Phenotypic Mutation 'Untied' (pdf version)
AlleleUntied
Mutation Type missense
Chromosome7
Coordinate122,582,439 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Prkcb
Gene Name protein kinase C, beta
Synonym(s) Pkcb, Prkcb2, Prkcb1, A130082F03Rik, PKC-Beta
Chromosomal Location 122,288,751-122,634,402 bp (+)
MGI Phenotype Mice homozygous and/or heterozygous for ENU-induced mutations exhibit abnormal B cell morphology and physiology, decreased IgM levels and reduced antibody response to a model T cell-independent antigen.
Accession Number
NCBI RefSeq: NM_008855; MGI: 97596
Mapped Yes 
Amino Acid Change Tyrosine changed to Histidine
Institutional SourceBeutler Lab
Ref Sequences
Y417H in Ensembl: ENSMUSP00000070019 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.996 (Sensitivity: 0.54; Specificity: 0.98)
(Using Ensembl: ENSMUSP00000070019)
Phenotypic Category immune system, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance 100% 
Alleles Listed at MGI

All alleles(3) : Targeted, other(2) Chemically induced(1)  

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
Tilcara APN 7 122595005 missense probably damaging 1.00
IGL02045:Prkcb APN 7 122590167 missense probably damaging 1.00
IGL02273:Prkcb APN 7 122627767 missense probably damaging 1.00
IGL02638:Prkcb APN 7 122600840 unclassified noncoding transcript
IGL02962:Prkcb APN 7 122425047 unclassified probably null
IGL03013:Prkcb APN 7 122627682 missense probably damaging 1.00
IGL03224:Prkcb APN 7 122516924 nonsense probably null
Almonde UTSW 7 122582449 missense probably damaging 1.00
Tigris UTSW 7 122424977 missense probably damaging 1.00
F5770:Prkcb UTSW 7 122528476 missense probably damaging 0.99
R0078:Prkcb UTSW 7 122590170 missense probably damaging 1.00
R0409:Prkcb UTSW 7 122424977 missense probably damaging 1.00
R0660:Prkcb UTSW 7 122424959 missense possibly damaging 0.56
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1480:Prkcb UTSW 7 122594642 missense probably damaging 1.00
R1518:Prkcb UTSW 7 122544631 critical splice acceptor site probably null
R1540:Prkcb UTSW 7 122627693 missense probably damaging 1.00
R1560:Prkcb UTSW 7 122458033 splice acceptor site noncoding transcript
R1823:Prkcb UTSW 7 122568124 splice acceptor site
R1860:Prkcb UTSW 7 122568201 missense probably damaging 1.00
R3110:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R3112:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R4583:Prkcb UTSW 7 122457224 missense probably benign 0.32
R4754:Prkcb UTSW 7 122600740 missense silent
R4847:Prkcb UTSW 7 122568149 missense probably benign 0.35
R5220:Prkcb UTSW 7 122289455 missense probably damaging 1.00
R5487:Prkcb UTSW 7 122600725 nonsense probably null
R5599:Prkcb UTSW 7 122582478 missense probably benign 0.17
R5946:Prkcb UTSW 7 122544703 missense probably benign
V7581:Prkcb UTSW 7 122528476 missense probably damaging 0.99
X0061:Prkcb UTSW 7 122457306 missense probably benign 0.03
Mode of Inheritance Autosomal Dominant
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission 034291-UNC
Last Updated 12/09/2016 11:59 AM by Katherine Timer
Record Created 05/08/2009 12:00 AM
Record Posted 09/03/2010
Phenotypic Description

Untied was identified in a forward genetic screen for mutations that impair the T cell-independent immunologic (Ig)M response to the model antigen 2,4,6-trinitrophenyl (TNP)-Ficoll (see the T-independent B Cell Response Screen). The index mouse, BB190, mounted a weak IgM response to NP-ficoll. To confirm the mutation, a group of 22 G3 siblings were immunized with TNP-ficoll, and on day seven, serum samples were collected. TNP-specific IgM was measured by ELISA. Of the 22 mice tested, five mice had high TNP-specific IgM responses, nine had intermediate responses, and seven had low TNP-specific IgM responses (circled in the figure below).  These data suggest that the Untied phenotype is semidominant with heterozygous animals displaying intermediate responses to TNP-Ficoll relative to wild type controls and homozygous mice.  

Nature of Mutation
The Untied mutation was mapped to Chromosome 7, and corresponds to a T to C transition at position 1469 of the Prkcb transcript, in exon 11 of 17 total exons.
 
