Phenotypic Mutation 'Lps4' (pdf version)
AlleleLps4
Mutation Type missense
Chromosome4
Coordinate66,841,142 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Tlr4
Gene Name toll-like receptor 4
Synonym(s) Rasl2-8, Lps, lipopolysaccharide response
Chromosomal Location 66,827,584-66,930,284 bp (+)
MGI Phenotype Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria.
Accession Number

NCBI RefSeq: NM_021297; MGI: 96824

Mapped Yes 
Amino Acid Change Glycine changed to Aspartic acid
Institutional SourceBeutler Lab
Ref Sequences
G724D in Ensembl: ENSMUSP00000045770 (fasta)
Gene Model not available
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
Blast:LRR 148 172 N/A BLAST
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000045770)
Phenotypic Category immune system, TLR signaling defect: TNF production by macrophages
Penetrance 100% 
Alleles Listed at MGI
All alleles(8) : Targeted, knock-out(1) Spontaneous(5) Chemically induced(2)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 unclassified noncoding transcript
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 unclassified probably null
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense
Lops UTSW 4 66833880 splice acceptor site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
JAX1:Tlr4 UTSW 4 66839536 missense probably benign 0.37
JAX1:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice acceptor site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5112:Tlr4 UTSW 4 66833914 missense silent
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm, gDNA
MMRRC Submission 031073-UCD
Last Updated 12/09/2016 10:31 AM by Katherine Timer
Record Created unknown
Record Posted 04/16/2009
Phenotypic Description

The Lps4 phenotype was identified in an ENU-mutagenized G3 mouse, which had a reduced interleukin (IL)-1β response to LPS/nigericin (Figure 1A).  Subsequent testing of isolated peritoneal macrophages from additional G3 animals, including siblings of the original index mouse, found a defect in tumor necrosis factor (TNF)-α production in response to the toll-like receptor 4 (TLR4) ligand lipopolysaccharide (LPS).  TNF-α production is normal in response to all other TLR ligands tested (TLR Signaling Screen; Figure 1B).  The original index mouse has been genotyped and is heterozygous for the mutation.  

Nature of Mutation
The Tlr4 gene on Chromosome 4 of Lps4 mice was sequenced, and a G to A transition was identified in exon 3 (of 3 total exons) at position 2192 of the Tlr4 transcript.
 
2176 AACATCATCCAGGAAGGCTTCCACAAGAGCCGG
719  -N--I--I--Q--E--G--F--H--K--S--R-
 
The mutated nucleotide is indicated in red lettering, and results in a glycine to aspartic acid change at amino acid 724 of the TLR4 protein.
Protein Prediction
 
Figure 2. Protein and domain structure of TLR4. A) Schematic representation of TLR9 based on crystalized structures of mouse TLR3 LRR (PBD 3CIG) and human TLR2 TIR (1FYW) domains. The residue affected by the Lps4 mutation is highlighted. 3D image was created using UCSF Chimera. B) TLR4 is an 835 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The Lps4 mutation (red asterisk) results in a glycine to aspartic acid change at amino acid 724 of the TLR4 protein. This image is interactive. Click on the image to view other mutations found in TLR4 (red). Click on the mutations for more specific information.
The Lps4 mutation results in a glycine to aspartic acid change at amino acid 724, which is located towards the end of the αβ helix of the TLR4 TIR domain (Figures 2 and 3).  The TIR domain participates in protein-protein interactions, but a specific role for the αβ helix has not been described.  This residue is conserved amongst TLR4 homologues, but is not conserved with other TLR proteins.  It is likely the substitution of a charged amino acid for a glycine at this position disrupts helical formation as the previous amino acid is also charged. 
 
Please see the record for lps3 for information about Tlr4.
Primers Primers cannot be located by automatic search.
Genotyping
Lps4 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
Lps4(F): 5’- TCTTGGCTTGACCAGTCTCAACAC -3’
Lps4(R): 5’- TTGTCCTCCCATTCCAGGTAGGTG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C              ∞
 
Primers for sequencing
Lps4_seq(F1): 5’- GGGGTATTTGACACCCTCCATAG -3’
Lps4_seq(F2): 5’- ACAATCATCAGTGTGTCAGTGG -3’
Lps4_seq(R): 5’- GTTTCTGCTAAGAAGGCGATAC -3’
 
The following sequence of 999 nucleotides (from Genbank genomic region NC_000070 for linear DNA sequence of Tlr4) is amplified:
 
12556                 tcttg gcttgaccag tctcaacaca ttaaaaatgg ctggcaattc
12601 tttcaaagac aacacccttt caaatgtctt tgcaaacaca acaaacttga cattcctgga
12661 tctttctaaa tgtcaattgg aacaaatatc ttggggggta tttgacaccc tccatagact
12721 tcaattatta aatatgagtc acaacaatct attgtttttg gattcatccc attataacca
12781 gctgtattcc ctcagcactc ttgattgcag tttcaatcgc atagagacat ctaaaggaat
12841 actgcaacat tttccaaaga gtctagcctt cttcaatctt actaacaatt ctgttgcttg
12901 tatatgtgaa catcagaaat tcctgcagtg ggtcaaggaa cagaagcagt tcttggtgaa
12961 tgttgaacaa atgacatgtg caacacctgt agagatgaat acctccttag tgttggattt
13021 taataattct acctgttata tgtacaagac aatcatcagt gtgtcagtgg tcagtgtgat
13081 tgtggtatcc actgtagcat ttctgatata ccacttctat tttcacctga tacttattgc
13141 tggctgtaaa aagtacagca gaggagaaag catctatgat gcatttgtga tctactcgag
13201 tcagaatgag gactgggtga gaaatgagct ggtaaagaat ttagaagaag gagtgccccg
13261 ctttcacctc tgccttcact acagagactt tattcctggt gtagccattg ctgccaacat
13321 catccaggaa ggcttccaca agagccggaa ggttattgtg gtagtgtcta gacactttat
13381 tcagagccgt tggtgtatct ttgaatatga gattgctcaa acatggcagt ttctgagcag
13441 ccgctctggc atcatcttca ttgtccttga gaaggttgag aagtccctgc tgaggcagca
13501 ggtggaattg tatcgccttc ttagcagaaa cacctacctg gaatgggagg acaa
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsOwen Siggs, Bruce Beutler
Edit History
01/28/2011 6:58 PM (current)
12/08/2010 12:12 PM
12/08/2010 12:12 PM
09/03/2010 8:17 AM
09/02/2010 1:51 PM
06/23/2010 4:36 PM
06/23/2010 4:17 PM
06/23/2010 4:17 PM
02/03/2010 5:21 PM