Phenotypic Mutation 'inept'

• Allele: inept
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 140,845,053 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Irf7
• Gene Name: interferon regulatory factor 7
• Chromosomal Location: 140,843,096-140,846,412 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRF7 encodes interferon regulatory factor 7, a member of the interferon regulatory transcription factor (IRF) family. IRF7 has been shown to play a role in the transcriptional activation of virus-inducible cellular genes, including interferon beta chain genes. Inducible expression of IRF7 is largely restricted to lymphoid tissue. Multiple IRF7 transcript variants have been identified, although the functional consequences of these have not yet been established. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous null mice are more vulnerable to viral infection and exhibit decreased serum interferon levels in response to viral infection. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P70434
• PDB Structure: Crystal structure of IRF-7 DBD apo form [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000026571; Gene: ENSMUSG00000025498; AA Change: D110G

Domain	Start	End	E-Value	Type
IRF	5	127	1.13e-54	SMART
IRF-3	240	420	1.38e-63	SMART
low complexity region	425	442	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000026571)
• SMART Domains: Protein: ENSMUSP00000095565; Gene: ENSMUSG00000025498; AA Change: D110G

Domain	Start	End	E-Value	Type
IRF	5	127	1.13e-54	SMART
IRF-3	209	389	1.38e-63	SMART
low complexity region	394	411	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
  (Using ENSMUST00000097952)
• SMART Domains: Protein: ENSMUSP00000101644; Gene: ENSMUSG00000025498; AA Change: D110G

Domain	Start	End	E-Value	Type
IRF	5	127	1.13e-54	SMART
IRF-3	208	388	1.38e-63	SMART
low complexity region	393	410	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000106023)
• SMART Domains: Protein: ENSMUSP00000121026; Gene: ENSMUSG00000025498; AA Change: D51G

Domain	Start	End	E-Value	Type
IRF	1	69	6.35e-3	SMART
IRF-3	77	251	2.62e-55	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000209899)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm, gDNA
• MMRRC Submission: 032796-UCD
• Last Updated: 2017-06-07 2:39 PM by Katherine Timer
• Record Created: 2009-08-31 12:00 AM
• Record Posted: 2010-04-02
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Amanda L. Blasius; Bruce Beutler

Accession Number

NCBI RefSeq: NM_016850; MGI: 1859212 

Alleles Listed at MGI

All alleles(5) : Targeted, knock-out(3) Gene trapped(1) Chemically induced(1)

Phenotypic Description

The inept mutation was discovered in a screen of ethylnitrosourea (ENU)-mutagenized G3 C57BL/6J mice looking for reduced type I interferon (IFN) responses to CpG DNA challenge in vivo (Figure 1) (1).  Oligodeoxynucleotides containing unmethylated CpG motifs are more abundant in prokaryotic genomes than in eukaryotic genomes (2), and stimulate the immune system.  CpG DNA is internalized by immune cells and is specifically recognized by Toll-like receptor 9 (TLR9; see the record for CpG1) present in the membranes of endosomes (3-5), leading to the production of multiple cyotokines and chemokines including type I IFNs (IFN-α/β).  Plasmacytoid dendritic cells (pDCs) are unique, in that they are the only cells capable of producing type I IFNs in response to TLR9 stimulation, making them the primary producers of type I IFNs in response to several viral infections.  The in vivo CpG screen is designed to identify mutations that would affect TLR signaling and type I IFN production in pDCs. pDCs also produce large amounts of type I IFN in response to single-stranded (ss) RNA, which is recognized by endosomal TLR7 (see the record for rsq1) (6-8). The defective type I IFN response to CpG DNA in inept mice is a recessive trait. In response to resiquimod, an ssRNA mimetic, both heterozygous and homozygous inept mice exhibit reduced levels of type I IFN in the serum.

 

Macrophages from homozygous inept mice produce normal amounts of tumor necrosis factor (TNF)-α in response to all TLR ligands, including CpG DNA and resiquimod (TLR Signaling Screen). These macrophages also display normal type I IFN responses to double-stranded DNA, which is recognized by cytosolic DNA sensors (Double-stranded DNA Macrophage Screen). They also secrete normal amounts of interleukin (IL)-1β in response to inflammasome stimulation (NALP3 Inflammasome Screen), and exhibit normal resistance to Rift Valley Fever virus (RVFV), adenovirus, influenza and mouse cytomegalovirus (MCMV; Ex Vivo Macrophage Screen for Control of Viral Infection). 

 

Using specific immune cell markers on flow cytometry, inept mice display normal numbers of pDC, DC, T cells, B cells, and natural killer (NK) cells in the spleen. 

