Phenotypic Mutation 'belittle' (pdf version)
List |< first << previous [record 31 of 511] next >> last >|
Allelebelittle
Mutation Type nonsense
Chromosome1
Coordinate138,137,493 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Ptprc
Gene Name protein tyrosine phosphatase, receptor type, C
Synonym(s) B220, Ly-5, Lyt-4, CD45, T200
Chromosomal Location 138,062,861-138,175,708 bp (-)
MGI Phenotype Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death.
Accession Number

NCBI RefSeq: NM_001111316 (isoform 1), NM_011210 (isoform 2); MGI: 97810

Mapped Yes 
Amino Acid Change Lysine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
K422* in Ensembl: ENSMUSP00000027645 (fasta)
K283* in Ensembl: ENSMUSP00000107667 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:PTP_N 5 31 2.3e-10 PFAM
low complexity region 109 126 N/A INTRINSIC
low complexity region 168 203 N/A INTRINSIC
Pfam:CD45 209 268 2.3e-21 PFAM
FN3 372 456 8.9e-3 SMART
FN3 472 550 1.4e-3 SMART
transmembrane domain 565 586 N/A INTRINSIC
PTPc 639 901 2.4e-129 SMART
PTPc 930 1216 4.5e-105 SMART
Phenotypic Category decrease in CD4+ T cells, decrease in CD8+ T cells, hematopoietic system, immune system
Penetrance 100% 
Alleles Listed at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138083790 splice acceptor site
IGL00486:Ptprc APN 1 138115621 missense possibly damaging 0.92
IGL00771:Ptprc APN 1 138113677 missense probably benign 0.00
IGL00833:Ptprc APN 1 138078492 missense probably benign 0.32
IGL00919:Ptprc APN 1 138113642 missense probably damaging 1.00
IGL01020:Ptprc APN 1 138120173 splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138080912 missense probably damaging 0.99
IGL01302:Ptprc APN 1 138099631 missense possibly damaging 0.45
IGL01548:Ptprc APN 1 138099481 critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 138068410 missense probably benign 0.43
IGL01775:Ptprc APN 1 138064759 missense probably damaging 1.00
IGL01820:Ptprc APN 1 138066198 missense probably damaging 1.00
IGL02340:Ptprc APN 1 138071219 missense probably damaging 1.00
IGL02943:Ptprc APN 1 138099513 missense possibly damaging 0.76
IGL03169:Ptprc APN 1 138113619 missense probably benign 0.00
IGL03308:Ptprc APN 1 138126320 missense probably benign 0.00
IGL03404:Ptprc APN 1 138093001 missense probably damaging 0.97
guotie UTSW 1 138068401 nonsense probably null
guotie2 UTSW 1 138094299 missense
R0013:Ptprc UTSW 1 138113559 splice donor site probably benign
R0013:Ptprc UTSW 1 138113559 splice donor site probably benign
R0189:Ptprc UTSW 1 138082715 missense probably benign 0.08
R0390:Ptprc UTSW 1 138122575 missense possibly damaging 0.61
R0504:Ptprc UTSW 1 138088697 missense probably damaging 1.00
R0602:Ptprc UTSW 1 138089485 splice donor site probably benign
R0627:Ptprc UTSW 1 138068320 missense probably damaging 0.99
R0632:Ptprc UTSW 1 138073610 missense probably benign 0.01
R0751:Ptprc UTSW 1 138092930 missense probably damaging 1.00
R0839:Ptprc UTSW 1 138101132 missense probably benign 0.00
R0942:Ptprc UTSW 1 138068401 nonsense probably null
R0943:Ptprc UTSW 1 138111164 missense possibly damaging 0.92
R1159:Ptprc UTSW 1 138072319 missense probably damaging 1.00
R1442:Ptprc UTSW 1 138072312 missense probably damaging 1.00
R1489:Ptprc UTSW 1 138120086 missense probably benign 0.41
R1616:Ptprc UTSW 1 138083669 splice acceptor site probably benign
R1728:Ptprc UTSW 1 138080273 splice acceptor site probably benign
R1728:Ptprc UTSW 1 138099676 missense probably benign 0.00
R1728:Ptprc UTSW 1 138107823 missense probably benign 0.05
R1728:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1728:Ptprc UTSW 1 138107837 missense probably benign 0.04
R1728:Ptprc UTSW 1 138112254 missense probably benign 0.00
R1729:Ptprc UTSW 1 138080273 splice acceptor site probably benign
R1729:Ptprc UTSW 1 138099676 missense probably benign 0.00
R1729:Ptprc UTSW 1 138107823 missense probably benign 0.05
R1729:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1729:Ptprc UTSW 1 138107837 missense probably benign 0.04
R1729:Ptprc UTSW 1 138112254 missense probably benign 0.00
R1730:Ptprc UTSW 1 138080273 splice acceptor site probably benign
R1730:Ptprc UTSW 1 138099676 missense probably benign 0.00
