Phenotypic Mutation 'Nabukov'

• Allele: Nabukov
• Mutation Type: missense
• Chromosome: 19
• Coordinate: 46,296,878 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Nfkb2
• Gene Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
• Synonym(s): p52, NF kappaB2
• Chromosomal Location: 46,292,759-46,300,824 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The protein encoded by this gene can function as both a transcriptional activator or repressor depending on its dimerization partner. The p100 full-length protein is co-translationally processed into a p52 active form. Chromosomal rearrangements and translocations of this locus have been observed in B cell lymphomas, some of which may result in the formation of fusion proteins. There is a pseudogene for this gene on chromosome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit gastric hyperplasia, enlarged lymph nodes, enhanced cytokine production by activated T cells, absence of Peyer's patches, increased susceptibility to Leishmania major, and early postnatal mortality. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000072859] [ENSMUSP00000107512]
• AlphaFold: Q9WTK5
• PDB Structure: Crystal structure of the dimerization domains p52 homodimer [X-RAY DIFFRACTION] ; Crystal structure of the dimerization domains p52 and RelB [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000072859; Gene: ENSMUSG00000025225; AA Change: D316G

Domain	Start	End	E-Value	Type
Pfam:RHD_DNA_bind	40	220	1.3e-67	PFAM
IPT	227	326	3.48e-27	SMART
low complexity region	351	382	N/A	INTRINSIC
low complexity region	391	409	N/A	INTRINSIC
ANK	487	522	5.58e1	SMART
ANK	526	555	9.78e-4	SMART
ANK	559	591	3.74e0	SMART
ANK	599	628	3.36e-2	SMART
ANK	633	663	1.3e1	SMART
ANK	667	696	4.26e-4	SMART
low complexity region	707	721	N/A	INTRINSIC
ANK	729	758	2.35e3	SMART
DEATH	764	851	5.52e-16	SMART
low complexity region	879	894	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
  (Using ENSMUST00000073116)
• SMART Domains: Protein: ENSMUSP00000107512; Gene: ENSMUSG00000025225; AA Change: D316G

Domain	Start	End	E-Value	Type
Pfam:RHD	40	220	1.3e-67	PFAM
IPT	227	326	3.48e-27	SMART
low complexity region	351	382	N/A	INTRINSIC
low complexity region	391	409	N/A	INTRINSIC
ANK	487	522	5.58e1	SMART
ANK	526	555	9.78e-4	SMART
ANK	559	591	3.74e0	SMART
ANK	599	628	3.36e-2	SMART
ANK	633	663	1.3e1	SMART
ANK	667	696	4.26e-4	SMART
low complexity region	707	721	N/A	INTRINSIC
ANK	729	758	2.35e3	SMART
DEATH	764	851	5.52e-16	SMART
low complexity region	879	894	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
  (Using ENSMUST00000111881)
• Meta Mutation Damage Score: 0.2738
• Is this an essential gene?: Possibly essential (E-score: 0.586)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:25 PM by Diantha La Vine
• Record Created: 2019-05-18 1:35 PM by Bruce Beutler
• Record Posted: 2019-05-22
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_019408; MGI: 1099800

Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(3) Targeted(8) Transgenic(2)

Phenotypic Description

Figure 1. Nabukov mice exhibit decreased frequencies of peripheral T cells. Raw cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Nabukov mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Nabukov mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Nabukov phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4493, some of which exhibited increased frequencies of T cells (Figure 1), CD4+ T cells (Figure 2), and CD8+ T cells (Figure 3) in the peripheral blood.

Nature of Mutation

Figure 4. Linkage mapping of the increased T cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 41 mutations (X-axis) identified in the G1 male of pedigree R4493. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 41 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Nfkb2:  an A to G transition at base pair 46,308,439 (v38) on chromosome 19, or base pair 4,120 in the GenBank genomic region NC_000085. The strongest association was found with an additive model of inheritance to the T cell frequency phenotype (P = 9.53 x 10^-5), wherein two variant homozygotes and 18 heterozygous mice departed phenotypically from 12 homozygous reference mice (Figure 4).  

The mutation corresponds to residue 1,256 in the mRNA sequence NM_019408 (variant 1) within exon 10 of 22 total exons.

1240 CGCAAGCGTGGGGGCGATGTCTCGGACTCCAAA 311  -R--K--R--G--G--D--V--S--D--S--K-

The mutated nucleotide is indicated in red.  The mutation results in an aspartic acid to glycine substitution at position 316 (D316G) in all isoforms of the NF-κB2 protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 0.991).

Protein Prediction

Figure 5. Domain structure of the NF-κB2 p100 protein. The Nabukov mutation (D316G) is noted. This image is interactive. Other mutations are noted in red. Click on each allele for more information.