Nature of Mutation

Whole genome sequencing of a homozygous inept mouse using the SOLiD technique identified an A to G transition at base pair 148451039 on Chromosome 7 using NCBI m37 mouse assembly (Build 37.1) located in the Irf7 gene. The mutation was confirmed using standard Sanger sequencing (Figure 2), and corresponds to nucleotide 749 of the Irf7 transcript in exon 4 of 10 total exons using Genbank record NM_016850. Multiple Irf7 transcripts are displayed on Ensembl.

 

693 TTTATCTTGCGCCAAGACAATTCAGGGGATCCA

105 -F--I--L--R--Q--D--N--S--G--D--P-

 

The mutated nucleotide is indicated in red lettering, and causes an aspartic acid to glycine substitution at residue 110 of the IRF7 protein.

Protein Prediction

In mouse and human, the Irf7 gene encodes one of nine members of the interferon regulatory factor (IRF) family of transcription factors, which regulate the transcription of type I interferons (IFN-α/β) and IFN-inducible genes during immune system development, homeostasis and activation by microbes [reviewed by (9;10)]. Multiple isoforms of IRF7 have been identified (11-13), with the standard isoforms in mouse and human displaying 62% sequence identity. An additional IRF, IRF10, has been identified in chickens (14), and several viral homologs have also been described (15).

 

Figure 2. Domain structure of IRF7. Shown are the DNA binding domain (DBD), transactivation domain (TD), autoinhibition domain (AID), and carboxyl-terminal regulation domain (C). There is a nuclear export signal at amino acids 401-415 shown with with diagonal lines. Phosphorylation in the C-terminal is shown with orange circles. The amino acid altered by the inept mutation is shown with a red asterisk.

Mouse IRF7 contains 457 amino acids and functions as a transcriptional activator (Figure 3) (12;16), although IRF7 was initially identified as a potential transcriptional repressor of the Qp promoter region of the Epstein-Barr virus (EBV)-encoded gene, EBNA-1 (11;17).  As in the other IRFs, the N-terminal half of IRF7 (residues 11-122) serves as the DNA binding region, and is characterized by the presence of five tryptophans (residues 15, 30, 42, 61, and 91) (11;16). The DNA binding region bears similarity to that of the c-Myb oncoprotein that also contains a tryptophan cluster (18), but not to any other transcription factor classes. IRF family proteins share sequence and structural homology in their DNA binding regions, and all bind to a similar DNA motif (A/G NGAAANNGAAACT) called the IFN-stimulated response element (ISRE) (19) or IFN regulatory element (20), found within positive regulatory domain I and III (PRD I and PRD III) of the IFN-β promoter.  IRF1 (see the record for Endeka), IRF3, and IRF7 have all been shown to participate in the formation of a large protein complex known as the IFN-β enhanceosome that also includes the nuclear factor-κB (NF-κB) subunits p50 and RelA (p65), ATF2/c-Jun heterodimer (also known as activator protein 1; AP1), the coactivators CREB-binding protein (CBP)/p300, and the high-mobility group protein HMG I(Y) or HMGA1 (21-24). IRF3 and IRF7, not IRF1, are now known to be the relevant IRFs necessary for IFN-β transcription (22;25;26), while the NF-κB subunits p50 and RelA do not play an essential role (27). Crystal structure of the IFN-β enhanceosome using the DNA-binding domains (DBDs) of IRF3, IRF7, AP1 and NF-κB found that two IRF7 proteins bind to ISRE sites B and D in PRD III and I, respectively, while IRF3 proteins bind to sites A and C in the same regions. NF-κB is bound to PRD II adjacent to the PRD I-bound IRF7, while the AP1 heterodimer binds to PRD IV next to the PRD III-bound IRF3 (24;28) (Figure 4)(PDB ID 2O61, 1T2K).

Crystal structure analyses of IRF DBDs suggest that they comprise a four-stranded antiparallel β-sheet (β1-β4), three helices (α1-α3), and three long loops (L1-L3) connecting β2 to α2, α2 to α3, and β3 to β4, respectively (24;28-31). IRF DBDs bind to DNA over a 12 base pair (bp) stretch with protein-DNA contacts in the major and minor grooves determining specificity. For instance, Ala 48 in L1 of IRF7 allows IRF7 to bind to the D site in the IFN-β promoter, while a leucine present at this position in IRF3 prevents IRF3 from binding to this site. In addition, a residue present in the major groove-binding α3 recognition helix, Arg 78 in IRF3 and Thr 93 in IRF7, specify a G or a T, respectively, just upstream of the core GAAA site in both IFN-β and IFN-α promoters (24;32;33). Unlike the other IRFs, IRF7 has a relatively unstructured extra nine amino acid insertion in L2, while α3 has a five amino acid N-terminal extension that extends away from the DNA. The L2 insertion allows IRF7 bound at the PRD I D site to avoid steric interference with the adjacent p50 subunit of NF-κB. Arg 96, Cys 97, and Ala 98 present in the recognition helix form contacts with GAAA, similar to the ones seen with homologous residues of IRF3. His 46 present in L1 contacts the minor groove of the DNA, an interaction that is also homologous to IRF3 DNA binding (24). Lys 92 is critical for DNA binding, but acetylation of this residue by the histone acetyltransferases p300/CBP-associated factor (PCAF) and GCN5 reduces DNA binding and IRF7 transcriptional activity (34). 

