Phenotypic Mutation 'june_gloom'

• Allele: june_gloom
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 11,023,529 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Slc45a2
• Gene Name: solute carrier family 45, member 2
• Synonym(s): Aim1, Dbr, blanc-sale, dominant brown, Aim-1, Matp, bls, Oca4
• Chromosomal Location: 11,000,807-11,029,319 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009] ; PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P58355
• SMART Domains: Protein: ENSMUSP00000112408; Gene: ENSMUSG00000022243; AA Change: S378P

Domain	Start	End	E-Value	Type
Pfam:MFS_2	1	457	2e-22	PFAM
Pfam:MFS_1	2	292	2.6e-12	PFAM

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
  (Using ENSMUST00000117100)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.073)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• Last Updated: 2019-04-01 11:28 AM by Stephen Lyon
• Record Created: 2009-07-13 12:00 AM
• Record Posted: 2010-01-21
• Science Writers: Nora G. Smart
• Illustrators: Nora G. Smart, Diantha La Vine
• Authors: Xin Du

Accession Number

NCBI RefSeq: NM_053077; MGI: 2153040

Alleles Listed at MGI

All alleles(11) : Targeted, other(1) Spontaneous(5) Chemically induced(5)

Repository

none

Phenotypic Description

The june gloom mutation was induced by ENU mutagenesis on the C57BL/6J (black) background and was discovered in G3 animals. The mutant mice exhibit a gray coat color and black eyes.  June gloom mutants are viable and fertile. June gloom mice display normal type I interferon (IFN) responses to CpG DNA challenge in vivo.

Nature of Mutation

The june gloom mutation was mapped to before 63.9 Mb on Chromosome 15 by intercrossing G2 offspring from crosses of june gloom (C57BL/6J background) and C57BL/B10 mice, and Slc45a2 was identified as a candidate gene in the mapped region. Sequencing of Slc45a2 revealed a T to C transition at position 22723 of the genomic DNA sequence (Genbank genomic region NC_000081 for linear genomic DNA sequence of Slc45a2). The mutation occurs in exon 5 of 7 total exons. The mutated residue corresponds to nucleotide 1228 of the Slc45a2 transcript.

 

22708 GGCTTGTGCATCAACTCTGTGTTTTCTTCAGTT

373   -G--L--C--I--N--S--V--F--S--S--V-

 

Genomic sequence and numbering are shown.  The mutated nucleotide is indicated in red lettering, and results in a serine to proline substitution at amino acid 378 of the SLC45A2 (solute carrier family 45, member 2) or MATP (membrane associated transporter protein) protein.

Protein Prediction

Figure 3. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. The june gloom mutation (red asterisk) results in a serine to proline substitution at amino acid 378 of the SLC45A2 protein. This image is interactive. Click on the mutations for more specific information. 

The june gloom mutation occurs in the eighth transmembrane domain of the SLC45A2 protein (Figure 3). It is unknown whether normal levels of the altered protein exist in june gloom mice or whether this protein is localized appropriately.

 

Please see the record for cardigan for more information about Slc45a2.

Putative Mechanism

The june gloom mutation results in a S378P change in the eighth transmembrane domain of SLC45A2. Proper structure of the transmembrane regions are likely important for the function and appropriate localization of the protein to membranes. Because of this, phenotype-causing mutations of SLC45A2 in humans and various animal models are often found in the transmembrane domains, and these regions tend to be well-conserved amongst SLC45A2 homologues (1,2). Proline is often found in turns and loops, and has a rigid conformation that can disrupt secondary structure. Replacement of S378 with a proline probably disrupts the structure of the eighth transmembrane domain, although the milder hypopigmentation defect of june gloom animals suggests that the resulting protein is hypomorphic and may be appropriately localized to the membrane. The coat color of homozygous june gloom mice most closely resembles those of homozygous Uw^dbr mice. These animals are light beige with dark eyes (as adults) on a nonagouti (black) background. However, a heterozygous phenotype for june gloom animals has not been reported while heterozygous Uw^dbr mice appear dark brown. Underwhite dense (uw^d) homozygous animals are also dark brown (3). The amino acids affected in both of these mutants also occur in transmembrane domains, the fourth and tenth transmembrane domains, respectively (1,4).