R1730:Ptprc UTSW 1 138107823 missense probably benign 0.05
R1730:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1730:Ptprc UTSW 1 138107837 missense probably benign 0.04
R1730:Ptprc UTSW 1 138112254 missense probably benign 0.00
R1739:Ptprc UTSW 1 138080273 splice acceptor site probably benign
R1739:Ptprc UTSW 1 138099676 missense probably benign 0.00
R1739:Ptprc UTSW 1 138107823 missense probably benign 0.05
R1739:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1739:Ptprc UTSW 1 138107837 missense probably benign 0.04
R1739:Ptprc UTSW 1 138112254 missense probably benign 0.00
R1762:Ptprc UTSW 1 138080273 splice acceptor site probably benign
R1762:Ptprc UTSW 1 138099676 missense probably benign 0.00
R1762:Ptprc UTSW 1 138107823 missense probably benign 0.05
R1762:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1762:Ptprc UTSW 1 138107837 missense probably benign 0.04
R1762:Ptprc UTSW 1 138112254 missense probably benign 0.00
R1783:Ptprc UTSW 1 138080273 splice acceptor site probably benign
R1783:Ptprc UTSW 1 138099676 missense probably benign 0.00
R1783:Ptprc UTSW 1 138107823 missense probably benign 0.05
R1783:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1783:Ptprc UTSW 1 138107837 missense probably benign 0.04
R1783:Ptprc UTSW 1 138112254 missense probably benign 0.00
R1784:Ptprc UTSW 1 138080273 splice acceptor site probably benign
R1784:Ptprc UTSW 1 138099676 missense probably benign 0.00
R1784:Ptprc UTSW 1 138107823 missense probably benign 0.05
R1784:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1784:Ptprc UTSW 1 138107837 missense probably benign 0.04
R1784:Ptprc UTSW 1 138112254 missense probably benign 0.00
R1785:Ptprc UTSW 1 138080273 splice acceptor site probably benign
R1785:Ptprc UTSW 1 138099676 missense probably benign 0.00
R1785:Ptprc UTSW 1 138107823 missense probably benign 0.05
R1785:Ptprc UTSW 1 138107824 missense probably benign 0.04
R1785:Ptprc UTSW 1 138107837 missense probably benign 0.04
R1785:Ptprc UTSW 1 138112254 missense probably benign 0.00
R1862:Ptprc UTSW 1 138112227 missense probably benign 0.01
R2049:Ptprc UTSW 1 138092244 splice acceptor site probably benign
R2145:Ptprc UTSW 1 138073681 missense probably damaging 1.00
R2290:Ptprc UTSW 1 138111188 missense probably benign 0.00
R2403:Ptprc UTSW 1 138088532 missense probably damaging 1.00
R2420:Ptprc UTSW 1 138175055 missense noncoding transcript
R2422:Ptprc UTSW 1 138175055 missense noncoding transcript
R2439:Ptprc UTSW 1 138066152 missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138080178 missense probably damaging 1.00
R2906:Ptprc UTSW 1 138064534 missense possibly damaging 0.51
R3774:Ptprc UTSW 1 138064773 missense possibly damaging 0.89
R3775:Ptprc UTSW 1 138064773 missense possibly damaging 0.89
R3776:Ptprc UTSW 1 138064773 missense possibly damaging 0.89
R3834:Ptprc UTSW 1 138083567 missense probably damaging 1.00
R3974:Ptprc UTSW 1 138113529 missense noncoding transcript
R3975:Ptprc UTSW 1 138113529 missense noncoding transcript
R4019:Ptprc UTSW 1 138078516 missense probably damaging 1.00
R4377:Ptprc UTSW 1 138067925 missense probably benign 0.04
R4580:Ptprc UTSW 1 138071251 missense probably benign 0.09
R4688:Ptprc UTSW 1 138113822 missense noncoding transcript
R4923:Ptprc UTSW 1 138078498 missense possibly damaging 0.89
R4925:Ptprc UTSW 1 138099497 missense probably benign 0.01
R4937:Ptprc UTSW 1 138089500 missense probably damaging 1.00
R4970:Ptprc UTSW 1 138094299 missense probably damaging 1.00
R5112:Ptprc UTSW 1 138094299 missense probably damaging 1.00
R5145:Ptprc UTSW 1 138089566 missense probably benign 0.05
R5158:Ptprc UTSW 1 138175084 missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138117862 missense probably benign
R5259:Ptprc UTSW 1 138112255 nonsense probably null
R5338:Ptprc UTSW 1 138113542 missense noncoding transcript
R5584:Ptprc UTSW 1 138112122 missense noncoding transcript
R5593:Ptprc UTSW 1 138117720 missense noncoding transcript
R5689:Ptprc UTSW 1 138117777 missense probably benign 0.05
R5885:Ptprc UTSW 1 138088508 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 031764-UCD
Last Updated 04/17/2017 11:32 AM by Katherine Timer
Record Created 07/17/2009 12:00 AM
Record Posted 08/14/2009
Phenotypic Description