 

By cellular localization and activation studies of deletion constructs, various domains have been mapped in both mouse and human IRF7 (12;13;23;35;36) (Figure 3). The role of C-terminal phosphorylation on IRF7 function has also been examined (16;23;35-37). The C-terminal halves of all IRF family members contain either an IRF association domain 1 (IAD1) or an IAD2, with which they bind to other IRFs, other transcription factors, or self-associate. These interactions allow the IRFs to modulate their activity and target a variety of genes. The IAD1 is approximately 177 amino acids in length, and is conserved in all IRFs except IRF1 and IRF2. IAD2 domains are found only in IRF1 and IRF2 (38-40). By homology, the mouse IRF7 IAD1 domain occurs at amino acids 240-416 (40), a region that corresponds to an autoinhibitory domain (AID) mapped by deletion constructs (13). Similarly, a transactivation domain was mapped to amino acids 132-237. Mouse IRF7 also contains a C-terminal regulatory region at residues 423-457 that is phosphorylated upon viral infection and is necessary for dimerization, nuclear localization and transactivation (13;16). Phosphorylation of this region is suggested to mediate a conformational change that enhances homo or heterodimerization, relieving repression of transactivation induced by the AID. Similar domains have been identified in human IRF7 (12;35), although the internal transactivation domain may be subdivided into a constitutional activation domain (CAD) and a region that is important both for basal and virus-inducible activity known as the virus-activated domain (VAD) (35). The mapped regions of human and mouse IRF7 do not completely match. For instance, the mouse inhibitory domain spans portions of the domain identified as important for virus activation in human IRF7. Similarly, the phosphorylated residues identified as being important for mouse IRF7 activation by viruses do not match the key phosphorylated residues identified in human IRF7, despite sequence conservation in this area (16;35). Additional mapping identified a potential nuclear localization signal in the N-terminal half of human IRF7 (amino acids 1-246) as a C-terminally truncated construct was constitutively localized to the nucleus.  Furthermore, human IRF7 constructs lacking amino acids 416-467, which is located at the C-terminal end of the inhibitory domain, also localize to the nucleus, and a leucine-rich region containing a consensus nuclear export sequence was identified at amino acids 448-462 (35). This sequence is conserved in mouse IRF7 at amino acids 401-415. Nuclear localization of IRF7 also depends on the VAD region.

 

In addition to interacting with other IRFs and transcription factors through its C-terminal domains (23;24;36), IRF7 directly interacts with a number of molecules involved in signaling pathways that have been shown to activate IRF7. These proteins include the TLR adaptor molecule myeloid differentiation (MyD) 88 (see the records for pococurante and lackadaisical), the E3 ubiquitin ligase TNFR-associated factor 6 (TRAF6) (41), the EBV pseudoreceptor latent membrane protein 1 (LMP1) and receptor-interacting protein 1 (RIP1) (42;43), as well as a number of kinases that probably mediate IRF7 phosphorylation like TANK-binding kinase 1 (TBK1; also known as NF-κB-activating kinase or NAK), IκB kinase ε (IKK-ε or IKK-i) (44), interleukin receptor associated kinase 1 (IRAK1) (45), and IKK-α (also known as IKK-1). IKK-β or IKK-2 was also shown to associate with IR7 in coimmunoprecipitation experiments, although to a lesser extent (46). Human IRF7 is ubiquitinated at multiple sites by TRAF6, but three C-terminal lysines at positions 444, 446, 452 are necessary for IRF7 activation (47).  

 

In humans, four splicing isoforms of the IRF7 gene have been described (11;12). Isoform A, the standard isoform, is 503 amino acids long. Isoform B contains an internal deletion that removes a portion of the transactivation domain, including parts of the constitutional activation domain (CAD) and the virus-activated domain (VAD). Isoform C (also known as gamma) contains a premature stop codon following the DBD, and Isoform D (or H) has an alternative N-terminus that adds 13 amino acids to the protein. Mice contain three known IRF7 isoforms. IRF7α is the standard 457 amino acid isoform, while IRF7β and IRF7γ contain internal deletions that remove portions of the transactivation domain. IRF7β has a smaller deletion than IRF7γ and retains some transactivation function (13).   