Primers

Primers cannot be located by automatic search.

Genotyping

June gloom genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

Primers

June(F): 5’- GTGCCAGAGAATGGTACTGCATCATC -3’

June(R): 5’- GGCTCCACATCTTATCCGTCCAACA -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

June_seq(F): 5'- TCTTGCTACAGATGCAGACACTG -3'

June_seq(R): 5’- GAATTCCGCTGGTTACAAGC -3’

 

The following sequence of 1224 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 15, bases 10,952,291 to 10,953,514) is amplified:

 

                                      gtgcc agagaatggt actgcatcat

ctggggccag gtgttatctt gacagggggg ccattaacat cactccagag aagtgttatt

catgtttgat gcgtgaagtg agaattttgg tttctttcaa aagcacagaa atgttatggg

aatgtgtttt tgtcttaatc ccaggtgtgg gacatggagc tgcttcagac tgtctgcagc

agctgtctgt aatttgcctt gtgctccagc agggctgtgg tttttttttg ccagctacag

atagttcctg caaatttaga attccagggg ttcttgtatg ggtaaataaa tgctagagcc

ctgagagggg ctgtagtcgc tgctgctggt ggttgctggt tgctggttac tggttgtcat

tattgtgact tgtcaagtgg ccatgcacaa agagagaaga aaaagaaact gaatatccca

atagagaaga ttaaacttgc cctaaggaac tcaatgctcg taaagatatc aacacccctt

tcccctttag ccttcattct ttctctccta cctagtgtag gtgggttgga agggtggaat

aggggtggag aagggtggta gaaaaaggac ccgtaaagta gccaaaggtc ttgctacaga

tgcagacact gtacttgatg aaggcccttg atggaggtat gctagatgaa aggagagtgc

tagtgctgtc tgcttgaact ctggccgcta ggaagtgccc cctccccaca agggtagaca

agcatttgaa gagctgccca cctcactgca ctagttacaa aatcactgga aactctcttt

cagattgtat accatgggga tccctacggt gcacacaact ccacggagtt tctcatctat

gaaagaggag ttgaggtcgg atgttggggc ttgtgcatca actctgtgtt ttcttcagtt

tattcatgta agtgttcttc tcccaaggct gtcttcaaat ggctagcagc aggatccaga

ttttatatcc cacaatctat ttccttctct ttaaaagatt ggattttgat cattttaagg

gaacaaggaa aaacactttc aagaggatca caggaagtgt cttttttcag actcaatcct

aggagtcatt ccccttgaat tgtgcttgta accagcggaa ttctgggaaa cttgttagaa

aagaaaagga aattttgtga ataagatagt aaaatgttgg acggataaga tgtggagcc

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References

 1.  Newton, J. M., Cohen-Barak, O., Hagiwara, N., Gardner, J. M., Davisson, M. T., King, R. A., and Brilliant, M. H. (2001) Mutations in the human orthologue of the mouse underwhite gene (uw) underlie a new form of oculocutaneous albinism, OCA4, Am. J Hum. Genet 69, 981-988.

 2.  Fukamachi, S., Shimada, A., and Shima, A. (2001) Mutations in the gene encoding B, a novel transporter protein, reduce melanin content in medaka, Nat. Genet 28, 381-385.

 3.  Sweet, H. O., Brilliant, M. H., Cook, S. A., Johnson, K. R., and Davisson, M. T. (1998) A new allelic series for the underwhite gene on mouse chromosome 15, J Hered 89, 546-551.

 4.  Du, J. and Fisher, D. E. (2002) Identification of Aim-1 as the underwhite mouse mutant and its transcriptional regulation by MITF, J Biol. Chem. 277, 402-406.