Phenotypic Mutation 'Klein-zschocher' (pdf version)
AlleleKlein-zschocher
Mutation Type splice acceptor site (5 bp from exon)
ChromosomeX
Coordinate98,940,782 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Yipf6
Gene Name Yip1 domain family, member 6
Synonym(s) A430107J06Rik
Chromosomal Location 98,936,316-98,949,017 bp (+)
MGI Phenotype Mice homozygous or hemizygous for an ENU-induced allele exhibit colitis and increased susceptibility to induced colitis with decreased Paneth and goblet cells.
Accession Number

NCBI RefSeq: NM_207633; MGI: 1925179

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000056039 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:Yip1 62 227 2.7e-15 PFAM
Phenotypic Category DSS: sensitive day 7, immune system
Penetrance 100% 
Alleles Listed at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0673:Yipf6 UTSW X 98940837 splice donor site probably benign
Mode of Inheritance Autosomal Semidominant
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission 034313-UCD
Last Updated 12/09/2016 9:22 AM by Anne Murray
Record Created unknown
Record Posted 08/13/2012
Other Mutations in This Stock Stock #: E7848 Run Code:
Validation Efficiency: 82/87

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
Capn2 T to A 1: 182,486,594 D362V possibly damaging Het
Cdsn T to C 17: 35,556,107 V511A probably benign Homo
Cml5 T to G 6: 85,817,619 T120P probably damaging Homo
Cyp2j11 T to A 4: 96,319,365 I238L probably benign Het
Sybu A to T 15: 44,673,422 S503T probably benign Homo
Trappc8 T to C 18: 20,850,918 H681R possibly damaging Het
Phenotypic Description

Figure 1. Increased susceptibility of Klein-Zschocher mice to induced colitis. (A, B) Percent weight change of mice given 1% DSS in drinking water for seven days. (A) Approximately 6000 mutagenized mice (ENU) were screened; approximately 2300 are shown here. WT (C57BL/6J) mice receiving 1% DSS (n=200) or 0% DSS (n=100) served as controls. Strains with transmissible mutations (light blue); Klein-Zschocher (red). (B) n= 8-9 each group including hemizygous males and homozygous females; for days 1 and 2, only three mice from each group were weighed. Unpaired T-test, *** p<0.0005. (C) Representative photomicrographs (magnification 200X; H&E) of colons from mice at day 7 of 1% DSS administration. (D) Survival of mice after administration of 4% DSS. n=8-10 each group; log rank (Mantel-Cox) Test, *** p<0.0001 (E) Plasma FITC-dextran concentrations in naive mice 4 hours following oral gavage. n= 4-7 each group; unpaired T-test, ** p=0.0091. (F) Percent weight change of BM chimeric mice upon administration of 1% DSS in the drinking water. KLZ, Klein-Zschocher. n=4-5 each group; unpaired T-test, ** p<0.005, *** p< 0.001. (G) Colon length of 16-month-old mice. n=6-10 males each group; unpaired T-test, * p < 0.05. (H) Representative photomicrographs (H&E; panels a-g, magnification 100X; panel h, magnification 400x) showing pathology of distal small intestines and colons from 16-month-old male mice.  See text for description.  All error bars represent s.e.m. Obtained from (1).

Figure 2. Non-hematopoietic cells are responsible for the DSS colitis phenotype in Klein-Zschocher mice. (A) Representative photomicrographs (magnification 100X, H&E staining) of colons from different chimeric mice. (B) Colon length from different chimeric mice. n= 4-5 each group, unpaired T-test, *** p<0.0001. KLZ, Klein-Zschocher. Obtained from (1).