 

The inept mutation results in an aspartic acid to glycine substitution at position 110 of IRF1.  This amino acid lies at the N-terminal end of loop L3 of the DBD, which connects strand β3 to β4 (Figure 3). 

Expression/Localization

In mouse and humans, IRF7 mRNA and protein can be constitutively detected in tissues of the immune system, including spleen, lymph node, thymus, and immune cells such as B cells, pDCs, monocytes and macrophages (11;12;48-51). Expression is upregulated in most cell types by viral infection and type I IFN stimulation (11;16;51;52). Basal IRF7 expression in pDCs is particularly high (49;50).

 

The full-length standard human IRF7 protein was the only detectable isoform found in normal peripheral blood leukocytes (11). In mouse, IRF7β mRNA is predominantly expressed in many cells including leukocytes (13).

 

In resting cells IRF7 is cytoplasmic, but is localized to the nucleus upon viral infection or other immune stimulus (12;52). Translational control of Irf7 mRNA is dependent on the translational repressors 4E-BP1 and 4E-BP2, which inhibit the assembly of the eukaryotic initiation factor 4F (eIF4F) complex necessary for translation (53).

Background

Type I IFNs are a critical class of cytokines that have antiviral, growth-inhibitory and immunomodulatory functions, and comprise 13 IFN-α subtypes, as well as IFN-β, w, ε, ω, κ and others in some animal species [reviewed in (54)].  Type I IFNs can be divided into two groups: immediate-early response genes that can be induced rapidly in response to immune stimuli without the need for ongoing protein synthesis; and a set of genes that display delayed induction. IFN-β and perhaps IFN-α4 are immediate-early response genes, while other IFN-α subtypes are induced more slowly in response to viral infection and require protein synthesis, a process that is completely dependent on IRF7 transcriptional activity and occurs through a two-step amplification in which IFN-β is initially produced in an IRF3-dependent manner from infected cells (55). Binding of IFN-β to the type I IFN receptor (see the records for macro-1 and macro-2) stimulates the Janus activating kinases (JAK)– signal transducer and activator of transcription (STAT) pathway (see the record for domino), resulting in activation of the transcription factor interferon stimulated gene factor 3 (ISGF3) complex composed of STAT1/STAT2 and IRF9.  The ISGF3 complex binds to upstream regulatory consensus sequences of hundreds of genes including IRF7, providing the type I IFN system with a positive feedback loop that allows amplification of the type I IFN response (16;52). Along with IRF7, IRF8 is also required for the second, amplifying phase of IFN transcription by binding to the promoters of IFN-α/β genes and regulating their transcription (56).    

 

IRF7-dependent amplification of the type I IFN response is essential during the immune response as IRF7-deficient mice and cells display a severe reduction of type I IFN in response to immune stimuli (25;51). In some cases, this lack of response is restricted to IFN-α production, with IRF7-deficient animals and cells displaying normal IFN-β production (51;57). Indeed, IRF3 is proposed to be relatively specific for the induction of Ifnb, while IRF7 induces the transcription of Ifna genes (26;32;33;55). In some situations, IRF7 may also be necessary for the early induction of type I IFNs despite low levels of expression in most cell types, as IRF7-deficient cells display severely reduced levels of IFN-β in addition to IFN-α in response to certain viral infections (25). Thus, although IRF7 is initially expressed at a low level, the formation of a heterodimer between IRF7 and IRF3, rather than an IRF3 homodimer, is presumed to be more crucial for the production of  IFN-β.  Positive-feedback regulation of IRF7 then comes into effect to achieve the full induction of type I IFN genes during the later phases of the response. Cells deficient in both IRF3 and IRF7 display a complete lack of type I IFNs in response to certain stimuli (10;25), underlying the importance of these two factors in the type I IFN response.  However, not all virally-induced type I IFN responses are dependent on IRF3 and/or IRF7. IFN-β production in response to MCMV is normal in both IRF3 and IRF7-deficient animals. Irf7^-/- mice are only modestly more susceptible to MCMV than C57BL/6 wild type animals despite a complete lack of IFN-α production, while Irf3^-/- animals display normal IFN-α responses and are resistant to disease (57).

