Phenotypic Mutation 'Cpg6' (pdf version)
AlleleCpg6
Mutation Type missense
Chromosome9
Coordinate106,226,593 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Tlr9
Gene Name toll-like receptor 9
Chromosomal Location 106,222,598-106,226,883 bp (+)
MGI Phenotype Mice homozygous for a knock-out allele exhibit impaired immune system response to LPS, CpG, and Leishmania bazillensis infection.
Accession Number

NCBI RefSeq: NM_031178; MGI: 1932389

Mapped Yes 
Amino Acid Change Glycine changed to Arginine
Institutional SourceBeutler Lab
Ref Sequences
G1028R in Ensembl: ENSMUSP00000082207 (fasta)
Gene Model not available
PDB Structure
Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 363 386 N/A BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
Blast:LRR 471 494 N/A BLAST
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 N/A BLAST
Pfam:TIR 872 1012 1.1e-13 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000082207)
Phenotypic Category decrease in response to injected CpG DNA, immune system, TLR signaling defect: TNF production by macrophages
Penetrance 100% 
Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(1) Gene trapped(1) Chemically induced(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 0.99
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.86
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 0.99
IGL02851:Tlr9 APN 9 106224730 nonsense probably null 0.00
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 0.99
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg7 UTSW 9 106225349 missense probably benign 0.01
Meager UTSW 9 106224139 missense probably damaging 1.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign 0.00
R0071:Tlr9 UTSW 9 106223578 missense probably benign 0.00
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.02
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign 0.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.65
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 unclassified probably null
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm, gDNA
MMRRC Submission 031078-UCD
Last Updated 05/13/2016 3:09 PM by Peter Jurek
Record Created unknown
Record Posted 04/30/2009
Phenotypic Description

The CpG6 phenotype was identified in a screen of ENU-mutagenized mice looking for reduced type I interferon (IFN) responses to CpG DNA challenge in vivo (Figure 1) (1).  Macrophages from CpG6 mice do not produce tumor necrosis factor (TNF)-α in response to CpG oligonucleotides, although responses to other TLR ligands are normal (TLR Signaling Screen).

Nature of Mutation
The Tlr9 gene was directly sequenced and a mutation corresponding to a G to A transition was found at position 3188 of the Tlr9 transcript, in exon 2 of 2 total exons.
 
3173 CAGAACTTCTGCCGGGGACCTACAGCAGAATAG
1023 -Q--N--F--C--R--G--P--T--A--E--*-
 
The mutated nucleotide is indicated in red lettering, and causes a glycine to arginine substitution at amino acid 1028 of the TLR9 protein.
Protein Prediction
Figure 2. Protein and domain structure of TLR9. (A) Schematic representation of TLR9 based on crystalized structures of mouse TLR9 LRR (PBD 3WPF) and human TLR2 TIR (1FYW) domains. The residue affected by the CpG6 mutation is highlighted. 3D image was created using UCSF Chimera. (B) TLR9 is a 1032 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane (TM) domain (blue) and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain (green). The CpG6 mutation (red asterisk) results in a glycine to arginine substitution at amino acid 1028 of the TLR9 protein. This image is interactive. Click on the image to view other mutations found in TLR9. Click on each mutation for more specific information.
The CpG6 mutation results in a glycine to arginine change at position 1028 of the TLR9 protein.  According to the crystal structure for the related TLR2 protein, this lies in the αE helix of the TIR domain.  The position of the mutation is shown in Figure 2. The mutation within the TIR domain is also shown in Figure 3 along with the position of the amino acid change caused by the CpG2 mutation (PDB ID 1FYW; see the record for languid).
 