1454 ACCATGGACCGCCTGTACTTTGTGATGGAGTAT
412  -T--M--D--R--L--Y--F--V--M--E--Y-
 
The mutated nucleotide is indicated in red lettering, and results in a tyrosine to histidine substitution at amino acid 417 of the PKCβ protein.
Protein Prediction
Figure 3. Domain structure of conventional PKCs (amino acid numbering is for PKCβII). Key features of the regulatory domain include the pseudosubstrate motif (PS), the DAG-binding C1 domain, and the calcium-binding C2 domain. The kinase domain consists of the ATP-binding C3 domain, the substrate-binding domain and the V5 region. Key phosphorylation sites necessary for PKC activity are indicated in orange ovals. The residue altered by the Untied mutation is shown in red. C, conserved region; V, variable region. Click on the image to view other mutations found in PRKCB. Click on each mututation for more specific information.
Figure 4. Crystal structures of PKCβ domains. A, C2 domains of PKCβ. Ca2+ molecules are shown in yellow. The three Ca2+ ions are coordinated by the highly conserved aspartic acid residues 187, 193, 246, 248, and 254 (peach). Asn189 (gray) is important for the preferential binding of PKCα and PKCβ to PS over other membrane lipids and Arg252 (green) contributes to electrostatic interactions with the membrane. Trp245 and Trp247 (dark blue) are involved in hydrophobic interactions with the membrane. PKCβ binds RACK1 through three sites present in its C2 domain (purple). UCSF Chimera structure based on PDB 1A25. B, Kinase domain of PKCβ. The N-terminal lobe (blue) consists of a five-stranded β-sheet and two α-helices. The C-terminal lobe (green) contains eight α-helices, and is connected to the N-terminal region by a linker (purple). ATP-binding site (yellow) is located in the cleft formed by these two lobes. An invariant Lys at amino acid 371 forms an ion pair with Glu390 from helix αC for substrate binding and catalysis. Met420 controls access to a preexisting cavity in the ATP binding pocket. The activation loop (orange) present in the C-terminal lobe contains the conserved Asp466, which interacts with the nucleophilic hydroxyl side chain of the substrate and Asn471, which serves to stabilize the orientation of Asp466. Asn471 and Asp484 form part of the Asp-Phe-Gly (DFG) motif at the base of the activation loop that is required for the binding of two divalent cations (Mg2+) involved in nucleotide recognition. The V5 domain (pink) contains a novel α-helix and contains the autophosphorylation site Thr641 and the hydrophobic motif (teal). The location of the Untied mutation is indicated in red. UCSF Chimera structure based on PDB 2IOE. Click on each 3D structure to view it rotate.
The Prkcb gene encodes two isoforms, PKCβI and PKCβII, which contain 671 and 673 amino acids, respectively, and are 98% identical to their human homologues. These proteins are members of the protein kinase C (PKC) family of serine-threonine kinases. At least 11 mammalian PKC proteins are known with a wide range of tissue distribution, subcellular localization, and function. The PKC family belongs to the AGC-type kinase (protein kinase A/protein kinase G/protein kinase C) superfamily. PKC kinases share certain structural features including a highly conserved catalytic domain consisting of motifs required for ATP-substrate binding and catalysis, and a regulatory domain that maintains the enzyme in an inactive conformation. The regulatory and catalytic domains are attached to each other by a hinge region (Figure 3). PKC kinases can be split into three groups: conventional, novel, and atypical. These classifications are based on the structural motifs in the regulatory domain that account for cofactor dependence and interactions during induction of catalytic activity. The PKCβ isoforms belong to the conventional group that are activated by calcium (Ca2+) and a phospholipid, such as diacylglycerol (DAG) or phosphatidylserine (PS), or by phorbol esters, which are non-hydrolysable, non-physiological analogues of DAG. Conventional PKCs (cPKCs) contain five variable (V) domains and four conserved (C) domains.  The first two conserved domains occur in the regulatory region, while the last two conserved domains comprise the ATP-binding site and substrate-binding domain of the catalytic region (Figure 3). In addition, the cPKCs contain an autoinhibitory pseudosubstrate sequence in the V1 domain (amino acids 19-35 for PKCβ) that can bind to the substrate-binding cavity in the kinase domain, but lacks a critical serine/threonine phosphoacceptor site and keeps the enzyme inactive. The V5 domain is also necessary for PKC function. The structure and functions of these domains are described in more detail below [reviewed by (1;2)].
 
Conventional PKCs interact weakly with membranes in the absence of Ca2+ or DAG. Agonists that promote phosphoinositide (PI) hydrolysis and inositol-1,4,5-trisphosphate (IP3) generation lead to the mobilization of intracellular Ca2+, which binds the C2 domain and increases the affinity of cPKCs for membranes. The initial interaction of PKC-C2 with membranes is low affinity. However, once anchored to membranes, cPKCs diffuse within the plane of the lipid bilayer and participate in a secondary C1A domain interaction with DAG, the membrane restricted product of PI hydrolysis. The coordinate C1/C2 domain binding to membrane components leads to a conformational change that releases the autoinhibitory pseudosubstrate domain from the substrate-binding pocket of the enzyme. In order for these allosteric interactions to occur, PKC must first be properly folded and in the correct conformation permissive for catalytic action. This is dependent upon the phosphorylation of Thr500 in the activation loop of the catalytic region. Subsequent autophosphorylation of Thr641 in the turn motif present in the C-terminal V5 domain maintains catalytic competence, and autophosphorylation on Ser660 in the V5 hydrophobic motif appears to release the kinase into the cytosol (2;3).
 