Belittle is an independent mutation, detected by an aberrant phenotype within the maladaptive pedigree, but distinct from the Rag1 mutation. The belittle phenotype is defined by a near complete absence of T cells, and the presence of normal percentages of CD45-deficient B cells (Figure 1). A mutation of Ptprc was suspected on this basis.

Nature of Mutation
The Ptprc gene was sequenced, and an A to T transversion identified at position 74078 of the genomic DNA sequence (Genbank genomic region NC_000067 for linear genomic DNA sequence of Ptprc).  Several isoforms of Ptprc are expressed due to alternative splicing. Originally, only exons 4-6 were found to be alternatively spliced (1), but some evidence suggests that exons 7, 8, and 10 may also be alternatively spliced (see Protein Prediction) (2;3). NCBI Genbank contains sequences for two isoforms, one containing all 33 exons (isoform 1, NM_001111316), and one lacking exons 4, 5, and 6 (isoform 2, NM_011210). The belittle mutation occurs in exon 13 of 33 total exons in isoform 1, and exon 10 of 30 total exons in isoform 2.  The mutated residue corresponds to nucleotide 1407 and nucleotide 990, respectively, in the cDNA sequences of Ptprc isoform 1 and isoform 2.
 
isoform 1:
1392  AATTCAGAAAAATGTAAAAGTTTGCCTAATAAT
417   -N--S--E--K--C--K--S--L--P--N--N-
 
isoform 2:
975   AATTCAGAAAAATGTAAAAGTTTGCCTAATAAT
278   -N--S--E--K--C--K--S--L--P--N--N-
 
The mutated nucleotide is indicated in red lettering, and converts lysine 422 (isoform 1) or 283 (isoform 2) of the CD45 protein to a stop.
Protein Prediction
Figure 2. Domain structure of the CD45RABC isoform. The extracellular N-terminal A, B, and C regions are encoded by exons 4, 5, and 6, respectively, and are heavily O-glycosylated. The remainder of the extracelluar domain contains 15 sites for N-glycosylation. The catalytic cysteine (828) is indicated within the PTP D1 domain. The belittle mutation (shown in red) converts a lysine to a stop codon. CRD=Cysteine-rich domain; TM=Transmembrane domain. This image is interactive. Click on the image to view other mutations found in CD45 (red). Click on the mutations for more specific information.   
Ptprc encodes CD45, a receptor-like protein tyrosine phosphatase (PTP) expressed by cells of the immune system. It is known by several names, including T200 (4), B220 for the B cell form (5), the mouse allotypic marker Ly-5 (6), and CD45. CD45 is a type I transmembrane glycoprotein containing a large N-terminal extracellular domain of ~400-500 residues (depending on the expression of several alternative exons, see below), a single transmembrane domain (22 amino acids), and a C-terminal cytoplasmic domain of 707 residues containing tandem PTP domains only one of which is enzymatically active (Figure 2) (7;8). Following the PTP domains is a 79 residue C-terminal tail. Among mouse, rat, and human CD45 amino acid sequences, the extracellular domains share 35% identity, while the cytoplasmic domains are 85% identical (9). The general structure of the extracellular domain is common to CD45 across species (10;11).
 