 

Figure 5. Type I IFN Production. Interferon production occurs in response to microbes binding to pattern recognition receptors such as TLR2, 3, and 4 as well as RIG-I and MDA5. TLR4 associates with TRAM in order to produce IRF7 transcription factors in a process that is partially dependent on TICAM. TLR3 uses a TICAM-dependent pathway to produce IRF3 transcription factors. TLR7 and TLR9 use a MyD88-dependent pathway to produce IRF7. While TLR4 and 2 are generally associated with the cell surface, they can internalize to produce IFN. TLR4 is internalized into late endosomes to signal through the TICAM-dependent pathway, activating IRF3.TLR2 may also be internalized into endosomes to activate both IRF3 and IRF7 by an unknown mechanism. Cytoplasmic receptors RIG-I or MDA5 are recruited to the outer membrane of mitochondria by IPS1 before producing both IRF3 and IRF7 transcription factors. Upon IFN activation, IFNR activates STATs. The STAT1/STAT2 heterodimer forms the ISGF3 complex with IRF9 that translocates into the nucleus where it activates genes containing the IFN-stimulated response element (ISRE). This image in interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

The production of type I IFNs in response to viral infection occurs by recognition of virus-derived molecules by specific host sensors such as the membrane-localized TLRs as well as the cytosolic nucleic-acid sensors retinoic acid-inducible gene 1 (RIG-1) and melanoma differentiation-associated protein 5 (MDA5) [reviewed by (58)]. 13 different TLRs have been identified (10 in humans and 12 in mice), which are able to recognize a wide variety of molecules derived from bacteria, viruses, fungi and protozoa that trigger the induction of proinflammatory cytokines and type I IFN genes (10;58). The TLRs engage various adaptors including MyD88 (see pococurante and lackadaisical), TIRAP (toll-interleukin 1 receptor domain containing adaptor protein; also called MAL for MyD88 adaptor-like) (see torpid), TRIF (for Toll-interleukin 1 receptor (TIR) domain-containing adaptor inducing IFN-β; also known as TICAM-1, for TIR domain-containing adaptor molecule-1) (see Lps2), and TRAM (for TRIF related adaptor molecule; also called TICAM-2) (see Tram KO). With the exception of TLR3, which signals solely by activating TRIF, all TLRs recruit MyD88, which triggers signaling pathways leading to mitogen activated protein (MAP) kinase cascades, nuclear translocation of NF-κB, and IRF7 activation (8;58;59). Both the MyD88-dependent and a TRIF-TRAM mediated pathways are used by TLR4 (58;60). 

 

MyD88-dependent signaling requires the recruitment of IRAK1, IRAK4 (see otiose), and TRAF6 to the receptor, and all of these components are necessary for type I IFN induction in response to MyD88-dependent TLR signaling (45;61;62). Like IRF7, IRF5 binds to MyD88 and may affect IFN production downstream of TLR7 and TLR9 signaling, but appears to be more critical for MyD88-dependent proinflammatory cytokine production (62;63).  IKK-α is also necessary for IRF7 phosphorylation and activation in this pathway (46), suggesting that the IRAK4-IRAK1-IKK-α kinase cascade, known to be necessary for NF-κB activation, likely leads to IRF7 activation. TRAF3 and osteopontin are also involved in MyD88-dependent type I IFN induction, but their exact functions are unknown (64;65). The MyD88-dependent pathway is operational downstream of TLR7 and TLR9 signaling in pDCs, which produce the largest amounts of IFN-α/β in response to nucleic acids derived from microbes [reviewed by (66)]. In this cell type, MyD88-dependent type I IFN production is largely IRF3-independent (25;41;61). By contrast, MyD88-dependent IFN production in inflammatory monocytes upon recognition of vaccinia virus and viral ligands by TLR2 requires the presence of both IRF3 and IRF7 (67). The MAPK tumor progression locus 2 (Tpl2; also known as MAP3K8 or COT) has also been shown to be necessary for MyD88-dependent type I IFN responses in macrophages and conventional or myeloid DCs (cDCs), but is dispensable for this response in pDCs (68;69) (see the record for Sluggish). The high expression of TLR7, TLR9 and IRF7 may contribute to the ability of pDCs to produce large amounts of type I IFN in response to viral infection relative to other cell types. In addition, TLR9 ligands are retained for long periods of time in early endosomal vesicles of pDC, where the TLR9-MyD88-IRF7 complex is located, which may result in altered signaling compared to other compartments. In cDCs and macrophages, TLR9 ligands are rapidly transferred to lysosomal vesicles, away from IRF7 (70).  Interestingly, the localization of TLR receptors to internal vesicles may be a requirement for TLR-dependent type I IFN production as both TLR2 and TLR4, which are normally localized to the plasma membrane, must be endocytosed before they are able to induce type I IFNs (67;71).