In PKCβ isoforms, the C1 domain occurs at residues 36-151 and can be subdivided into an A and B domain, each containing a characteristic DAG-binding motif, HX12CX2CXnCX2CX4HX2CX7C, where H is histidine, C is cysteine, X is any other amino acid, and n is 13 or 14 (2). Although the crystal structure of the PKCB C1 domain has not been determined, the structure of the closely related PKCα C1B domain complexed with a DAG-analogue has been solved (4). The upper third of the C1 domain forms a largely hydrophobic surface, while positively charged residues that interact with anionic phospholipids are exposed on the middle third of the C1 domain structure. The bottom third of the C1 domain contains the two Zn2+ coordinating sites, each formed by three cysteines and one histidine, that are required for proper domain folding. Initially, the C1 domain positively charged residues interact with electrostatically anionic membrane phospholipids. This interaction allows the C1 domain to penetrate the membrane bilayer and bind DAG, which is located more deeply within the membrane. DAG then binds to a narrow polar groove present in the otherwise highly conserved hydrophobic surface at the top of the domain formed by C1A residues Trp58/Phe60 and C1B residues Tyr123/Leu125. The C1 subdomains of PKCs do not always bind to DAG with the same affinity. For instance, the PKCα C1A domain has high affinity for DAG (likely true for PKCβ as well), while PKCα and PKCβ C1B DAG interactions are very weak (5). Other PKC enzymes bind DAG with high affinity through their C1B domains (6). The structural basis for these differences depends on the presence of a tryptophan or tyrosine in the lipid-binding surface of the C1B domain. C1B domains containing tryptophan at this position bind DAG with high affinity, while C1B domains containing tyrosine (Tyr123 in PKCβ) do not (5). The C1 domains of PKCα and PKCβ also show a strong preference for PS over other lipids (7;8). PS plays an important role to disrupt electrostatic interactions that form between C1 residues and residues found in the C2 domain, amino acids Asp55-Arg252 and Arg42-Glu282. These interactions maintain PKC enzymes in a closed conformation in the resting state, and disruption of this closed conformation allows the C1A domain to penetrate the membrane, bind to DAG, and trigger the conformational changes leading to enzyme activation (8)
 
The C2 domain is approximately 130 amino acids long and binds to anionic phospholipids present in membranes in a Ca2+-dependent manner. The structure of the PKCβ C2 domain is made up of eight anti-parallel β-strands connected by variable loops to form a Greek key β-sandwich fold (9) (Figure 4A). Three Ca2+ ions are coordinated by the highly conserved aspartic acid residues 187, 193, 246, 248, and 254 present in two opposing loops at one end of the domain, located at amino acids 186-195 and 245-256. Asn189 in this domain is important for the preferential binding of PKCα and PKCβ to PS over other membrane lipids, while Arg252 contributes to electrostatic interactions with the membrane. Trp245 and Trp247 are involved in hydrophobic interactions with the membrane, and the highly basic lysine-rich β3- and β4-sheets localize active enzyme to phosphatidylinositol 4,5-bisphosphate (PIP2)-enriched membranes (9-13). PKCβ also binds to the membrane-associated scaffolding protein receptor for activated protein kinase C 1 (RACK1) through three sites present in its C2 domain; MDPNGLSDPYVKLat amino acids 186-198, KGKTKTIK at residues 209-216, and SLNPEWNET at amino acids 218-226. These binding sites occur on β-strands in the domain, with the first binding site located on β-strand 3, adjacent and anti-parallel to a RACK-mimetic sequence known as the pseudo (ψ)-RACK site (SVEIWD at residues 241-246) on β6 with homology to RACK PKC binding sites. Molecular interactions between the RACK1-binding site and ψ-RACK stabilize the β-sandwich structure of the C2 domain (14). The binding of ψ-RACK to PKCβ RACK binding sites is of lower affinity than PKC binding to RACK proteins.
 
The catalytic domain of PKCβII at amino acids 339-673 has also been determined (15), and follows the classical bilobal fold present in kinases. The N-terminal lobe (residues 339-421) consists of a five-stranded β-sheet (β1-β5) and two α-helices (αB, αC). The C-terminal lobe (residues 426-620) contains eight α-helices, and is connected to the N-terminal region by a linker comprised of amino acids 422-425 (Figure 4B). Both the ATP- and substrate-binding sites are located in the cleft formed by these two lobes. This is also where the pseudosubstrate domain of the regulatory region binds. The ATP-binding site at amino acids 348-356 consists of a characteristic glycine-rich sequence. An invariant Lys at amino acid 371 forms an ion pair with Glu390 from helix αC, properly aligning helix αC for substrate binding and catalysis. A gatekeeper residue (Met420), usually conserved as a large hydrophobic amino acid, controls access to a preexisting cavity in the ATP binding pocket. The activation loop present in the C-terminal lobe emanates from the base of the catalytic site and contains the conserved Asp466, which interacts with the nucleophilic hydroxyl side chain of the substrate. This loop also contains Asn471, which serves to stabilize the orientiation of Asp466. Asn471 and Asp484 form part of the Asp-Phe-Gly (DFG) motif at the base of the activation loop that is required for the binding of two divalent cations (Mg2+) involved in nucleotide recognition (2;15). Both the activation loop and V5 domain contain highly conserved phosphorylation sites that are critical for structuring the catalytic pocket (2;15). The V5 domain wraps around the N-lobe and contains a novel α-helix near the proline-flanked turn motif at amino acids 637-643, which contains the autophosphorylation site Thr641 (15). The V5 domain also contains a conserved phosphorylation site flanked by hydrophobic residues (FXXFS/TF/Y at residues 656-661), known as the hydrophobic motif. The hydrophobic motif contains a conserved phenylalanine next to the phosphorylation site that appears to interact with a hydrophobic pocket on the back side of the kinase active site, and stabilizes the structure to allow high-affinity interactions with ATP and substrate (2). The phosphorylation site in the activation loop is regulated by 3-phosphoinositide-dependent protein kinase 1 (PDK1) subsequent to PDK1 docking at the hydrophobic motif (2;16), while dephosphorylation of Ser660 is regulated by the PH domain leucine-rich repeat protein phosphatases, PHLPP1 and 2, and leads to PKC degradation (17). The dephosphorylated PKCβII turn motif has been shown to bind to the heat shock protein HSP70, an interaction that protects PKCβII from degradation (18). PKC substrate-binding sites contain basic amino acids close to the Ser/Thr to be phosphorylated, and PKC substrate proteins may include mitogen activated protein (MAP) kinases, inhibitor of nuclear factor-κB (IκB), the vitamin D3 receptor VDR, Raf kinase, calpain, and the epidermal growth factor receptor (EGFR; see the record for Velvet).
 