Figure 3. Aberrant morphology of Paneth and goblet cells of Klein-Zschocher mice. H&E (A-D) and periodic acid-Schiff (PAS) staining (E-H) of small intestines and colons (magnification 200x). Arrows point to Paneth cells; asterisks are beside goblet cells. Electron microscopy of Paneth (I, J, M, N) and goblet (K, L, O, P) cells. (Q) mRNA from small intestine of WT and Klein-Zschocher mice analyzed for cryptdin-4 (Defcr4), cryptdin-5 (Defcr5), cryptdin-3 (Defcr3), lysozyme and Chop expression. Data are normalized to 18S, n=5-8 each group, unpaired T-test, * p<0.05, ** p<0.01. Error bars represent s.e.m. (R) Lysozyme immunoblot of protein extracts from small intestine of WT (B6) and Klein-Zschocher (KLZ) mice. Tubulin was used as a loading control. Obtained from (1).

The Klein-Zschocher phenotype was identified in a screen of ENU-mutagenized G3 mice for mutants susceptible to dextran sulfate sodium (DSS)-induced colitis (DSS-induced Colitis Screen) (Figure 1A); Klein-Zschocher exhibited weight loss upon exposure to 1% DSS (Figure 1B) (1).  Histological examination of colons from the Klein-Zschocher mice revealed leukocyte recruitment as well as crypt loss seven days post-exposure to 1% DSS (Figure 1C) (1).  An increase in the dosage of DSS led to an increased rate of weight loss and lethality within seven to nine days post-exposure (Figure 1D) (1).  Even without exposure to DSS, intestinal permeability was increased in the mutant mice by 85% compared to the wild-type mice (Figure 1E) (1).  Observation of mutant mice housed under pathogen-free conditions found that there was no pathology for up to one year.  However, by 16 months, the mutants had shortening of the colon (Figure 1G) as well as cellular defects of the lamina propria and epithelium in the small intestine and colon (Figure 1H) (1).

 

Bone marrow chimeric mice (in which donors and/or recipients were either wild-type or Klein-Zschocher mutant mice) were treated with DSS and it was found that mutant mice that received wild-type bone marrow exhibited weight loss (Figure 1F), disruption of the epithelial in the colon (Figure 2A), and shortening of the colon (Figure 2B); these phenotypes were not observed in wild-type mice that received bone marrow from the mutants (1)

 

The morphology of the Klein-Zschocher small intestine and colon were normal (Figure 3A-D).  However, goblet and Paneth cells were reduced in number as well as had less stainable material and an odd shape (Figure 3E-H) (1).  The mutant colon also had reduced mucin (Figure 3G, H) (1).  Examination of the Paneth cells by electron microscopy showed smaller, disorganized granules (Figure 3I, J, M, N); goblet cell mucin granules were smaller and variable in electron density when compared to wild-type mice (Figure 3K, L, O, P) (1).  mRNA expression of the defensin peptides cryptidin-3, -4, -5 and lysozyme were reduced (Figure 3Q); examination of the lysozyme protein levels revealed that the level of protein was reduced (Figure 3R) (1).

Nature of Mutation

The Klein-Zschocher mutation was mapped (using C3H/HeN) to Chromosome X with a LOD score of 17.4 (1).  Analysis of 79 meioses confined the mutation to a critical region bounded by DXMit114 and DXMit169 (95.34-97.952 MB).  Whole genome SOLiD sequencing of DNA from four mutant animals on four SOLiD slides identified a single coding/splicing mutation within the critical region:  a T to A transversion at position 3002 of the genomic DNA sequence of Yipf6 (NC_000086.6), encoding the 236 amino acid protein Yipf6.  Capillary sequencing confirmed the hemizygous status of the mutation in all the males sequenced using SOLiD.  The mutation lies in the splice acceptor site of intron 3 of the seven exon gene, and affects a thymine base five nucleotides from the next exon.  cDNA sequencing revealed that the mutation results in skipping of exon 4.  Splicing of exon 3 to exon 5 creates a frameshift and a stop premature codon at position 89 (the first abnormal codon after exon 3):

 

      <--exon 3           <--intron 3 exon 4-->    exon 5-->    
724  …CTGTTAAGAGACT GTGAG……CTCATTGTAG GGGAC……GCATT GATGTTACAGAAA…   
85   …-L--L--R--D--                   W--D-……-A--L --M--L--Q--K-…

                                correct

 

          <--exon 3  exon 4-->    exon 5-->    

724 …CTGTTAAGAGACT  ------------ GATGTTACAGAAA…

85  …-L--L--R--D--*-...........................

                      aberrant

    

The mutated nucleotide is indicated in red; the splice acceptor sequence is shown in blue.  