 

In contrast to the MyD88-dependent pathway, the TRIF-dependent pathway mediates the phosphorylation of IRF3 and/or IRF7 by activating the TBK1 and IKK-ε kinases (44;72), with TBK1 being more critical than IKK-ε for IRF3 activation and IFN-β production (73). Although TLR4 can signal through MyD88, type I IFN production by this receptor appears to be largely TRAM-TRIF and IRF3-dependent (74), with TRAM-TRIF recruiting TRAF3, NAK-associated protein 1 (NAP1), and TBK1 (64;73;75;76). The induction of IFN-β in response to lipopolysaccharide (LPS), the principal bacterial TLR4 ligand, is abolished in Irf3^-/- DCs, whereas this induction is almost normal in Irf7^-/- cells (25;77;78). Under certain conditions, IRF7 may also participate in TLR4 dependent type I IFN production, as pretreatment with IFN-β or cytokines results in LPS induced IFN-β mRNA accumulation in Irf3^-/- cDCs, and can induce activation of the MyD88-IRF7-dependent pathway in response to TLR4 stimulation (77;79). In addition, the vesicular stomatitis virus (VSV) glycoprotein G (gpG) is able to stimulate TLR4 resulting in IRF7 activation in cDCs and macrophages (80). Similar to TLR4, TLR3-dependent IFN production is more dependent on IRF3 activation, but weak induction of type I IFNs in response to TLR3 ligands is still observed in Irf3^-/- cells while type I IFN production was completely abolished in Irf3^-/-, Irf7^-/- cells (10;60). TLR3 is localized to the endosome, and can detect viral infections by recognizing double-stranded (ds) RNA, including the synthetic dsRNA analog poly(I:C) (81).

 

Many viruses induce IFN production in most cell types, except pDCs, by being recognized by the RNA helicases RIG-I and MDA5, which recognize cytoplasmic viral RNA (82). RIG-I is able to detect negative-strand ssRNA viruses such as Newcastle disease virus (NDV), VSV, Sendai virus, and influenza virus by recognizing the uncapped 5′-triphosphate end of RNA (83;84), while MDA5 recognizes positive-strand ssRNA picornaviruses and encephalomyocarditis virus (EMCV) and can detect dsRNA and poly(I:C) (82;85). The adaptor molecule that links the sensing of viral RNA by RIG-I or MDA5 to downstream signaling is known as IFN-β promoter stimulator 1 (IPS-1), virus-induced signaling adaptor (VISA), mitochondrial antiviral signaling (MAVS) or CARD adaptor inducing IFN-β (Cardif) (86-89). Dimerization of IPS-1 in the mitochondrial membrane results in recruitment of TRAF3 (and TRAF5) (64;90;91). In turn TRAF3 interacts with TBK1 (64). Also associated with this complex are IKK-γ (also known as NEMO;see the record for panr2), TRAF-associated NF-kappa-B activator (TANK), and the TANK-like proteins NAP1 and similar to NAP1 TBK1 adaptor (SINTBAD) (75;76;92;93). IRF3, IRF5 and IRF7 are all implicated in RIG-I/MDA5 signaling (44;72;25). IRF7-deficient cells are unable to produce IFN-α/β in response to viruses that typically activate these pathways (25;94), while Irf5^-/- mice have reduced type I IFN serum levels when infected with RNA viruses that activate this pathway and are susceptible to VSV infection (95). Type I IFNs are also produced in response to cytoplasmic DNA, either by the DNA-dependent activator of IRFs (DAI) cytoplasmic sensor, unknown receptors, or by the transcription of viral DNA into RNA, which is then recognized by RIG-I (96-99). IFN-β induction in response to cytoplasmic DNA is absent in Irf3^-/- mouse embryonic fibroblasts (MEFs), but was normal in Irf7^-/- or Irf5^-/- MEFs (96). DNA-dependent IFN-α production requires both IRF3 and IRF7.     

 

Because the production of type I IFNs is critical for controlling viral infections, many viruses have evolved mechanisms to counteract their production. Some of these mechanisms include direct inhibition of IRF7 activity. For instance, the Vaccinia virus-encoded protein K7 antagonizes TLR3/4 signaling and production of IFNβ by inhibiting the phosphorylation of IRF3 and/or IRF7 by IKK-I and TBK1. This effect is mediated by the interaction of these proteins with the DEAD box protein 3 (Ddx3), which promotes TBK1/IKK-i-dependent Ifnβ promoter induction (100). As discussed above, the TLR3/4-dependent type I IFN pathways mostly rely on IRF3, but IRF7 is necessary for maximal induction of IFN-β through TLR3 (10). Hepatitis C virus (HCV) encodes nonstructural proteins 3 and 4A (NS3/4A) that are proteases that cleave IPS-1 and TRIF, again inhibiting IRF3 and/or IRF7 activation (101). Rotavirus nonstructural protein 1 (NSP1) mediates IRF3, IRF5 and IRF7 degradation (102). IRF7 ubiquitination and proteosome-degradation is also mediated by a ubiquitin E3 ligase known as replication and transcription activator (RTA), encoded by Kaposi’s sarcoma-associated human herpes virus (KSHV) and human herpes virus 8 (HHV8) (103). KSHV also encodes three viral IRFs (15) that show homology in their N-terminal regions to the DBDs of IRFs but lack several of the tryptophan residues essential for DNA binding. These proteins inhibit type I IFN production in response to viral infection by binding to and inhibiting the DNA binding activity of host IRFs, including IRF7 (104). Conversely, some cancer causing viruses may induce cellular transformation by increasing type I IFN production through IRF regulation. EBV LMP1 transforms B lymphocytes into cancerous cells and is demonstrated to induce the expression and activation of IRF7 in a process that is dependent on RIP1 and TRAF6 (42;43;47).