The extracellular domain of CD45 consists of five heavily glycosylated regions, and is observed to form an extended rod-like structure when visualized by electron microscopy after low-angle rotary shadowing (12). The three membrane proximal domains are members of the type III fibronectin (fnIII) domain family, and are conserved in all species examined (10;11). Following the three fnIII domains is a cysteine-rich region that appears to form a globular domain with high β-sheet content but no α-helices (13). The cysteine-rich region contains five cysteines conserved in all mammalian CD45 molecules, which form two intradomain disulfide bonds, and one disulfide bond with the adjacent fnIII domain (13).  Following these four structural domains is the most N-terminal domain, furthest from the cell membrane, containing all of the variation represented by the several protein isoforms. These isoforms are generated by alternative splicing of at least three exons (4, 5, and 6), which encode peptides (designated A, B, and C, respectively) ~50 amino acids in length. The protein isoforms are commonly named based on the exons included, with the largest isoform (RABC) including all three exons, RAB including exons 4 and 5, etc., and the smallest isoform lacking all three exons designated RO. In contrast to the cysteine-rich and fnIII domains that are N-glycosylated, the three alternative exons encode multiple sites of O-linked glycosylation and are variably modified by sialic acid (10;14;15). As a result, the various isoforms have molecular weights ranging from 180 kD (RO) to 240 kD (RABC), and differ in size, shape, and negative charge. The differential glycosylation of CD45 may influence its interactions with lectins, its organization into cell surface microdomains, and subsequent downstream signaling (16;17).
 
The cytoplasmic domain of CD45 contains a juxtamembrane region followed by tandem PTP domains of ~240 residues (D1 and D2) separated by a short spacer and a C-terminal tail. Mutation of the catalytic cysteine (residue 828) in D1 abolishes the phosphatase activity of the protein, demonstrating that only D1 is catalytically active (18). However, optimal phosphatase activity in cells requires both domains (19). Within the second PTP domain is a unique acidic region of 19 residues that contains multiple sites for serine phosphorylation by casein kinase II (20;21). This modification is important for optimal CD45 phosphatase activity toward a model substrate in vitro and for cellular signaling leading to Ca2+ flux in Jurkat T cells, although the mechanistic basis for these effects is unknown. The D2 domain may also modulate substrate access and localization, as suggested by the interaction of D2 with the CD45 substrate Lck (22).
 
The crystal structure of the CD45 cytoplasmic domain lacking the C-terminal tail has shown that domains D1 and D2 adopt similar structures, with core conformations resembling those of other PTP domains (23). The domains consist of a highly twisted nine-stranded β-sheet flanked by six α-helices, four on one side and two on the other (Figure 3; PDB ID 1YGU). When crystallized in the presence of monomeric phosphotyrosine or the phosphorylated membrane proximal immunoreceptor tyrosine-based activation motif (ITAM) of the CD3ζ chain, only the D1 active site of CD45 is filled while D2 remains empty. Substrate residues between pY-3 and pY+2 bind in the active site pocket of D1 and determine phosphatase specificity, with optimal binding for substrates containing a hydrophilic residue at the pY-1 position, and negatively charged residues located around the pY-2 position. Inspection of the structure of the D2 domain supports the finding that it is catalytically inactive, since compared to that of D1, its active site pocket is significantly altered in shape and unable to accommodate a phosphoryl group.  Loops surrounding the D2 active site also differ substantially in structure from those around the D1 active site. Two extra loops in D2, the acidic and basic loops, may help to recruit substrates to the active site of D1.
 
The cytoplasmic juxtamembrane region of CD45 forms a helix-turn-helix “wedge” structure, observed in receptor-like PTP α (RPTPα) and leukocyte common antigen-related (LAR) receptor proteins (24;25).  In its crystal structure, dimerization of RPTPα results in an inactive phosphatase due to reciprocal blockage of active sites by the wedge structure of opposing monomers (24). Such wedge-mediated dimeric interaction is not supported by the monomeric CD45 crystal structure, which suggests that steric constraints would prevent the structural deformation required for this intermolecular interaction (23). However, negative regulation of CD45 by dimerization is supported by several studies employing cells and/or mice, although involvement of the wedge was not definitively demonstrated (26-28). CD45 lacking the entire cytoplasmic domain, or containing a point mutation of the wedge, is capable of dimerizing, demonstrating that the extracellular and transmembrane domains are sufficient to mediate dimerization (29). Further studies are needed to determine the role of the wedge in CD45 regulation.
 
The belittle mutation is a premature stop introduced at residue 422 of the 1291-residue full length CD45 protein (containing all exons). The mutation resides in the middle fnIII domain.