Protein Prediction

Figure 4.  Inferred evolutionary relationships between known Yip1 family members based on sequence homology calculated from multiple sequence alignment using ClustalW.  Protein functions, where known, are described.

Proteins of the Ypt1p-interacting protein 1 (Yip1) family are thought to regulate Rab protein-mediated ER to Golgi membrane transport.  In Saccharomyces cerevisiae, the family consists of Yip1p (the founding member) (2), Yip4p, and Yip5p (3); in mammals, there are seven recognized members designated Yipf1-7 of which Yipf5 and Yipf7 (also called Yip1A and Yip1B, respectively) reportedly represent the closest homologues of yeast Yip1p (4) (Figure 4).  Yip1 family proteins are defined by the Yip1 domain, a ~200 amino acid integral membrane domain containing four transmembrane α helices and the motifs DLYGP and GY (NCBI Conserved Domain cl12048, Pfam PF04893).  Yeast proteins Yip2p (Yop1p) (5) and Yip3p (Pra1p) (6) lack the Yip1 domain and are thus not considered Yip1 family members.  The Yip1 domain spans essentially the full length of Yip1 family proteins, which are relatively small (235-350 aa).  In Yipf6, the Yip1 domain is predicted by SMART and Pfam to encompass residues 62-227.

 

Yip1 family proteins share several features.  First, a common domain topology defined by the Yip1 domain.  Predictions based on hydropathy plots indicated that yeast Yip1p, Yip4p, and Yip5p, and mouse Yip1A and Yip1B possess a soluble N-terminal domain oriented toward the cytosol and a C-terminal domain with multiple hydrophobic segments that span or are inserted into the membrane (2-4).  Such a topology has been verified experimentally for Yip1p (2).

 

Second, Yip1 proteins possess an ability to interact with Rab proteins in a manner dependent on Rab C-terminal dual prenylation.  Rabs are intrinsically cytosolic, but their function depends on membrane association mediated by geranylgeranyl groups covalently attached to one or both cysteines in their C-terminal dicysteine motif (7;8).  Rab protein constructs lacking both C-terminal cysteines, or modified to support either mono-geranylation or prenylation with farnesyl instead of a geranyl group, failed to interact with Yip1p in yeast two-hybrid experiments (7); Yip4p and Yip5p were also unable to interact in vitro with a Rab protein lacking its C-terminal dicysteine motif (3).  The nucleotide-binding conformation of Rab proteins (for GTP versus GDP) did not affect Yip1p binding (7).  The cytoplasmic N-terminal hydrophilic domain of Yip1p was sufficient to interact with Ypt1p, suggesting that Yip1 proteins recognize and bind to Rabs through their N-terminal domains. 

 

Third, Yip1 proteins physically associate with other Yip1 family members.  This property has been demonstrated by yeast two-hybrid and pull down experiments for Yip1p, Yip4p, and Yip5p (2;3;9;10).  Yip1 proteins likely function within a larger protein complex, as has been demonstrated for Yip1p, whose interactors include Yif1p (11), Yos1p (12), Yip3p (6), and Yop1p (5).

Figure 5.  Predicted domain and topographic organization of Yipf6.  The Klein-zschocher mutation is denoted by a red asterisk. KLZ, Klein-zschocher; TM, transmembrane domain.

 

Mouse Yipf6 is 21% identical and 31% similar in sequence to Yip1p, and sequence alignment by Clustal analysis indicates that this similarity extends across the full length of the proteins.  Like Yip1p, Yipf6 is predicted to consist of a soluble, cytoplasmic N-terminal domain (roughly 40% of the length of the protein) and a C-terminal domain containing five transmembrane α helices connected by short loops (UniProt, SMART, Pfam, NetSurfP predictions).  The C terminus is oriented away from the cytosol.  Yipf6 is predicted to be N-glycosylated at amino acids 55 and 145.

