Phenotypic Mutation 'untersuchen' (pdf version)
Mutation Type missense
Coordinate65,297,257 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Pappa
Gene Name pregnancy-associated plasma protein A
Synonym(s) IGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
Chromosomal Location 65,124,174-65,357,509 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021362; MGI:97479

Mapped Yes 
Amino Acid Change Leucine changed to Methionine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000081545]
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: L1134M

signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000084501)
Meta Mutation Damage Score 0.0316 question?
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased
Body Weight (Female) - decreased
Body Weight (Z-score) - decreased
FACS CD8a+ DCs (gated in CD11c+ cells) - increased
Candidate Explorer Status CE: excellent candidate; human score: 0.5; ML prob: 0.64
Single pedigree
Linkage Analysis Data
Alleles Listed at MGI

All Mutations and Alleles(7) : Chemically induced (ENU)(3) Targeted (4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
caer UTSW 4 65124891 missense probably damaging 0.98
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2168:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4289:Pappa UTSW 4 65155863 missense probably benign 0.19
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5651:Pappa UTSW 4 65156352 missense probably damaging 0.99
R5725:Pappa UTSW 4 65189410 missense probably damaging 1.00
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6002:Pappa UTSW 4 65297408 missense probably damaging 0.99
R6252:Pappa UTSW 4 65189412 missense probably benign 0.02
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6322:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
R7158:Pappa UTSW 4 65204867 missense possibly damaging 0.94
R7165:Pappa UTSW 4 65261873 missense probably damaging 1.00
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Mode of Inheritance Unknown
Local Stock
Last Updated 2019-05-22 3:03 PM by Anne Murray
Record Created 2019-05-18 2:02 PM by Bruce Beutler
Record Posted 2019-05-22
Phenotypic Description

Figure 1. Untersuchen mice exhibit reduced body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The untersuchen phenotype was identified among G3 mice of the pedigree R2127, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R2127. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 94 mutations. The body weight phenotype was linked to mutations in several genes. However, the mutation in Pappa was presumed causative as the body weight phenotype in the untersuchen mice mimics that of mice expressing other mutant Pappa alleles (see MGI). The mutation in Pappa is a T to A transversion at base pair 65,297,257 (v38) on chromosome 4, or base pair 173,084 in the GenBank genomic region NC_000070. Linkage was found with a recessive model of inheritance, wherein one variant homozygote departed phenotypically from 11 homozygous reference mice and 12 heterozygous mice with a P value of 0.000366 (Figure 2).  


The mutation corresponds to residue 3,768 in the mRNA sequence NM_021362 within exon 13 of 22 total exons.


1129 -L--G--L--H--V--L--S--C--R--N--N-


The mutated nucleotide is indicated in red. The mutation results in a leucine to methionine substitution at position 1,134 (L1134M) in the PAPP-A protein, and is strongly predicted by Polyphen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 3. Domain organization of PAPP-A. The untersuchen mutation results in a leucine to methionine substitution at position 1134. This image is interactive. Other mutations found in PAPP-A are noted in red. Click on each allele for more information. Abbreviations: SP, signal peptide; LNR: Lin12/Notch repeats; CCP, complement control protein

Pappa encodes pregnancy-associated plasma protein A (PAPP-A; alternatively, IGFBP4 protease or differentially expressed in placenta 1 [DIPLA1]), a member of the pappalysin subfamily of the metzincin protease family along with PAPP-A2 (see the record for Lilliputian) and ulilysin. PAPP-A is initially translated as a 1,624 proprotein; cleavage of the signal peptide and the propeptide (amino acids 23-80) generates the mature 1,544 amino acid peptide (1). PAPP-A has several domains, including a signaling peptide (amino acids 1-22), a laminin G-like domain, three Lin12/Notch repeats (LNRs), a metalloprotease region (amino acids 272-583), and five complement control protein (CCP) domains (alternatively, short consensus repeat [SCR] or Sushi domains; amino acids 1210-1279, 1280-1341, 1342-1409, 1410-1470, and 1473-1553) (Figure 3) (2).


The untersuchen mutation results in a leucine to methionine substitution at position 1,134 (L1134M); Leu1134 is within an undefined region before the first CCP domain.


Please see the record caer for more information about Pappa.

Putative Mechanism

PAPP-A is a secreted metalloproteinase that cleaves insulin-like growth factor binding protein 2 (IGFBP2), IGFBP4, and IGFBP5. The IGFBPs regulate the IGF-I signaling pathways by binding IGF-I. IGFBP5 also has IGF-I-independent functions. IGFPB5 is able to bind its putative receptor to enter the cytoplasm and subsequently interact with, and regulate, other proteins. IGFBPs are carrier proteins that regulate the bioavailability of insulin-like growth factors (IGFs) by prolonging their-half-life and circulation turnover. IGFs are essential for the regulation of growth and development by influencing the proliferation, differentiation, and apoptosis of osteoblasts (3;4). IGFs bind to two types of receptors, IGF-IR and IGF-IIR, subsequently activating downstream tyrosine kinase pathways. In IGF-I-associated signaling, both the IRS-1/phosphoinositide 3-kinase/serine–threonine kinase pathway and the Ras/mitogen-activated protein kinase/extracellular signal-regulated kinase pathway are activated, which subsequently promote cell proliferation, tissue differentiation, and protection from apoptosis.


Pappa-deficient (Pappa-/-) mice showed reduced body sizes and weights (60 to 70% of wild-type mice) as well as delayed bone ossification (5). The phenotype of the untersuchen mice mimics that of the Pappa-/- mice, indicating loss of PAPP-A function. PAPP-A functions as a growth-promoting enzyme through its role in cleaving IGFBPs (and subsequent release of bioactive IGF). IGFBP4 cleavage is required to activate most, if not all, IGF2-mediated growth-promoting activity.

Primers PCR Primer
untersuchen(F):5'- AAGTCCCTGTAGCAACGTGG -3'
untersuchen(R):5'- GGTTGCTTACCTCTGCTCAG -3'

Sequencing Primer
untersuchen_seq(F):5'- CCATAGATGAGGGTGGCCATTTG -3'
untersuchen_seq(R):5'- AGGGCTGTAGGTCTCTCCTC -3'
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsZhao Zhang and Bruce Beutler