Although PKC V5 domains contain the conserved turn and hydrophobic motifs, the sequences at the extreme C-terminus are highly variable and are likely to provide important determinants of specific PKC functions. The two PKCβ isoforms encoded by the Prkcb gene are translated from alternatively spliced products of the PKCβ pre-mRNA, and only differ from each other by a single C-terminal exon encoding the V5 variable region (19). Although RACK1 binding sites occur in the PKCβ C2 domain and are thus common to both isoforms, PKCβII appears to interact more specifically with RACK1 due to the presence of additional putative RACK1 binding motifs in its V5 domain; ACGRNAE at amino acids 621-627, QEVIRN at amino acids 645-650, and SFVNSEFLKPEVKS at amino acids 660-673. PKCβI also contains a RACK1 binding sequence in its V5 domain; KLFIMN at amino acids 645-650. Two non-conserved residues in the PKCβII domain (Asn625 and Lys668) are necessary for distinct subcellular translocation patterns associated with this isoform and are located in the RACK1 binding sites (20;21) (see Expression and Localization). The PKCβII V5 domain contains an actin binding site at amino acids 629-640, which also plays an important role in subcellular localization (22;23). PKCβI Tyr661 is phosphorylated by the tyrosine kinase Syk (spleen tyrosine kinase), which requires prior phosphorylation of the adjacent hydrophobic motif phosphorylation site. Once phosphorylated, this tyrosine residue binds to the Src-homology 2 (SH2)domain of the adaptor protein growth factor receptor-bound protein 2 (Grb2), leading to the activation of the Ras/extracellular regulated kinase (ERK) pathway (24). Potential NLS sequences are present in most PKC V5 domains, but this has only been tested in PKCδ, a novel PKC member (25)
 
The Untied mutation results in the substitution of a histidine for a tyrosine at amino acid 417 located in the kinase domain of the protein (Figure 3 and Figure 4B).
Expression/Localization
In their inactive conformations, most PKC proteins are localized in the cytosol and often associate with other proteins of the cytoskeleton (26). Upon activation, cPKCs have been shown to translocate to the plasma membrane via a mechanism that involves phospholipase C (PLC)-derived DAG accumulation (27;28). For instance, activation of B cells through B cell receptor (BCR) signaling leadsto translocation of PKCβ into specialized membranemicrodomains called lipid rafts (29). However, many PKC enzymes exhibit complex spatiotemporal expression patterns in cells. In cells that display a biphasic DAG response, PKCα and PKCβII, but not PKCβ1, are released from the plasma membrane and relocalize to a perinuclear site known as the pericentron, a subset of recycling endosomes containing the small GTPase Rab11 (30-32). In cardiomyocytes, endogenous PKCβ1 localizes to the cytosol and perinuclear region under basal conditions and translocates to the nucleus following treatment with phorbol 12-myristate 13-acetate (PMA), whereas PKCβII decorates fibrillar cytoskeletal structures at rest and translocates to the cell periphery and the perinuclear region, colocalizing with the PKC anchoring protein RACK1 (33;34). Interactions of PKC enzymes with RACK proteins are important for PKC subcellular localization as peptides containing the PKCβ1 and PKCβII–specific RACK1 binding sequences can act as isoform-specific translocation inhibitors during cell stimulation (20). In response to metabotropic glutamate receptor-1a (mGluR1a) activation, PKCβ1 and PKCβII oscillate differently between the cytosol and membrane. PKCα and PKCβI display three distinct patterns of activity: 1) agonist-independent oscillations, 2) agonist-stimulated oscillations, and 3) persistent plasma membrane localization in response to mGluR1a activation. In contrast, only agonist-stimulated PKCβII translocation responses are observed in mGluR1a-expressing cells (21;22). In a human erythroleukemia cell line, PKCβII selectively translocates to the nucleus during the G2/M stage of the cell cycle and directly phosphorylates the nuclear envelope protein lamin B at mitosis-specific sites involved in mitotic nuclear lamina disassembly (35;36). The 13 C-terminal amino acids of PKCβII are sufficient to confer PKCβII-like subcellular localization to PKCα in these cells (37). In addition, PKCβII accumulates in the cytoskeleton at actin-rich microfilaments in certain cell types due to the actin-binding site present in its V5 domain (22;23), and can localize to the centrosome by binding to the centrosomal protein pericentrin via its C1A domain (38). PKCβI has been shown to co-localize with microtubules and bind microtubule-associated proteins (39). Treatment of various cell types with insulin regulates PRKCB/Prkcb gene splicing to preferentially express the PKCβII isoform (40;41).
 