 

Expression/Localization
CD45 expression is restricted to all nucleated hematopoietic cells (30). Expression of individual isoforms is controlled in a cell type-specific manner that is conserved through mammalian evolution (9;31). In general, B lymphocytes of humans, mice, rats, and sheep express only the highest molecular weight form containing all exons, T cells express a mix of isoforms, and thymocytes remove exons 4, 5, and 6, and express the lowest molecular weight form. It is estimated that up to 10% of lymphocyte surface is occupied by CD45. Myeloid lineage cells express the CD45RO isoform until activated, when they upregulate exon A-containing isoforms (32-34)
 
CD45 isoform expression has been best studied in T lineage cells, where it is regulated in a developmental and activation state-dependent manner. In mice, CD4+CD8+ double positive (DP) thymocytes express predominantly CD45RO, along with lesser amounts of CD45RB and CD45RBC (35). Positive selection is associated with a twofold increase in total CD45 expression (35;36). Human CD45 expression on developing thymocytes is similar to that in mouse, with CD4+CD8+ DP thymocytes expressing predominantly CD45RO and CD45RB (37). Thymic T cell maturation is associated with maintenance of CD45RB expression, slight downregulation of CD45RO, and increased expression of higher molecular weight CD45 isoforms containing the A exon product (35;37;38).
 
Mature quiescent T cells predominantly express CD45RO and CD45RB, although lower levels of exon A-containing isoforms are also expressed (39;40). CD8+ T cells appear to express the higher molecular weight forms more abundantly than do CD4+ T cells (35).  Upon T cell activation, protein expression of mixed larger (exon A-containing) isoforms transiently increases during the first day post-stimulation. Over the subsequent three days, CD45 isoforms containing exons A, B, and C are downregulated and replaced by CD45RO (41-43). The switch to expression of CD45RO is reportedly dependent on Ras and protein kinase C (44). CD45RO is an accepted marker for memory T cells (45;46).
Background
CD45 was identified in the 1970s as the major specificity of anti-lymphocyte sera and as an allotypic marker [reviewed in (9;47)]. It was also identified in protein gels of lymphocyte membranes. cDNA sequencing revealed that the cytoplasmic tandem repeats were similar in sequence to human placental PTP1B, and subsequently CD45 was shown to have phosphatase activity (7;8). Since then, much work has focused on the different forms of CD45, their source, and their functions both in isolated cells and in mice.
 
CD45 alternative splicing, tissue and cell-specific isoform expression, and the cis- and trans-acting factors regulating them have been extensively studied.  Counting exons 4, 5, 6, 7, 8, and 10 as candidates for alternative splicing, the number of possible isoforms is quite large. However, significant expression of only six isoforms has been detected at the protein level in T lineage cells where it has been best studied. The existence of RO, RB, RAB, RBC, and RABC is well established, whereas E3_8, which lacks exons 4-7, is consistently observed at the mRNA level (35;37) but has not been definitively demonstrated at the protein level (48). As mentioned above (Expression/Localization), CD45 protein isoform expression is regulated in a cell type and developmental stage-specific manner, and reflects the levels of alternatively spliced CD45 transcripts. The regulation of mRNA expression requires sequences within and flanking exons 4, 5, and 6, and is thought to be mediated by cell-specific factors (40;49-52)
 
Both positive and negative trans-acting regulatory factors have been implicated in the control of CD45 alternative splicing (40;49). The SR proteins, characterized by the presence of one or two RNA recognition motifs and an arginine- and serine-rich (RS) domain, are essential components of the spliceosome, functioning in constitutive and alternative splicing (53). The SR proteins also play an important role in splice site selection via binding to elements known as ESEs and ISEs (exonic and intronic splicing enhancers) and ESSs and ISSs (exonic and intronic splicing silencers) within the pre-mRNA. Using a heterologous system expressing a CD45 minigene, it has been demonstrated that overexpression of the SR proteins SRp20 and 9G8 can facilitate exon inclusion, whereas SWAP, SF2/ASF, SC35, SRp30C, SRp40, and SRp75 can promote exon exclusion (54-56). Studies of a human Ptprc polymorphism located in exon 4 (C77G) led to the discovery of a specific nucleotide sequence motif in exons 4, 5, and 6 that is necessary and sufficient to induce exon skipping (57;58). This sequence, termed exonic splicing silencer (ESS1) or activation-responsive sequence (ARS), has been shown to bind in vitro to heterogeneous nuclear ribonucleoprotein L-like (hnRNPLL) protein, hnRNPL, and PTB-associated splicing factor (PSF) (52;59-61). A point mutation of Hnrpll in mice (mutated in thunder) alters the proportions of naïve and memory T cells, and impairs Ptprc exon silencing needed to generate CD45RO in memory T cells (62).
 
