sequence NM_008855 within exon 1 of 17 total exons.  

374 CACTGCACCGACTTCATCTGGGGCTTCGGGAAG 52  -H--C--T--D--F--I--W--G--F--G--K-

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine to threonine substitution at position 57 (I57T) in the PKCβ protein, and is strongly predicted by Polyphen-2 to be damaging (score = 0.997).

Protein Prediction

Figure 8. Domain structure of conventional PKCs (amino acid numbering is for PKCβII). Key features of the regulatory domain include the pseudosubstrate motif (PS), the DAG-binding C1 domain, and the calcium-binding C2 domain. The kinase domain consists of the ATP-binding C3 domain, the substrate-binding domain and the V5 region. Key phosphorylation sites necessary for PKC activity are indicated in orange ovals. The residue altered by the Mesopotamia mutation is shown in red. C, conserved region; V, variable region. Other mutations found in PRKCB are noted in red. Click on each mututation for more specific information.

PKCβ is a member of the protein kinase C (PKC) family of serine-threonine kinases. The PKC family belongs to the AGC-type kinase (protein kinase A/protein kinase G/protein kinase C) superfamily. PKC kinases share certain structural features including a highly conserved catalytic domain consisting of motifs required for ATP-substrate binding and catalysis, and a regulatory domain that maintains the enzyme in an inactive conformation. The regulatory and catalytic domains are attached to each other by a hinge region (Figure 8). Conventional PKCs (cPKCs) contain five variable (V) domains and four conserved (C) domains.  In PKCβ isoforms, the C1 domain occurs at residues 36-151 and can be subdivided into an A and B domain, each containing a characteristic DAG-binding motif, HX₁₂CX₂CX_nCX₂CX₄HX₂CX₇C, where H is histidine, C is cysteine, X is any other amino acid, and n is 13 or 14 (1).

The Mesopotamia mutation results in an isoleucine to threonine substitution at position 57 (I57T) within the C1 region within the regulatory domain.

Please see the record Untied for information about Prkcb.

Putative Mechanism

In B cell receptor signaling, PKCβ functions to upregulate NF-κB activity and to promote B-cell activation, PKCβ can also directly inhibit Btk through a negative feedback loop (2). PKCβ specifically phosphorylates Btk at Ser180 within its Tec-homology (TH) region, leading to an inhibition of Btk membrane translocation and activation, and the downstream events that promote PKCβ activation. PKCβ activity also appears to play a role in mediating B cell activating factor (BAFF)-induced signals leading to B cell survival by phosphorylating the Akt kinase (also known as protein kinase B or PKB) and contributing to its activation. 

A targeted knockout of the Prkcb gene in mice resulted in animals with reduced numbers of mature peripheral B cells, a loss of peritoneal B-1 B cells, reduced T cell-independent antibody responses, as well as reduced function of various other immune cell types. The reduction of B cell antibody responses to TNP-Ficoll in Mesopotamia mice suggests that the function of B-1 and/or MZ B cells is impaired in these animals with BCR signaling likely affected.  These phenotypes are consistent with the phenotypes observed in Prkcb^-/-animals, which also exhibit reduced T cell-independent antibody responses along with severe impairment of B-1 cells (3).  The phenotype observed in Mesopotamia mice may be due to the expression of nonfunctional, but appropriately localized, PKCβ proteins that are then able to inhibit the appropriate localization and function of wild type kinases.

Primers

PCR Primer
Mesopotamia_pcr_F: TTCATGCAAATGAGGGAGGC
Mesopotamia_pcr_R: CTGAGCCAGGTGTCGAAAAG

Sequencing Primer
Mesopotamia_seq_F: TGCCAAGCACAGCTGGAC
Mesopotamia_seq_R: TGTCGAAAAGGCGCCTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 737 nucleotides is amplified (chromosome 7, + strand):

1   ttcatgcaaa tgagggaggc ggggttacac tggggctccg cctccctccc ccgcagctgg
61  ggccagcggt gccaagcaca gctggaccag cggcagcagc tgggcgagtg acagcccagc
121 tacgcgcgcg cggccgccgc cagagccggc gcgaaggggc agcgcggccc tgcggtcccc
181 gggcggcagc agcggccgcc tagtcccgcg cctttccggg cttgcagccc cgcggtcccg
241 ccgccccggg gccgccacct ctcggggctc cccccagtcc ccgcgcgcgc aagatggctg
301 acccggctgc ggggccgccg ccgagcgagg gcgaggagag cacagtgcgc ttcgcccgca
361 aaggcgccct ccggcagaag aacgtgcacg aggtgaagaa ccacaaattc accgcccgct
421 tcttcaagca gcccaccttc tgcagccact gcaccgactt catctggtga gagtgcgccg
481 cgcgggccac ctgcctgggg ccctagaggg cagcgacacg catggggacc cctgttgttg
541 cccccggggg gaggagccgt gtgatcaccc ccatcccgct ggacccttat gccctgcgct
601 cccggatggc cagtccctca ggtgctgggt tctctgctcc cagacggctg gccgccaggc
661 gccttctgcc ctcttgcact ctgtcgcccg agcgcctagg gacagcgctg caggcgcctt
721 ttcgacacct ggctcag

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Steinberg, S. F. (2008) Structural Basis of Protein Kinase C Isoform Function. Physiol Rev. 88, 1341-1378.

  2. Kang, S. W., Wahl, M. I., Chu, J., Kitaura, J., Kawakami, Y., Kato, R. M., Tabuchi, R., Tarakhovsky, A., Kawakami, T., Turck, C. W., Witte, O. N., and Rawlings, D. J. (2001) PKCbeta Modulates Antigen Receptor Signaling Via Regulation of Btk Membrane Localization. EMBO J. 20, 5692-5702.

  3. Leitges, M., Schmedt, C., Guinamard, R., Davoust, J., Schaal, S., Stabel, S., and Tarakhovsky, A. (1996) Immunodeficiency in Protein Kinase Cbeta-Deficient Mice. Science. 273, 788-791.