Generally, PKCβ isoforms are found in most tissues and cell types at some level. However, various studies suggest dynamic expression levels occur during embryonic development, and in some tissues in response to specific conditions. In rats, both isoforms are present in the greatest amount in the brain and spleen. PKCβ1 antisera stained peripheral cells within the islets of Langerhans of the pancreas most intensely, but was also found in the stratum granulosum of the cerebellum, and granulosa cells of the ovarian follicles, the spleen, heart, adrenal glands, and lung. Light staining was observed in the testes and no protein was seen in the liver or pituitary gland. A similar expression pattern was observed for PKCβII, except that PKCβII was more strongly expressed in Sertoli cells and cells of the spermatogenetic line in the testes (42). A detailed analysis of PKCβ isoforms in the rat brain found them to be widely expressed in neurons with PKCβ1 exhibiting various patterns of cytoplasm localization and PKCβII often found associated with the Golgi (43;44). PKCβ expression is increased in aging rat brains (45). The cerebellar expression pattern of PKCβ isoforms was observed in multiple species (46-48), and mRNA for both PKCβ  isoforms have been reported in the cat visual system (49). PKCβ has also been observed in the rat kidney (50). During development of kidney glomerular mesangial cells (MCs), PKCβI expression was observed in neonatal and adult MCs, but PKCβII was expressed specifically in neonatal MCs during proliferation (51)
 
In fetal mice at embryonic day (E) 17, PKCβ1 was found in all tissues examined, while PKCβII was absent in the lung and the liver (52). All PKC proteins are expressed during preimplantation development (53). PKCβ is highly expressed by chrondocytes in developing mouse skeletal structures (54), while PKCβII is dynamically expressed during murine palate development (55). PKCβ has also been reported to be upregulated during adipocyte differentiation (56).
 
PKCβ is upregulated in diffuse large B cell lymphoma (57), while PKCβII, specifically, is highly expressed in chronic lymphocytic leukemia (CLL) (58). A dramatic increase in PKCβII protein was also observed in colon tumors relative to normal colonic epithelium, while PKCβI was dramatically reduced in colon tumors (59). Although normally present in the upper cell layers of the human epidermis, particularly in dendritic Langerhans cells, PKCβ expression is absent from psoriatic skin lesions except in recruited immune cells (60).
Background
Many functions have been ascribed to PKC kinases due to their wide-spread expression and variety of substrates. PKCs are involved in receptor desensitization, modulating membrane structure events, regulating transcription, mediating immune responses, regulating cell growth, and in learning and memory. A high degree of redundancy or cross-talk amongst different PKC proteins can also occur, making the identification of isoform-specific roles difficult. The development of knockout mice for various PKC genes has enabled identification of the in vivo pathways and processes these proteins are involved in as opposed to their broad in vitro substrate specificity. A targeted knockout of the Prkcb gene in mice resulted in animals with reduced numbers of mature peripheral B cells, a loss of peritoneal B-1 B cells, reduced T cell-independent antibody responses, as well as reduced function of various other immune cell types. PKCβ-deficient mice also exhibit a variety of minor metabolic deficiencies (61-66). The roles of PKCβ isoforms in B cell signaling, immune cell function, diabetic complications, and cancer are detailed below.
 