The physiological function of CD45 has been examined most extensively in T cells. Studies with CD45-deficient cell lines identified CD45 as an obligate positive regulator of antigen receptor signaling, since T cells lacking CD45 failed to proliferate or produce cytokines in response to TCR stimulation (63;64). The generation of CD45-deficient mice through targeted deletion exons 6, 9, or 12 confirmed these data.  Ptprc-/- mice have profound defects in thymic development due to dysfunctional signaling through the preTCR and TCR, leading to a block in thymocyte development at β selection and at the DP stage (65-67). As a result, the absolute number of DP thymocytes is reduced twofold, and the number of single positive (SP) thymocytes is reduced five-fold. An ENU-induced mutation in Ptprc that results in insertion of 26 amino acids before a premature stop codon, designated lochy, results in normal numbers of B cells and bone marrow B220+CD19+ cells, reduced numbers of bone marrow B220loCD19+ cells, a block in thymocyte DP to SP transition, reduced numbers of CD4+ and CD8+ SP thymocytes, reduced numbers of naïve CD8+ T cells, and a shift toward an activated/memory CD8+ T cell phenotype in homozygous mutant mice.
 
Figure Figure 4. TCR signaling pathway. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs).  Binding of these ligands to the TCR initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex. Lck and Fyn are regulated by the phosphorylation of two key tyrosine residues, an activating tyrosine located in the activation loop, and an inhibitory tyrosine located in the C-terminal tail.  CD45 dephosphorylates the C-terminal inhibitory tyrosine, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2(Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1.  SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1).  This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca2+) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways.  Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and DAG resulting in Ca2+-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ and Ras, respectively.  PKCθ regulates nuclear factor-κB activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1). Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors.
Biochemical analyses of CD45-deficient cells demonstrated that signal transduction through the TCR is blocked at the level of tyrosine phosphoprotein induction (68), mediated in large part by the Src family kinases Lck (mutated in iconoclast) and Fyn (Figure 4). Activation of Lck and Fyn are two of the earliest events following TCR ligation. These kinases subsequently phosphorylate the immunoreceptor tyrosine-based activation motifs (ITAMs) present in the ζ, CD3ε, CD3δ and CD3γ chains of the TCR, leading to the downstream events that mediate T cell activation. Lck, and to a lesser extent Fyn, are primary substrates for CD45, as evidenced by their hyperphosphorylated state in CD45-deficient thymocytes and cell lines (69-71). The activity of Src family kinases including Lck and Fyn, is regulated by the phosphorylation of two key tyrosine residues, an activating tyrosine located in the activation loop, and an inhibitory tyrosine located in the C-terminal tail (see iconoclast for further explanation). The C-terminal Src kinase (Csk) negatively regulates kinase activity by phosphorylating the inhibitory tyrosine of Lck and Fyn. CD45 opposes the action of Csk by dephosphorylating this tyrosine, leading to the activation of Lck and Fyn (69-71). However, other work demonstrates that CD45-deficient macrophages are abnormally adherent due to increased Hck- and Lyn-dependent integrin signaling associated with hyperphosphorylation of both the activation loop and inhibitory C-terminal tyrosines (72). Thus, it is now thought that CD45 can regulate both the activating and inhibitory tyrosines of Src family kinases, and may do so depending on substrate accessibility and cellular state. Nonetheless, the phenotype of CD45-deficient mice supports a predominantly positive role for CD45 in TCR signaling, as does the ability of a constitutively active Lck Y505F mutant (inhibitory tyrosine mutation) to rescue thymic development when expressed transgenically in CD45-deficient mice (73;74).
 
Interestingly, the level of CD45 expression may determine cellular outcome, as suggested by the finding that CD45-deficient mice reconstituted with different expression levels of transgenic CD45RO required only 3% of wild type CD45 activity to restore normal T cell numbers and normal cytotoxic T cell responses (75). Expression of 30% of wild type CD45 levels, however, resulted in augmented production of CD4 and CD8 SP cells. Preferential hyperphosphorylation of the inhibitory tyrosine of Lck in was observed in CD45-deficient, or low expressing transgenic mice, but a near equal level of activation loop and C-terminal tyrosine phosphorylation was observed in mice with intermediate CD45 expression. These data suggest that much less phosphatase activity is required to dephosphorylate the C-terminal inhibitory tyrosine and “prime” the kinase, than to dephosphorylate the activation loop tyrosine and inhibit kinase activation. The high levels of CD45 expression on lymphocytes are hypothesized to be required to dephosphorylate the activation loop tyrosine and suppress aberrant positive selection and hyperactivity of T cells. The complicated mechanisms of Lck (and Fyn) regulation by CD45 are further highlighted by the different phenotypes of CD45- and double mutant Lck/Fyn-deficient mice. Lck/Fyn-deficient thymocytes are predominantly blocked at the DN stage, while CD45-deficient thymocytes are blocked at the DP stage.
 