The Nfkb2 gene encodes a roughly 100 kD 899 amino acid protein (p100), which is cleaved at amino acids 454-455 to produce an active 52-kD transcription factor (p52) that is a member of the NF-κB family of transcription factors [reviewed in (1)]. The members of the NF-κB family (i.e., NF-κB1 (p50 and its precursor p105; see the record for Finlay), RelA (also known as p65), c-Rel, and RelB) are characterized by the presence of an N-terminal Rel homology domain (RHD) that is responsible for homo- and heterodimerization as well as for sequence-specific DNA binding. Unlike RelA, c-Rel, and RelB, p52 and p50 do not contain a C-terminal transcription activation domain (TAD).  p52 is able to heterodimerize with most other NF-κB proteins, but preferentially binds to RelB, as does the p100 precursor (2-4). p52 homodimers likely repress transcription by competing with other NF-κB dimers for binding sites in the promoters of NF-κB activated genes. Both the p100 and p105 proteins contain multiple C-terminal ankyrin repeats (seven in p100), a common feature shared by IκB family members (Figure 5).  Between the RHD and the ankyrin repeats is a glycine-rich region (GRR) that is essential for determining the site of p100 cleavage into the p52 subunit.  p100 also contains a C-terminal death domain (DD) at amino acids 764-851 that associates with the S9 subunit of the 19 S protease (5). Death domains are conserved regions that are usually involved in homotypic protein interactions, and are composed of a bundle of six α-helices.

The Nabukov mutation results in an aspartic acid to glycine substitution at position 316 (D316G); amino acid 316 is within an undefined region between the RHD and the GRR.

Please see the record xander for more information about Nfkb2.

Putative Mechanism

The NF-κB signaling pathway functions in essentially all mammalian cell types and is activated in response to injury, infection, inflammation and other stressful conditions requiring rapid reprogramming of gene expression. The non-canonical NF-κB pathway drives the post-translational processing of p100 to mature p52 through IKK-1 and NIK, and results in the activation of p52/RelB heterodimers (1;3;4;6), and appears to be mostly restricted to a subset of tumor necrosis factor (TNF) receptors including lymphotoxin-β receptor (LTβR), B cell activating receptor (BAFFR), CD40, receptor activator of NF-κB (RANK) and TNF-related weak inducer of apoptosis (TWEAK) (7-11). These receptors are involved in secondary lymphoid organogenesis (SLO), B cell differentiation, survival and homeostasis, osteoclastogenesis, and angiogenesis (6).

Mice homozygous for targeted null mutations of Nfkb2 exhibit absence of Peyer's patches (PPs) and reduced lymph nodes, increased susceptibility to certain pathogens, impaired B cell maturation, aberrant T cell function, and early postnatal mortality [reviewed by (12)]. They also exhibit disruption of splenic architecture that includes an absence of the splenic follicular marginal zone and marked depletion of B cell follicular areas or germinal centers (13-15).

The phenotype of the Nabukov mice indicates loss of NF-κB2-associated function in T cells. Some residual function may remain as the Nabukov mice do not show B cell defects. 

Primers

PCR Primer
Nabukov_pcr_F: ATGGATGGCAAGCCTTTGGG
Nabukov_pcr_R: GGGGTGTTAAAACCTAATATGGGTC

Sequencing Primer
Nabukov_seq_F: GCAAGCCTTTGGGGACTTCTC
Nabukov_seq_R: GTCAGACCCTAGATTCCTCAAGCTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 19, + strand):

1   atggatggca agcctttggg gacttctctc ccacagacgt tcataaacag gtactgaggg
61  actagggcct gtcctggaga cagaactacg aagaaacctt actgacacca tgttgctctc
121 ccatcctcca ccccagtatg ccattgtgtt ccggacaccg ccctatcaca agatgaagat
181 cgagaggcct gtaacggtgt tcctgcagct gaaacgcaag cgtgggggcg atgtctcgga
241 ctccaaacag ttcacatatt accctctggt ggaaggtgag tcgggcttca gcattcccaa
301 aggctggacg gagcgaggcg ggccaggagg tggcctagag ttgactccca ggagccagct
361 tgaggaatct agggtctgac ccatattagg ttttaacacc cc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Vallabhapurapu, S., and Karin, M. (2009) Regulation and Function of NF-kappaB Transcription Factors in the Immune System. Annu Rev Immunol. 27, 693-733.

  2. Dobrzanski, P., Ryseck, R. P., and Bravo, R. (1995) Specific Inhibition of RelB/p52 Transcriptional Activity by the C-Terminal Domain of p100. Oncogene. 10, 1003-1007.

  3. Senftleben, U., Cao, Y., Xiao, G., Greten, F. R., Krahn, G., Bonizzi, G., Chen, Y., Hu, Y., Fong, A., Sun, S. C., and Karin, M. (2001) Activation by IKKalpha of a Second, Evolutionary Conserved, NF-Kappa B Signaling Pathway. Science. 293, 1495-1499.