Putative Mechanism

The defective type I IFN production noted in inept animals in response to TLR7 and TLR9 stimulation is consistent with the phenotypes observed in Irf7^-/- mice. However, peritoneal macrophages isolated from inept mice are able to resist infection by multiple viruses, while IRF7-deficient cells are susceptible (25;51). In addition, type I IFN production in response to cytosolic DNA is normal in inept cells, although Irf7^-/- MEFs show impaired IFN-α production (97). These differences could be due to different cell types, viruses or by the use of a non-specific type I IFN antibody in the double-stranded DNA screen, which detects both IFN-α and IFN-β. Another possible explanation is that the inept mutation is a hypomorphic allele, and that inept mice retain normal type I IFN responses to certain stimuli.

 

As the inept mutation alters a highly conserved amino acid located in the DBD of IRF7, the aberrant protein produced by the inept allele is likely to be DNA-binding defective. Alternatively, the protein may not be able to appropriately dimerize or interact with other transcription factors. However, the DBD domains of IRF3 and IRF7 do not make any protein-protein contacts while binding to the IFN-β promoter (24), suggesting that the amino acid change found in inept mice may not directly affect protein-protein interactions. It is possible that the inept alteration generally affects protein structure and thus may also affect cooperative binding to promoter regions, coactivators, IRF3, or other factors necessary to induce transcription of type I IFN genes.

 

Multiple lines of evidence suggest that in pDCs both TLR7 and TLR9 engage the same MyD88-dependent pathway leading to proinflammatory cytokine and type I IFN production [reviewed by (58)], but the phenotypic differences between CpG and resiquimod type I IFN responses in inept mice suggest the possibility that the signaling components in these pathways may have some differences. It is also possible that TLR7 signaling is more sensitive to perturbations in IRF7 signaling. The presence of aberrant protein in heterozygous animals may interfere with the dimerization of wild type protein, the binding of IRF dimers to DNA, or the association of IRF7 with components of the TLR signaling pathway, reducing IRF7 function in vivo. This reduction in functional (wild type) IRF7 complexes may have an effect on the TLR7 response, but be enough for appropriate responses to CpG in heterozygous animals. N-terminally truncated IRF7 proteins exhibit dominant-negative effects on wild type protein in vitro (36). Similarly, IRF7C, which does not contain a C-terminus has been suggested to be a dominant-negative regulator of IRF activity and can inhibit IRF7-dependent IFN transcription (105). A similar effect could be occurring in heterozygous inept animals in vivo in response to TLR7 stimulation. 

Primers

Primers cannot be located by automatic search.

Genotyping

Inept genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

Primers

Inept(F): 5’- ACCCTGGAAGCATTTCGGTCGTAG -3’

Inept(R): 5’- TGCCCAAGCAGTTCCAAAAGTTCTC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               8

 

Primers for sequencing

Inept _seq(F): 5'- TGCACAGATCTTCAAGGTGG -3'

Inept _seq(R): 5’- CCAAGGCTCTGACTTAGCAG -3’

 

The following sequence of 613 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 7, bases 148,450,721 to 148,451,333) is amplified:

 

accctggaag catttcggtc gtagggatct ggatgaagaa gatgcacaga tcttcaaggt
ggtacccagt cctgccctct ttataatctg ccagaactcc tgggggaatc cagcctcaac
ccatgctctc tcctctcctt caggcctggg ctgtggcccg agggaggtgg ccacctagtg
gagttaacct gccaccccca gaggctgagg ctgctgagcg aagagagcga agaggctgga
agaccaactt ccgctgtgca ctccacagca cagggcgttt tatcttgcgc caagacaatt
caggggatcc agttgatccg cataaggtgt acgaacttag ccgggagctt ggatctactg
gtgagcagtg ccacaaacag ggatgggcca gggaggtaca tggcctctgt cattttggtg
gtttcaatg gtttgatttgt ggtttttgaa actagttgta gattcagttc ctctccttcc
aaagtgtgt gtgtgtcgggg tggaggggga gtgcacactt cctgctaagt cagagccttg
ggctgagtg aggtacctggt ggtttgggaa cagagggtat gagaaataga gaacttttgg
aactgcttg ggca       

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.