CD45 deficiency has less severe consequences for B cells than for T cells. Peripheral B cell numbers are actually increased in CD45-deficient mice (65-67). Marginal zone B cells are increased, while B1 cell production is decreased, and B cell development is blocked at the transitional 2 (T2) to mature follicular B cell transition (28). CD45 does not appear to be a simple positive regulator of Src family kinases in B cells, consistent with the fact that mice lacking Blk, Lyn, and Fyn, the predominant B cell Src family kinases, exhibit a different phenotype (severe block in B cell development at the pro-B cell stage) than CD45-deficient mice. Studies of CD45-deficient mice expressing transgenes for CD45RO, CD45RB, or CD45RABC, again suggest that the levels of CD45 expression influence cellular outcome. Expression of any of the three transgenes at a level lower than wild type is able to rescue thymic development and peripheral T cell function, but fails to permit normal B cell maturation (76;77).  In contrast, transgenic expression of a CD45 minigene at wild type levels in CD45-deficient mice rescues both T and B cell functions (78).
 
As mentioned above, CD45 negatively regulates Src family kinases in macrophages to control integrin-mediated cell adhesion (72). Additional roles for CD45 in cells of the myeloid lineage have been reported. In mast cells, CD45 deficiency results in defective histamine degranulation after IgE receptor cross-linking, although the mechanism remains unclear (79). Dendritic cells (DC) lacking CD45 display altered responses to Toll-like receptor (TLR) stimulation, producing reduced amounts of interleukin (IL)-12p70, tumor necrosis factor (TNF)-α, and IL-6 in response to TLR4 stimulation, but increased amounts of TNF-α and IL-6 in response to TLR1/2, TLR3 or TLR9 stimulation (80;81). In contrast, interferon (IFN)-β production by CD45-deficient DC in response to TLR3 stimulation was reduced compared to that of wild type DC (80). IFN-α production by CD45-deficient DC was reportedly normal in response to TLR3 or TLR9 stimulation (81). It has been hypothesized that CD45 positively regulates MyD88-independent signaling, and negatively regulates MyD88-dependent signaling (80). Whether CD45 signaling impinges on Src family kinases, NF-κB, MAPKs, or other TLR signaling pathway components to modulate cytokine production is not established. A role for CD45 in cytokine production in natural killer (NK) cells is suggested by the severely impaired IFN-γ production of CD45-deficient NK cells in response to stimulation with anti-NKG2D, Ly49D, or NK1.1 antibodies, but not PMA/ionomycin (82;83). Surprisingly, CD45-deficient NK cells are fully competent in killing NK cell targets in vitro. A defect in ERK and JNK activation following NK cell stimulation may underlie the impaired cytokine production (82;83).
 
Ligand binding, localization, and dimerization have been hypothesized as mechanisms to control CD45 activity in cells. Although the expression of multiple CD45 isoforms suggested that ligand-regulated activation may be important, so far no specific ligand has been identified. There is evidence that CD45 function is regulated, via interactions with proteins such as spectrin and ankyrin (84), through localization in cell surface microdomains including TCR-containing lipid rafts and central supramolecular activation clusters (cSMAC) of the immunological synapse (85;86). Dimerization as a means to negatively regulate phosphatase activity is supported by many reports (26-28). The cytoplasmic wedge of CD45 has been proposed to mediate dimerization and inhibition by binding to the catalytic site of another CD45 molecule. To test the importance of the wedge, a point mutation was introduced into the tip of the wedge in human CD45 and found to eliminate the inhibitory effects of forced dimerization (26). Introduction of the analogous mutation (E613R) in mice of mixed C57BL/6-129 background resulted in a dominant phenotype characterized by lymphoproliferative disease with polyclonal T and B lymphocyte activation and autoimmune nephritis with autoantibody production, leading to premature death (27). Interestingly, these phenotypes were conferred by mutant B cells, since genetic elimination of B cells but not T cells in CD45 E613R mice abrogated the lymphoproliferation (28). Despite these findings, the involvement of the wedge in dimerization and inhibition is uncertain, since the extracellular domain alone can mediate dimerization, and steric hindrance between D1 and D2 domains may preclude wedge-mediated dimerization (25;29).
 