  4. Yilmaz, Z. B., Weih, D. S., Sivakumar, V., and Weih, F. (2003) RelB is Required for Peyer's Patch Development: Differential Regulation of p52-RelB by Lymphotoxin and TNF. EMBO J. 22, 121-130.

  5. Fong, A., and Sun, S. C. (2002) Genetic Evidence for the Essential Role of Beta-Transducin Repeat-Containing Protein in the Inducible Processing of NF-Kappa B2/p100. J Biol Chem. 277, 22111-22114.

  6. Dejardin, E. (2006) The Alternative NF-kappaB Pathway from Biochemistry to Biology: Pitfalls and Promises for Future Drug Development. Biochem Pharmacol. 72, 1161-1179.

  7. Xiao, G., Harhaj, E. W., and Sun, S. C. (2001) NF-kappaB-Inducing Kinase Regulates the Processing of NF-kappaB2 p100. Mol Cell. 7, 401-409.

  8. Luftig, M. A., Cahir-McFarland, E., Mosialos, G., and Kieff, E. (2001) Effects of the NIK Aly Mutation on NF-kappaB Activation by the Epstein-Barr Virus Latent Infection Membrane Protein, Lymphotoxin Beta Receptor, and CD40. J Biol Chem. 276, 14602-14606.

  9. Kayagaki, N., Yan, M., Seshasayee, D., Wang, H., Lee, W., French, D. M., Grewal, I. S., Cochran, A. G., Gordon, N. C., Yin, J., Starovasnik, M. A., and Dixit, V. M. (2002) BAFF/BLyS Receptor 3 Binds the B Cell Survival Factor BAFF Ligand through a Discrete Surface Loop and Promotes Processing of NF-kappaB2. Immunity. 17, 515-524.

  10. Coope, H. J., Atkinson, P. G., Huhse, B., Belich, M., Janzen, J., Holman, M. J., Klaus, G. G., Johnston, L. H., and Ley, S. C. (2002) CD40 Regulates the Processing of NF-kappaB2 p100 to p52. EMBO J. 21, 5375-5385.

  11. Saitoh, T., Nakayama, M., Nakano, H., Yagita, H., Yamamoto, N., and Yamaoka, S. (2003) TWEAK Induces NF-kappaB2 p100 Processing and Long Lasting NF-kappaB Activation. J Biol Chem. 278, 36005-36012.

  12. Gerondakis, S., Grumont, R., Gugasyan, R., Wong, L., Isomura, I., Ho, W., and Banerjee, A. (2006) Unravelling the Complexities of the NF-kappaB Signalling Pathway using Mouse Knockout and Transgenic Models. Oncogene. 25, 6781-6799.

  13. Caamano, J. H., Rizzo, C. A., Durham, S. K., Barton, D. S., Raventos-Suarez, C., Snapper, C. M., and Bravo, R. (1998) Nuclear Factor (NF)-Kappa B2 (p100/p52) is Required for Normal Splenic Microarchitecture and B Cell-Mediated Immune Responses. J Exp Med. 187, 185-196.

  14. Franzoso, G., Carlson, L., Poljak, L., Shores, E. W., Epstein, S., Leonardi, A., Grinberg, A., Tran, T., Scharton-Kersten, T., Anver, M., Love, P., Brown, K., and Siebenlist, U. (1998) Mice Deficient in Nuclear Factor (NF)-Kappa B/p52 Present with Defects in Humoral Responses, Germinal Center Reactions, and Splenic Microarchitecture. J Exp Med. 187, 147-159.

  15. Carragher, D., Johal, R., Button, A., White, A., Eliopoulos, A., Jenkinson, E., Anderson, G., and Caamano, J. (2004) A Stroma-Derived Defect in NF-kappaB2-/- Mice Causes Impaired Lymph Node Development and Lymphocyte Recruitment. J Immunol. 173, 2271-2279.

  16. Shinkura, R., Kitada, K., Matsuda, F., Tashiro, K., Ikuta, K., Suzuki, M., Kogishi, K., Serikawa, T., and Honjo, T. (1999) Alymphoplasia is Caused by a Point Mutation in the Mouse Gene Encoding Nf-Kappa b-Inducing Kinase. Nat Genet. 22, 74-77.

  17. Fagarasan, S., Shinkura, R., Kamata, T., Nogaki, F., Ikuta, K., Tashiro, K., and Honjo, T. (2000) Alymphoplasia (Aly)-Type Nuclear Factor kappaB-Inducing Kinase (NIK) Causes Defects in Secondary Lymphoid Tissue Chemokine Receptor Signaling and Homing of Peritoneal Cells to the Gut-Associated Lymphatic Tissue System. J Exp Med. 191, 1477-1486.