 

The Klein-Zschocher mutation causes a premature stop at position 89 of the 236 amino acid protein (Figure 5).

Expression/Localization
Figure 6. Yipf6 is mainly expressed in the intestinal tract and localizes with Golgi marker and COPII coat protein. (A) mRNA levels of Yipf6 in different tissues. (B) Detection of Yipf6 in transfected HEK293 cells with Flag antibody and a rabbit polyclonal antibody raised against the N-terminal domain of Yipf6.  KLZ, Klein-Zschocher. (C) Immunoprecipitation from Yipf6-transfected cell lysates using anti-Flag beads or using biotinylated Yipf6 antibody followed by streptavidin beads. (D) Localization by confocal microscopy of murine Yipf6 protein in HEK293 cells transfected with Flag-Yipf6 construct.  Cells were stained with polyclonal Yipf6 antibody along with antibodies for the Golgi marker GM130, TGN46, COPII coat protein Sec31a and the mitochondrial marker MTC02.  Nuclei were stained with Hoeschst 33342 (magnification 600x). Obtained from (1).

Mammalian Yip1 family proteins display distinct tissue specificities.  Mouse Yip1A transcript was detected in heart, brain, spleen, lung, liver, kidney, and testis, whereas mouse Yip1B was observed predominantly in the heart (4).  By RT-PCR analysis, prominent expression of human YIP1A was found in the duodenum, heart, ileum, jejunum, pancreas, prostate, retina, small intestine, uterus, colon tumor and lung tumor as well as in fibroblasts. The highest level of YIP1A expression was detected in cultured coronary smooth muscle cells (13).  Human YIPF3 (KLIP1) protein was expressed in nucleated hematopoietic cells, from early embryonic hematopoietic stem cells through mature adult blood lymphoid lineages, either as membrane or as cytoplasmic molecules (14).  Among mature blood cells, surface KLIP1 expression was restricted to CD56+ NK cells.

 

Yipf6 was verified to be expressed throughout the gastrointestinal tract by RT-PCR, with high expression in the colon (Figure 6A(1).  The Yipf6 protein has three predominant bands (25, 45, and 75 kDa) by Western blot analysis of an N-terminally Flag-tagged full length protein (Figure 6B, C(1).  The predicted molecular weight of Yipf6 is 26 kDa, therefore, it is proposed that the multiple bands by immunoblot indicate that Yipf6 self-associates similar to other Yip family members (2;3;9). Yipf6 colocalizes with the cis-Golgi marker GM130, the trans-Golgi network marker TGN46, and the coat protein complex II (COPII) marker Sec31a (Figure 6D(1), indicating that Yipf6 transits the Golgi compartments.

 

Among human tissues, the GNF SymAtlas indicates elevated Yipf6 transcript levels in TfR1-expressing early erythroid cells (30 to 50-fold over the average level of expression), as well as possibly elevated levels in placenta, prostate, fetal liver, and in some brain regions (at least 3-fold above the median).  Mouse salivary gland, prostate, and possibly the large intestine and some immune cell types (B cells, thymocytes, macrophages, LPS-stimulated macrophages) displayed transcript expression levels at least 3-fold higher than the median.  Please see the charts displayed here

Background

Figure 7.  Steps of vesicle budding and fusion.  (1) Initiation of coat assembly.  The membrane-proximal coat components (purple) are recruited to the donor compartment by binding to a membrane-associated GTPase (orange) and/or to a specific phosphoinositide.  Transmembrane cargo proteins and SNAREs begin to gather at the assembling coat.  (2) Budding.  The membrane-distal coat components (green) are added and polymerize into a mesh-like structure.  Cargo becomes concentrated and membrane curvature increases. (3) Scission.  The neck between teh vesicle and the donor compartment is severed either by direct action of the coat or by accessory proteins.  (4) Uncoating.  The vesicle loses its coat due to various events including inactivation of the small GTPase, phosphoinositide hydrolysis, and the action of uncoating enzymes.  Cytosolic coat proteins are then recycled for addiotnal rounds of vesicle budding.  (5) Tethering.  The "naked" vesicle moves tot eh acceptor compartment, possibly guided by the cytoskeleton, and becomes tethered to teh acceptor compartment by the combination of a GTP bound Rab and a tethering factor.  (6) Docking.  The v- and t-SNAREs assemble into a four-helix bundle.  (7) This "trans-SNARE complex" promotes fusion of the vesicle and acceptor lipid bilayers.  Cargo is transferred tot eh acceptor compartment, and the SNAREs are recycled.  Figure reproduced from Stolle et al. (2005).