Please see the record for CpG1 for information about Tlr9.
Putative Mechanism

The CpG6 mutation replaces a glycine possibly located in the αE helix of TLR9 with an arginine, and results in a hypomorphic allele that fails to respond to CpG ODN stimulation.  It is likely the substitution of a charged amino acid for a glycine at this position disrupts helical formation as the previous amino acid is also charged.  Many of the α-helices and connecting loops of the TIR domain are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions.  TIR domains in TLRs, IL receptors and the adapters MyD88 and TIRAP contain 3 conserved boxes (boxes 1, 2 and 3) required for signaling, which form part of the βA-strand, BB loop and αE-helix, respectively (2;3).  Computational docking of the TLR2 TIR domain with the TIR domain of the myeloid differentiation (MyD)-88 adaptor protein suggests that TIR domains can interact in two different modes, one of which is mediated by αE-helix interactions.  Further studies of the MyD88/TLR2 αE-helical interactions suggest that the αE-helices mediate homotypic oligomerization of TIR domains (4).  Thus, the CpG6 mutation likely prevents TLR9 dimerization.  It must be noted that the amino acid sequence identity between any pair of TIR domains is generally about 25%, and that the crystal structures of different TIR domains reveal that significant conformational differences exist between them (5;6).  As the crystal structure of TLR9 has not been determined, it remains to be seen whether the TLR9 TIR domain behaves similarly to the TIR domain of TLR2.

Primers Primers cannot be located by automatic search.
Genotyping
CpG6 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. 
 
Primers for PCR amplification
CpG6(F): 5’- CAGTTCTAGACGTGAGAAGCAACCC -3’
CpG6 (R): 5’- GGCAGAGAATGAACTCCAGTCCTG -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 35X
6) 72°C             10:00
7) 4°C               ∞
 
Primers for sequencing
CpG6_seq(F): 5’- GGAGCCGCAAGACTCTATTTG -3’
CpG6_seq(R): 5’- TCACTCTCCTGAAAGATGCATGG -3’
 
The following sequence of 1076 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Tlr9) is amplified:
 
3175                                                            cagttc
3181 tagacgtgag aagcaaccct ctgcactgtg cctgtggggc agccttcgta gacttactgt
3241 tggaggtgca gaccaaggtg cctggcctgg ctaatggtgt gaagtgtggc agccccggcc
3301 agctgcaggg ccgtagcatc ttcgcgcagg acctgcggct gtgcctggat gaggtcctct
3361 cttgggactg ctttggcctt tcactcttgg ctgtggccgt gggcatggtg gtgcctatac
3421 tgcaccatct ctgcggctgg gacgtctggt actgttttca tctgtgcctg gcatggctac
3481 ctttgctagc ccgcagccga cgcagcgccc aaactctccc ttatgatgcc ttcgtggtgt
3541 tcgataaggc acagagcgca gttgccgact gggtgtataa cgagctgcgg gtgcggctgg
3601 aggagcggcg cggccgccga gccctacgct tgtgtctgga ggaccgagat tggctgcctg
3661 gccagacgct cttcgagaac ctctgggctt ccatctatgg gagccgcaag actctatttg
3721 tgctggccca cacggaccgc gtcagtggcc tcctgcgcac cagcttcctg ctggctcagc
3781 agcgcctgtt ggaagaccgc aaggacgtgg tggtgttggt gatcctgcgt ccggatgccc
3841 accgctcccg ctatgtgcga ctgcgccagc gtctctgccg ccagagtgtg ctcttctggc
3901 cccagcagcc caacgggcag gggggcttct gggcccagct gagtacagcc ctgactaggg
3961 acaaccgcca cttctataac cagaacttct gccggggacc tacagcagaa tagctcagag
4021 caacagctgg aaacagctgc atcttcatgt ctggttcccg agttgctctg cctgccttgc
4081 tctgtcttac tacaccgcta tttggcaagt gcgcaatata tgctaccaag ccaccaggcc
4141 cacggagcaa aggttggctg taaagggtag ttttcttccc atgcatcttt caggagagtg
4201 aagatagaca ccaaacccac acagaacagg actggagttc attctctgcc
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsAmanda L. Blasius, Bruce Beutler
Edit History
01/07/2011 9:01 AM (current)
12/08/2010 3:32 PM
11/12/2010 10:04 AM
09/13/2010 11:15 AM
09/07/2010 12:43 PM
08/06/2010 10:15 AM
06/23/2010 11:25 AM
06/23/2010 11:17 AM
06/23/2010 11:14 AM
06/23/2010 11:14 AM
04/29/2010 11:21 AM
02/25/2010 3:01 PM