Figure 5. BCR signaling. Following aggregation and localization of BCR molecules, the tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn) and by SYK . These phosphotyrosines then act as docking sites for the SH2 domains of SYK, resulting in SYK phosphorylation and activation. SYK phosphorylates a number of downstream targets including BLNK, PLC-γ2 and protein kinase C β (PKCβ). BCR stimulation activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of 3′-phosphorylated phosphoinositides. One of these lipids, phosphatidylinositol-3,4,5-triphosphate (PIP3), binds selectively to the pleckstrin homology (PH) domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-γ2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). Soluble IP3 and membrane-bound DAG initiate downstream signal transduction pathways involving calcium (Ca2+) mobilization and PKC, respectively. The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1 or CARD11), which are involved in NF-κB activation along with PKCβ. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.
Engagement of the BCR initiates receptor aggregation, resulting in activation of receptor-associated Src-family kinases, as well as Syk and Bruton’s tyrosine kinase (Btk)/Tec family kinases (Figure 5). These initial events facilitate the recruitment and activation of additional kinases and adaptor proteins within membrane raft microdomains leading to the formation of a mature BCR ‘signalosome’ and promoting the full activation of several downstream signaling cascades including the generation of the second messengers DAG and IP3. Soluble IP3 and membrane-bound DAG initiate downstream signal transduction pathways involving Ca2+ and PKC isoforms, respectively. These, together with additional signal transduction cascades, lead to the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB and activator protein 1 (AP-1), which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies [reviewed by (67)]. As described above, mice deficient in both PKCβ isoforms have severe B cell defects, and PKCβ-deficient mice also fail to proliferate in response to BCR stimulation (61), a phenotype similar to that seen in Btk-deficient mice. Btk and PKCβ are both essential for NF-κB activation (see the records for xander and panr2)   in response to BCR crosslinking (29;61;68-70) and PKCβ-/- cells fail either to degrade IκB or to activate the IKK complex in response to BCR stimulation. PKCβ is essential for recruitment and activation of the IKK complex and Btk into the BCR signalsome (29;68;71), and the inhibition of PKCβ activity blocks the localization of the IKK complex to BCR lipid rafts (29). Consistent with the defect in NF-κB activation, mice deficient in PKCβ exhibit a B cell survival defect in response to BCR stimulation, correlating with an inability to induce the NF-κB-dependent anti-apoptotic proteins Bcl-xL and A1 (29). Three other molecules are likely to play important roles in this pathway; Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1 or paracaspase), and caspase recruitment domain family, member 11 (CARMA1 or CARD11; see the record for king) due to the similarity of B cell defects found in mice deficient in these proteins (72-78). Mice deficient in other BCR signaling components, such as the adaptor protein BLNK/SLP65 (see the record for busy) and PLC-γ2 (see the record for queen), also display defects in B cell number and function (79;80). Although PKCβ clearly functions to upregulate NF-κB activity and to promote B-cell activation, PKCβ can also directly inhibit Btk through a negative feedback loop (71). PKCβ specifically phosphorylates Btk at Ser180 within its Tec-homology (TH) region, leading to an inhibition of Btk membrane translocation and activation, and the downstream events that promote PKCβ activation. PKCβ activity also appears to play a role in mediating B cell activating factor (BAFF)-induced signals leading to B cell survival by phosphorylating the Akt kinase (also known as protein kinase B or PKB) and contributing to its activation. However, PKCβ-deficient B cells remained partially responsive to the survival action of BAFF (81).
 
PKCβ appears to play a more minor role in the function of other immune cell types. Although PKCβ is expressed in T cells, T cell signaling is intact in PKCβ-deficient mice (82). However, activated T cell locomotion is impaired (63). During inflammation, T cells enter the peripheral inflamed tissues and crawl along microvascular endothelial cells in order to encounter inflammatory signals. T cell recruitment is mediated by the integrin receptor lymphocyte function-associated antigen 1 (LFA-1), which binds to the counter-receptor intercellular cell-adhesion molecule 1 (ICAM-1) expressed by endothelium at inflammatory sites. The activation of LFA-1 is associated with translocation of PKCβ1 to the microtubule cytoskeleton (83), while the expression of PKCβ1 in a PKCβ-deficient and nonmotile T cell line promoted cell polarization and enhanced motility (63)Prkcb-/- animals display defects in mast cell degranulation and release of interleukin (IL)-6, which are key features of IgE stimulation through the high affinity FceR1 receptor and requires PKC activity (62). In addition, PKCβ overexpressing mast cells exhibited an increased level of IL-6 and IL-2 mRNA (84). Activation of the mitogen activated protein (MAP) kinase cascade culminating in TNFα secretion (see the record for panr1) appears to be dependent on PKCβ in these cells (24;85). Platelets deficient in PKCβ are unable to spread on a fibrinogen-coated surface, although they do not show any change in agonist-induced fibrinogen binding. These results suggest that PKCβ is not required for agonist-induced activation of the fibrinogen receptor αIIbβ3, but is necessary for subsequent signaling to the actin cytoskeleton, which is required for cytoskeletal rearrangements necessary for full platelet aggregation. This activity requires the adaptor protein RACK1 (64). Finally, PKCβII activation appears to be required for dendritic cell (DC) differentiation, at least in vitro (86).
 
Members of the PKC family play important roles in signaling for various growth factors, cytokines, and hormones including those involved in the regulation of cell growth, apoptosis, and differentiation of hematopoietic cells. These include platelet-derived growth factor (PDGF), insulin-like growth factor 1 (IGF-1), erythropoietin (EPO), thrombopoietin (TPO), stem cell factor (SCF), tumor necrosis factor (TNF), granulocyte-macrophage colony-stimulating factor (GM-CSF), G-CSF, M-CSF, type I and II interferons (IFNs) and various interleukins (ILs). It is likely that multiple PKC enzymes play roles in the signaling from each of these factors, but the study of PKCβ activity specifically has only been implicated in TPO, IL-3, TNF, and GM-CSF [reviewed by (1)]. TPO is a glycoprotein hormone produced mainly by the liver and kidneys that functions as the major regulator of megakaryocytic precursor differentiation and proliferation in the bone marrow. TPO treatment of certain cell lines results in PKC enzyme activation including PKCα and PKCβ, and relocalization of both of these proteins to the membrane (87). Although PKCβ is not specifically implicated in SCF signaling, it is likely involved. SCF is a glycoprotein that serves as a ligand for the tyrosine kinase receptor c-kit (see the record for Pretty2 and Casper), and is an essential regulator of early hematopoiesis. PKC enzymes can directly phosphorylate c-kit on serine residues following SCF ligand binding, resulting in a decrease in receptor tyrosine autophosphorylation (88). Inhibition of PKC activity reversed this decrease in autophosphorylation. IL-3 is a cytokine with significant effects on cell proliferation and differentiation in various hematopoietic cell types, and PKCβ isoforms have been shown to be the predominant nuclear isoforms in certain IL-3 dependent hematopoietic cell lines (89;90). However, PKCβ is not required for IL-3/IL-4 induced mast cell proliferation (62).
 