Newly synthesized secretory proteins pass through a series of membrane-enclosed organelles, including the ER, the Golgi complex, and secretory granules, on their way to the extracellular space [reviewed in (15)].  Proteins destined for residence at the plasma membrane, endosomes, or lysosomes share the early stations of this pathway (ER and Golgi) with secretory proteins.  The transfer of proteins from one organelle to the next is mediated by transport vesicles following a process divided conceptually into seven steps that are reiterated for each inter-organellar transport event until the protein cargo reaches its destination (Figure 7).  Each step is regulated by a distinct set of proteins, including cytosolic coat proteins that mediate the generation of transport vesicles, and conserved membrane fusion factors such as SNARE proteins that mediate site-specific fusion of vesicles with target membranes.  GTPases of the Rab family are required for tethering the transport vesicle to the target membrane before SNARE-mediated fusion.

 

The first Yip1 family member, Saccharomyces cerevisiae Yip1p, was discovered as a yeast two-hybrid interactor of Ypt1p and Ypt31p (the yeast homologs of mammalian Rab1 and Rab11, respectively) (2).  Both Ypt1p and Ypt31p function in the yeast exocytic pathway, and are localized primarily to Golgi membranes.  By acting as a tethering factor localized at target membranes, Ypt1p is required for ER to cis-Golgi transport of vesicles that depend on COPII coat proteins for their formation and budding (16;17).  Ypt1p has also been implicated in cis- to medial-Golgi transport (18).  Ypt1p acts together with large heteromeric tethering complexes such as the Uso1 complex (yeast homolog of mammalian p115) and the GEF-containing TRAPP1 complex.  An interaction between Uso1 and Ypt1p appears to be required for vesicle tethering and for assembly of the SNARE complex at the target membrane (19-21).  TRAPP1 acts as a GEF for Ypt1p, activating Ypt1p preceding membrane fusion (22-25).  Ypt31p and the closely related Ypt32p (81% identical in amino acid sequence) are required for the exit of vesicles from the trans-Golgi (18;26).  Like Ypt1p and Ypt31p, Yip1p is essential for viability in yeast (2).

Figure 8.  COPII vesicle formation and fusion, and hypothesized involvement of Yip1p.  The COPII coat assembles by the stepwise deposition of Sar1p-GTP, Sec23p-Sec24p, and Sec13p-Sec31p at ER exit sites (ERES).  Cytosolic Sar1p-GDP is converted to membrane bound Sar1pGTP by the transmembrane GEF Sec12p.  Sar1p-GTP then recruits the Sec23p-Sec24p subcomplex by binding to Sec23p, forming the pre-budding complex.  Transmembrane cargo proteins are concentrated in COPII-coated buds by binding to Sec24p using a variety of ER export signals.  Sec13p-Sec31p polymerizes onto Sec23p-Sec24p to form a mesh-like scaffold and crosslink the pre-budding complex.  Yip1p is thought to cycle between the ER and golgi compartments.  Yip1p may promote the process of vesicle budding by interacting with Sec13p, Sec31p, Sec23p, or Sec24p.  As COPII vesicles travel towards the Golgi, they are thought to become uncoated.  They approach Golgi arrival sites (GoAS) and become tethered by the combination of Ypt1p which is activated by the GEF complex TRAPP1, and the tethering factor Uso1/p115.  v- and t-SNARES then assemble into a four-helix bundle to mediate vesicle docking, and fusion of the lipid bilayers of the vesicle and Golgi membranes occurs.  Yip1f forms part of a Ypt1p-interacting complex with Yif1p and Yos1p, and may promote Ypt1p-dependent vesicle tethering to the Golgi membrane.

