Phenotypic Mutation 'Lazuli'

• Allele: Lazuli
• Mutation Type: frame shift
• Chromosome: 16
• Coordinate: 19,775,716 bp (GRCm39)
• Base Change: GT ⇒ G (forward strand)
• Gene: Klhl6
• Gene Name: kelch-like 6
• Chromosomal Location: 19,765,242-19,801,766 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000053023 ^†] [ENSMUSP00000130755] † probably from a misspliced transcript
• AlphaFold: Q6V595
• SMART Domains: Protein: ENSMUSP00000053023; Gene: ENSMUSG00000043008; AA Change: 279

Domain	Start	End	E-Value	Type
BTB	70	167	1.43e-25	SMART
BACK	172	274	1.68e-35	SMART
Kelch	376	419	3.05e-1	SMART
Kelch	420	466	6.82e-11	SMART
Kelch	467	514	4.27e-3	SMART
Kelch	515	556	3.06e-4	SMART
Kelch	557	604	3.47e-3	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000130755; Gene: ENSMUSG00000043008

Domain	Start	End	E-Value	Type
Pfam:BTB	60	98	1.2e-9	PFAM

• Predicted Effect: noncoding transcript
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.072)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-05-24 5:44 PM by Anne Murray
• Record Created: 2019-05-18 3:48 PM by Bruce Beutler
• Record Posted: 2019-05-24
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_183390; MGI:2686922

Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(8) Targeted(5)

Phenotypic Description

Figure 1. Lazuli mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Lazuli mice exhibit reduced frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Lazuli mice exhibit reduced frequencies of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Lazuli mice exhibit reduced frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Lazuli mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Lazuli mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Lazuli phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0497, some of which showed reduced B to T cell ratios (Figure 1) as well as reduced frequencies of B cells (Figure 2), IgD+ B cells (Figure 3), and IgM+ B cells (Figure 4) with concomitant increased frequencies of T cells (Figure 5) and CD4+ T cells (Figure 6), all in the peripheral blood.

Nature of Mutation

Figure 7. Linkage mapping of the increased T cell frequency using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 68 mutations (X-axis) identified in the G1 male of pedigree R0497. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 68 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in several genes. The mutation in Klhl6 was presumed causative as the immune phenotypes mimic that in other mice expressing mutation Klhl6 alleles (see MGI). The Klhl6 mutation is an AC>C frame shift due to a 1-bp deletion at base pair 19,956,966 (v38) on chromosome 16, or base pair 26,083 in the GenBank genomic region NC_000082 encoding Klhl6. The strongest association was found with a dominant model of inheritance to the T cell phenotype, wherein one variant homozygote and four heterozygous mice departed phenotypically from three homozygous reference mice with a P value of 2.68 x 10^-5 (Figure 7).  

The mutation corresponds to c.888delA in the mRNA sequence NM_183390 within exon 3 of 7 total exons.

C57BL/6J: 870 GCAGACCCTCTTATTAGACAGTGCCCTGAAGTC 274 -A--D--P--L--I--R--Q--C--P--E--V- Lazuli: 870 GCAGACCCTCTTATTAGCAGTGCCCTGAAG……AGGTGTTCATGA 1007 274 -A--D--P--L--I--S--S--A--L--K-……-R--C--S--*-         correct                aberrant

The mutated nucleotide is indicated in red. The mutation is predicted to result in a frame shifted protein product beginning after amino acid 279 and termination after the inclusion of 40 aberrant amino acids.

Protein Prediction

Figure 8. Domain structure of the KLHL6 protein. KLHL6 is a member of the Kelch-like family. The location of the Lazuli mutation is indicated. Please see the text for more details about these domains. BTB, Broad-complex, Tramtrack and Bric à brac domain; BACK, BTB and C-terminal kelch domain. The image is interactive. Additional mutations found in KLHL6 are noted. Click each mutation to view more information. Domain information is from SMART and UniProt.

KLHL6 is a member of the Kelch-like family (see the record for teeny for information about KBTBD2, another Kelch-like family member). Similar to other Kelch-like family members, KLHL6 has a Bric-a-brac, Tramtrack, Broad-complex (BTB) domain at the N-terminus, a BACK domain, and a kelch repeat region at the C-terminus (KLHL6 has five or six kelch repeats) (Figure 8) (1). BTB domains facilitate protein-protein interactions, the BACK domain has no known function, and Kelch domains form a tertiary structure of β-propellers that have a role in extracellular functions, morphology, and binding to other proteins.

The Lazuli mutation is predicted to result in a frame shifted protein product beginning after amino acid 279 and termination after the inclusion of 40 aberrant amino acids. The affected region is within the BACK domain.

Please see the record cerulean for more information about Klhl6.

Putative Mechanism

KLHL6 has putative functions in B cell receptor-associated signal transduction and germinal center responses (2). Loss of KLHL6 expression results in impaired transitional B cell survival and differentiation (3). Klhl6-deficient (Klhl6^-/-) mice exhibited impaired B cell development past the immature stage, reduced numbers of B220+ and CD3- B cells in the spleen and peripheral blood, reduced numbers of follicular B cells in the lymph nodes, reduced spleen weight, spleen hypoplasia, impaired germinal center formation, and impaired memory IgG responses (2). Mice homozygous for an ENU-induced Klhl6 mutation (W267*) exhibited increased numbers of immature B cells, but reduced numbers of mature B cells (MGI).

Putative functions for KLHL6 in T cells has not been described. The role of KLHL6 in B cells is unknown, but it may contribute to cell proliferation and cell survival through interactions with proteins (e.g., HBXIP and Cul3) (3). The phenotype observed in the Lazuli mice indicate loss of KLHL6-associated function in B cells.

References

  1. Gupta-Rossi, N., Storck, S., Griebel, P. J., Reynaud, C. A., Weill, J. C., and Dahan, A. (2003) Specific Over-Expression of Deltex and a New Kelch-Like Protein in Human Germinal Center B Cells. Mol Immunol. 39, 791-799.

  2. Kroll, J., Shi, X., Caprioli, A., Liu, H. H., Waskow, C., Lin, K. M., Miyazaki, T., Rodewald, H. R., and Sato, T. N. (2005) The BTB-Kelch Protein KLHL6 is Involved in B-Lymphocyte Antigen Receptor Signaling and Germinal Center Formation. Mol Cell Biol. 25, 8531-8540.

  3. Bertocci, B., Lecoeuche, D., Sterlin, D., Kuhn, J., Gaillard, B., De Smet, A., Lembo, F., Bole-Feysot, C., Cagnard, N., Fadeev, T., Dahan, A., Weill, J. C., and Reynaud, C. A. (2017) Klhl6 Deficiency Impairs Transitional B Cell Survival and Differentiation. J Immunol. 199, 2408-2420.