Many receptor protein tyrosine kinases, such as EGFR, platelet-derived growth factor receptor (PDGFR) and the insulin receptor (IR), activate PLC and production of DAG, which in turn activates PKC enzymes (91). Downstream of the insulin receptor, PKCs may activate the Raf/MEK/ERK cascade. In response to insulin, activation of several PKC enzymes, including PKCβ, in skeletal muscle cells is dependent on the phosphorylation of the insulin receptor substrate 1 (IRS-1).  Blocking PKCβ specifically decreased the insulin-induced ERK activity and subsequent DNA synthesis, without affecting EGF-stimulated mitogenesis, and also inhibited insulin-induced Raf activation (92). PKCβ activation may also provide an inhibitory feedback mechanism to down regulate insulin receptor autophosphorylation and activity (93), but this inhibition does not occur in all cell types (94).  Glucose transport is increased in some tissues in PKCβ knockout mice, which may be partly due to the loss of PKCβ1 as PKCβ1 was specifically shown to negatively modulate insulin-stimulated translocation of the glucose transporter, GLUT4, to the plasma membrane (66). Interestingly, overexpression of PKCβII in NIH-3T3 cells enhanced the effects of insulin on glucose transport (40). These results, along with the insulin-stimulated regulation of PRKCB gene splicing, suggests that PKCB isoforms may have opposing effects on glucose transport in cells. However, other PKC enzymes have been shown to play important roles in mediating the metabolic effects of insulin, and it is not clear whether PKCβ isoforms play a significant role in this process (95).  
 
PKCβ is also implicated in the pathogenesis of diabetes. Hyperglycemia activates PKC enzymes involved in the regulation of vascular permeability and contractility, endothelial cell activation and vasoconstriction, extracellular matrix (ECM) synthesis and turnover, abnormal angiogenesis, excessive apoptosis, leukocyte adhesion, abnormal growth factor signaling and cytokine action, as well as abnormal cell growth [reviewed by (96)]. In diabetic rats, PKCβII was shown to be preferentially increased in membrane fractions in the aorta, heart, and renal glomeration (97), while high glucose induced PKCβ1 activity in mesangial cell cultures (98). PRKCB gene synthesis is specifically increased in human diabetic kidneys (99). Specific inhibition of PKCβ ameliorated diabetic symptoms in diabetic animal models (100-102).  When diabetes is induced in Prkcb-/- mice, complications due to hyperglycemia are reduced relative to wild type controls (103-105), and angiogenic response to oxygen-induced retinal ischemia was dramatically increased in transgenic mice overexpressing PKCβII (103).
 

PKCs have long been known to play important roles in the development of cancer. Phorbol esters are known to promote tumor formation and partially do so by activating PKC enzymes, thus promoting cellular survival and proliferation [reviewed by (106)]. PKCs were originally thought to be pro-mitogenic kinases, but this activity can be PKC-isozyme-dependent and cell-type dependent, as many PKCs can also inhibit cell cycle progression and promote apoptosis. Altered PKC levels are found in many types of human cancers. As mentioned above, PKCβII is overexpressed in CLL, a malignant disorder of mature B cells that is characterized by monoclonal expansion in blood, bone marrow, and lymphoid organs of cells arrested in the G0/G1 stage of the cell cycle. BCR signaling through PKCβII plays a role in the survival and expansion of these cells (58;107). PKCβII may also be an important mediator of vascular endothelial growth factor (VEGF)-induced angiogenesis and have a role in VEGF-induced endothelial cell proliferation, thus promoting the tumor vascular network.  PKCβII is progressively induced in chemically induced colon carcinogenesis in mice, along with a concomitant reduction in PKCa and PKCβ1 (59). Furthermore, PKCβII transgenic mice display hyperproliferation of the colonic epithelium and are highly sensitive to carcinogen-induced colon cancer (108). In these cancerous cells, PKCβII activates the Ras/MEK pathway (109). In another type of cancer, PKC βII has been shown to be critical for nuclear lamina disassembly at the G2/M transition through phosphorylation of lamin B in K562 erythroleukemia cells (36). The relocalization of activated PKCβII from the plasma membrane to the pericentron (see Expression and Localization) has been implicated in the oncogenic transformation of cells, pathogenesis associated with hyperglycemia, and in cardiac hypertrophy (2). Localization to the pericentron is a consequence of sustained DAG formation through a PLC-independent mechanism involving phospholipase D (PLD), a membrane-bound enzyme that generates phosphatidic acid (PA), which is subsequently converted to DAG by PA phosphohydrolase (110;111). PKCβII at the pericentron may control hormone responses by regulating the trafficking of continuously recycling membrane signaling proteins and cell surface receptors. The lipid, ceramide, is able to inhibit this localization by stimulating a ceramide-activated protein phosphatase that reverses PKCβII activation loop phosphorylation (112;113). PKCβ-selective inhibitors have been shown to kill or suppress the proliferation of multiple types of cancer cells (114;115).