 

The function of Yip1p is not entirely clear.  Yip1p was identified by its interaction with Ypt1p, which is known to be required for vesicle tethering prior to fusion with Golgi membranes.  Yip1p interacts with multiple Rabs in a manner dependent on C-terminal dual prenylation of the Rab (7).  Furthermore, Yip1p was found to exist in a complex with Yif1p (11) and Yos1p (12), essential yeast proteins that when mutated block transport between the ER and Golgi, resulting in an accumulation of ER membranes, vesicles, and tubulovesicles.  These findings suggested that Yip1p regulates or itself serves as the membrane receptor for Rab proteins, and pointed to a potential role in vesicle tethering to Golgi membranes (Figure 8).  However, neither depletion, antibody inhibition, or temperature sensitive mutation of Yip1p or Yif1p inhibited Ypt1p membrane association in vitro (27;28).  Unexpectedly, Heidtman et al. show by a variety of approaches that Yip1p is required for the budding of COPII-derived vesicles from the ER, but not for the tethering and fusion of those vesicles at the Golgi (27).  Barrowman et al. reported slightly different findings that Yip1p performs a critical role at the time of budding in establishing the fusion competence of ER transport vesicles (28).  Antibodies against Yip1p or Yif1p blocked transport to the Golgi, but only reduced budding efficiencies by half.  The vesicles that formed in the presence of anti-Yip1p antibodies failed to fuse with Golgi membranes.  Thus, these reports indicated a role for Yip1p during COPII vesicle biogenesis (Figure 8).

 

Because some Rab proteins, including Rab1, have been implicated in programming vesicles for docking and fusion competency (29), it was proposed that Yip1p may act to recruit Ypt1p or other Rabs into forming vesicles, thus coupling vesicle formation with incorporation of cargoes necessary for subsequent docking and fusion.  However, ypt1 thermosensitive mutant yeast strains accumulate transport vesicles at nonpermissive temperatures, demonstrating that Ypt1p is not required for the formation of vesicles, but rather for their fusion to target membranes (30)In vitro data further supported this conclusion (31-33).  These findings argue against a role for Ypt1p in COPII vesicle formation, and suggest a Ypt1p-independent function for Yip1p in vesicle budding.  However, extensive mutagenesis spanning the entire Yip1p protein failed to yield any conditional allele that was selectively defective in either Golgi Rab or COPII gene interaction, suggesting that Yip1p acts in a common pathway involving both COPII vesicle proteins and Golgi Rab proteins (34).

 

Families of Yip1p homologues are found in all eukaryotes so far examined (3;4;35).  Yip1A (Yipf5) and Yip1B (Yipf7) represent the mammalian homologues of yeast Yip1p and share about 31% identity with Yip1p overall.  Human YIP1A rescued a yeast Yip1p deletion, indicating a conservation of function (7).  However, the interaction between yeast Yip1p and Ypt1p was not recapitulated in mouse:  both Yip1A and Yip1B failed to interact with Rab1 (4), suggesting a distinct spectrum of Rab interactions or that Yip1A/B function Rab-independently in mammals.  Yip1A localized to vesicular structures that also showed staining for Sec31 and Sec13, essential components of the COPII complex found at ER exit sites (ERES) (4).  A GST fusion protein of the N-terminal cytoplasmic domain of Yip1A interacted with the Sec23/24 subunit of the mammalian COPII complex in pull down experiments from rat liver cytosolic extracts.  Overexpression of the cytoplasmic domain of Yip1A in mammalian cells blocked ER to Golgi transport.  These data are consistent with a role for Yip1A in COPII-dependent vesicle budding from the ER.