Humans deficient in CD45 develop severed combined immunodeficiency (SCID) with defects in T and B cell development and function (OMIM #608971) (87;88). Polymorphisms in CD45 may also influence immune functions in humans [(89) and references therein]. A rare, translationally silent polymorphism, C77G in exon 4 of CD45, has been associated with multiple sclerosis, autoimmune hepatitis, HIV, Langerhans cell histiocytosis, and systemic sclerosis in some ethnic backgrounds but not in others. The mutation lies in the ESS of exon 4 and prevents its exclusion from the mature transcript (58). It has also been found in four patients with systemic lupus erythematosus, one with myasthenia gravis, and in families with hemophagocytic lymphohistiocytosis. In one study, the C77G polymorphism occured twice as frequently among hepatitis C virus-infected patients than in healthy individuals (90). A second polymorphism, A138G in exon 6, results a threonine to alanine substitution of residue 47, a potential glycosylation site, and may cause exon skipping. The allele is found at a frequency of 20% in Asian populations, and carriers exhibit increased expression of CD45RO in both CD8+ and CD4+ T cells (91). It has been associated with a protective effect in hepatitis B virus infection and autoimmune Graves’ thyroiditis (92).
Putative Mechanism
The belittle mutation creates a premature stop codon within the first third of the Ptprc transcript that is likely to result in nonsense-mediated decay of the aberrant mRNA. Staining of belittle B cells with a pan-specific CD45 antibody (anti-CD45.2, clone 104, eBioscience), or an antibody specific to exon A-containing molecules (anti-B220, clone RA3-6B2, eBioscience), revealed no CD45 is expressed on CD19+ B cells. Homozygous belittle mice have a drastic reduction of T cells similar to that observed in CD45 null animals, supporting the idea that belittle mice do not express CD45.
Primers Primers cannot be located by automatic search.
Genotyping
Belittle genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 
Primers
belittle (F): 5’-TGTCTTCTCTACGCACAATTAAAGCCC -3’
belittle (R): 5’- AGTCACAGATTCCACCTTACTCCAGG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
belittle_seq(F): 5’- TACACACACCTGAAGATTTGGAG -3’
belittle_seq(R): 5’- GGACATCATTAAGTGTCTAGCTGC -3’
 
The following sequence of 1039 nucleotides (from Genbank genomic region NC_­­­­­000067 for linear genomic sequence of Ptprc, sense strand) is amplified:
 
73720                                           t gtcttctcta cgcacaatta
73741 aagccctctc cacatttctc atcttcctct tcatgtcacc tatatcctgc ccttctgccc
73801 tttccctctc tagatgcccc cttccctgtc cttttttttt ttttttttaa tggtcctggt
73861 ttctgcagtt actctaggtt gtatacacac acctgaagat ttggagctag gagcacagac
73921 tagagaaaac atgttgtttt tgcctttctg tataaattcc ctcaatattt ggagtctgct
73981 tgggatcata ttatgtaaac atcaagttat ctgcacaggg atcctgactt tcagaaactt
74041 actaactcag gctttctttt taattctaga aaaatgtaaa agtttgccta ataatgtgac
74101 cagttttgag gtggaaagct tgaaacctta taaatactat gaagtgtccc tacttgccta
74161 tgtcaatggg aagattcaaa gaaatgggac tgctgagaag tgcaattttc acacaaaagc
74221 agatcgtaag tttttggctt taatatttct tccatgaatg gcaaatgaca tttttatgtg
74281 aaatgcattg ctctttctac ttctgctggc acgtttgttt acttctgaag ttttaaataa
74341 tttaatagaa aattatttaa ccactgcaaa tcaaggttca ctgtatctat ctgatagagt
74401 gacagagttg aagtaacaaa gcaggaggcc tcaccagcca gtgtacttcc taaggcttca
74461 aacacttaat taagcatctc agcaacttag attaaaaatt ctcactttag tatctagaaa
74521 cacaaactgc agctagacac ttaatgatgt cctacagaac cctgatagaa catttcataa
74581 tataaagcat gttttggtac ttatttcatg ttatgttttt cgctggaaat tttaatggtc
74641 ttgcttctcg tgtggccttg ctgaaataag gctaagttat gtctccctgg taactgctta
74701 atctcaatta gggtcaggga agaagaaaga gtcctggagt aaggtggaat ctgtgact
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.
 
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsOwen M. Siggs, Bruce Beutler
List |< first << previous [record 31 of 511] next >> last >|
Edit History
03/02/2011 2:24 PM (current)
03/02/2011 2:23 PM
01/28/2011 6:52 PM
12/30/2010 11:58 AM
08/16/2010 3:35 PM
08/16/2010 3:35 PM
08/16/2010 1:31 PM
08/16/2010 1:29 PM
03/19/2010 11:31 AM
03/18/2010 12:27 PM
01/13/2010 12:00 AM