Putative Mechanism
B cell responses are classified as T-dependent (T-D) or T-independent (T-I) based on their requirement for T cell help in antibody production. T cell-dependent antigens are processed and presented to helper T cells via the MHC class II molecules, whereas T cell-independent antigens are typically polysaccharides that cannot be processed and presented by MHC molecules. These antigens are often expressed on the surface of pathogens in an organized, highly repetitive form that can activate specific B cells by cross-linking of antigen receptors. The formation of antigen receptor clusters can recruit and activate multiple Btk molecules, resulting in long-term mobilization of intracellular ionized Ca2+, gene transcription and B cell activation and proliferation. Toll-like receptor (TLR) engagement provides a second signal that allows the secretion of antibody in response to these antigens. The T-D B cell response is mediated by conventional (follicular B-2) B cells, while T-I B cell responses are mediated by peritoneal B-1 and marginal zone (MZ) B cells [reviewed by (116;117)]. 
 
The reduction of B cell antibody responses to TNP-Ficoll in Untied mice suggests that the function of B-1 and/or MZ B cells is impaired in these animals with BCR signaling likely affected. These phenotypes are consistent with the phenotypes observed in Prkcb-/-animals, which also exhibit reduced T cell-independent antibody responses along with severe impairment of B-1 cells (61). B cell numbers have not been analyzed in Untied mice and it is unknown if the Untied allele is hypomorphic rather than functionally null. Mice heterozygous for the knockout allele have normal B cell numbers and B cell responses (29;61), which varies from the semidominant intermediate phenotype observed in Untied animals.  The semidominant phenotype observed in Untied mice may be due to the expression of nonfunctional, but appropriately localized, PKCβ proteins that are then able to inhibit the appropriate localization and function of wild type kinases.
 

The amino acid substitution in Untied mice occurs close to the gatekeeper residue located in the kinase domain of PKCβ. The substitution of a histidine for a tyrosine may affect the overall structure and catalytic activity of the kinase domain, or it may affect the role of the gatekeeper residue on restricting access to the ATP binding pocket of the enzyme.

Primers Primers cannot be located by automatic search.
Genotyping

Untied genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

Primers
Untied(F): 5’- TGTTCCAGCAAACCCTGAACTAGGT -3’
Untied(R): 5’- TCTCCCCAAGAGTCAGAGGGAAGA -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Untied_seq(F): 5'- AAAAGTGTTCTCATTCTACCTGTGC -3'
Untied_seq(R): 5’- TTAGCTGGCCTTCAGGAAC -3’
 
The following sequence of 953 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 7, bases 129,725,637 to 129,726,591) is amplified:
 
tgttccagca aaccctgaac taggtaataa tatcaattaa gtagtaagat ccatgtgtta
attatatttt ccagcacaaa tgaatttcaa tttgtagtta ttaattaaaa gtgttctcat
tctacctgtg ctagcctgca tgcttacagt ggctcagagg tcacccttag tgggtgctgg
gccctgcctg aaagaacact ccggagttct ggtagctctc atcataagtc ccagctactc
cctgctcccc gtttgggtcc tgagaaagta tggggtgctg actttggtgt ttgctctctt
tcctcaggac cgcctgtact ttgtgatgga gtatgtgaac gggggtgacc tcatgtacca
catccaacaa gttggccgtt tcaaggagcc ccatgctgtg taagacagac cctctttgtg
ccctttcctt gggataaatg attgtcattt cctttaagtt ttagcctact agggattttt
tttaccccaa catcccaggc ttcttctttg tgagcgttat ttggccaagg acaactgtat
tctgctcgct ttgagatgtt tctttatgtt cctgaaggcc agctaagaac tcatagctct
agaccaatga ctgtttcata atctctaatt tttttttgcc cctccatcct gagaaaggtc
ttataacttc cttggggaat gtctttgcag gttttttgtc tgttcatttg ctaatattta
ttgagagcgt tctttgtgcc agaccctcga gtactgaaca aacaccatct catttcatcc
tgagcggtac ggtgagggag agaatctcac ccaagcttta caatcaaggg caacgagacc
cggagggtgg gaaccgccaa gattctagac ctaggggagg gtctgtgtgg gtgagaccca
cctgtgtttg ttcatctgtt tcctacacct cttccctctg actcttgggg aga
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
References

117. Vos, Q., Lees, A., Wu, Z. Q., Snapper, C. M., and Mond, J. J. (2000) B-Cell Activation by T-Cell-Independent Type 2 Antigens as an Integral Part of the Humoral Immune Response to Pathogenic Microorganisms. Immunol. Rev. 176, 154-170.

Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsCarrie N. Arnold, Nathaniel Wang, Elaine Pirie, and Bruce Beutler
Edit History
07/01/2011 8:30 AM (current)
05/27/2011 4:19 PM
05/27/2011 4:10 PM
05/27/2011 4:08 PM
05/27/2011 12:30 PM
01/25/2011 9:53 AM
01/25/2011 9:45 AM
12/02/2010 8:56 AM
11/10/2010 10:51 AM
11/02/2010 1:18 PM
10/29/2010 2:54 PM
10/14/2010 3:05 PM
10/14/2010 2:34 PM
10/08/2010 2:29 PM
10/08/2010 2:26 PM
10/08/2010 8:06 AM
10/08/2010 8:05 AM
09/03/2010 10:39 AM