Putative Mechanism

The maturation of transmembrane and GPI-anchored proteins requires their shuttling in COPII vesicles from the ER, where they are synthesized and embedded into the membrane, to the Golgi, from which these proteins are targeted to the plasma membrane.  Since numerous proteins required to sense or respond to microbes upon disruption of the intestinal epithelial barrier are transmembrane proteins, it is possible that an impairment of ER to Golgi transport might prevent their normal expression at the cell membrane and cause susceptibility to induced colitis.  Such proteins include TLRs, EGFR, and EGFR ligands such as amphiregulin (AREG), and epiregulin (EREG), all of which have been implicated in susceptibility to DSS-induced colitis (see Velvet and wavedX) (36).  It is unclear whether defective transmembrane protein expression potentially caused by Yipf6 mutation would be specific to a subset of proteins including TLRs, EGFR, etc., or whether intestinal epithelial cells might be hypersensitive to a general impairment of transmembrane protein expression.  The coat protein Sec24p plays a central role in cargo selection (37;38), and mammalian Yip1A has been shown to interact with Sec23/24 of the COPII complex in vitro (4), suggesting by extension that Yipf6 may influence cargo selection through an interaction with COPII components.  Ypt1p has been implicated in sorting of GPI-anchored proteins into ER transport vesicles (39), potentially linking Yip1p (and Yipf6) to protein sorting at ER exit sites.  Although Yip1 gene family members are proposed to regulate Rab protein-mediate ER to Golgi membrane transport, examination of pancreatic acinar cells found that the cells were swollen as well as a colocalziation of Yipf6 and Sec31a. These findings indicate that Yipf6 may be required for membrane transport from the ER to Golgi via COPII vesicles.  A link between membrane transport and Yipf6 has not been examined in the intestine. 

 

Characterization of the Klein-Zschocher mouse found that Yipf6 is necessary for granule secretion by Paneth and globet cells in the intestine (1).  Histological examination of the legions found in both the small and large intestines of these mice indicates that the observed intestinal inflammation mimics Chrohn’s disease and that YIPF6 could be a susceptibility locus for IBD in humans (1).

Primers Primers cannot be located by automatic search.
Genotyping

Klein-Zschocher genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers

KlZ (F): 5’-ACATGAACGTAGAACCTGCTCACAG -3’

KlZ (R): 5’- AGGCACAGAACCAGTTTCCTTGATG -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7)  4°C              ∞

 

Primers for sequencing

KlZ_seq(F): 5’- TGGAGAACAGATTGTCCATAGCTC -3’

KlZ_seq(R): 5’- GTGTGGGCTACATACTACAACTC -3’

 

The following sequence of 794 nucleotides (from Genbank genomic region NC_000086.6 for linear genomic sequence of Yipf6, sense strand) is amplified:

 

                                                     acatga acgtagaacc

2641 tgctcacagt tgaatttgct aatgtgattt ggctgtcgtt aggaatccaa ggtgattgag

2701 attctctcta ggccctgaca tcacaggcag aatatcttac ttgaatattg tgtccatgtg

2761 gagaacagat tgtccatagc tcttaatgtg ctagaatggg gattaggaaa tgaagaaagg

2821 gtaatttatg acacgtgaaa ataacaaacc ttaaaggata tatgaagtaa gggagggaaa

2881 cagaaaggtt gggaaggctt aggtaaacct tgctgctagg attctgagtg gaaggtaagt

2941 aattaggtaa agatagaaaa tatggcatat tggtttctta gcatcttgtc tttcctctca

3001 ttgtagggga cctgtggggc ccattgatac tttgtgtgac acttgcattg taagtattta

3061 tacttcttcc tcactggagc ctgtttttgt ttagttttgt tttaatgggc tttccagaat

3121 taaggaaaaa attgactagg cctttagggc gtcttctatt ttttttaatt tatttattaa

3181 gaaagaaaag ataagagttg tagtatgtag cccacactat cctggaactt tctgtgtagc

3241 ccaggctggc ctcaaacttg tgcttctcct gctccaactt ctgagtccta gtatttcaag

3301 tatgcaccac cacaccataa cttaaaattt atatttattg tatactcatt tagattataa

3361 tgtagtttca ctttcttgtt cttttaataa tcacatcaag gaaactggtt ctgtgcct

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References
Science Writers Eva Marie Y. Moresco, Anne Murray
Illustrators Diantha La Vine
AuthorsKatharina Brandl, Bruce Beutler