References

    1. Blasius, A. L., Arnold, C. N., Georgel, P., Rutschmann, S., Xia, Y., Lin, P., Ross, C., Li, X., Smart, N. G., and Beutler, B. (2010) Slc15a4, AP-3, and Hermansky-Pudlak Syndrome Proteins are Required for Toll-Like Receptor Signaling in Plasmacytoid Dendritic Cells. Proc. Natl. Acad. Sci. U. S. A.. epub Nov. 2.

    2. Cardon, L. R., Burge, C., Clayton, D. A., and Karlin, S. (1994) Pervasive CpG Suppression in Animal Mitochondrial Genomes. Proc. Natl. Acad. Sci. U. S. A. 91, 3799-3803.

    3. Latz, E., Schoenemeyer, A., Visintin, A., Fitzgerald, K. A., Monks, B. G., Knetter, C. F., Lien, E., Nilsen, N. J., Espevik, T., and Golenbock, D. T. (2004) TLR9 Signals After Translocating from the ER to CpG DNA in the Lysosome. Nat. Immunol. 5, 190-198.

    4. Leifer, C. A., Kennedy, M. N., Mazzoni, A., Lee, C., Kruhlak, M. J., and Segal, D. M. (2004) TLR9 is Localized in the Endoplasmic Reticulum Prior to Stimulation. J. Immunol. 173, 1179-1183.

    5. Ishii, K. J., Takeshita, F., Gursel, I., Gursel, M., Conover, J., Nussenzweig, A., and Klinman, D. M. (2002) Potential Role of Phosphatidylinositol 3 Kinase, rather than DNA-Dependent Protein Kinase, in CpG DNA-Induced Immune Activation. J. Exp. Med. 196, 269-274.

    6. Diebold, S. S., Kaisho, T., Hemmi, H., Akira, S., and Reis y Sousa, C. (2004) Innate Antiviral Responses by Means of TLR7-Mediated Recognition of Single-Stranded RNA. Science. 303, 1529-1531.

    7. Heil, F., Hemmi, H., Hochrein, H., Ampenberger, F., Kirschning, C., Akira, S., Lipford, G., Wagner, H., and Bauer, S. (2004) Species-Specific Recognition of Single-Stranded RNA Via Toll-Like Receptor 7 and 8. Science. 303, 1481-1482.

    8. Lund, J. M., Alexopoulou, L., Sato, A., Karow, M., Adams, N. C., Gale, N. W., Iwasaki, A., and Flavell, R. A. (2004) Recognition of Single-Stranded RNA Viruses by Toll-Like Receptor 7. Proc. Natl. Acad. Sci. U. S. A. 101, 5598-5603.

    9. Tamura, T., Yanai, H., Savitsky, D., and Taniguchi, T. (2008) The IRF Family Transcription Factors in Immunity and Oncogenesis. Annu. Rev. Immunol. 26, 535-584.

  10. Savitsky, D., Tamura, T., Yanai, H., and Taniguchi, T. (2010) Regulation of Immunity and Oncogenesis by the IRF Transcription Factor Family. Cancer Immunol. Immunother. 59, 489-510.

  11. Zhang, L., and Pagano, J. S. (1997) IRF-7, a New Interferon Regulatory Factor Associated with Epstein-Barr Virus Latency. Mol. Cell. Biol. 17, 5748-5757.

  12. Au, W. C., Moore, P. A., LaFleur, D. W., Tombal, B., and Pitha, P. M. (1998) Characterization of the Interferon Regulatory Factor-7 and its Potential Role in the Transcription Activation of Interferon A Genes. J. Biol. Chem. 273, 29210-29217.

  13. Marie, I., Smith, E., Prakash, A., and Levy, D. E. (2000) Phosphorylation-Induced Dimerization of Interferon Regulatory Factor 7 Unmasks DNA Binding and a Bipartite Transactivation Domain. Mol. Cell. Biol. 20, 8803-8814.

  14. Nehyba, J., Hrdlickova, R., Burnside, J., and Bose, H. R.,Jr. (2002) A Novel Interferon Regulatory Factor (IRF), IRF-10, has a Unique Role in Immune Defense and is Induced by the v-Rel Oncoprotein. Mol. Cell. Biol. 22, 3942-3957.

  15. Offermann, M. K. (2007) Kaposi Sarcoma Herpesvirus-Encoded Interferon Regulator Factors. Curr. Top. Microbiol. Immunol. 312, 185-209.

  16. Marie, I., Durbin, J. E., and Levy, D. E. (1998) Differential Viral Induction of Distinct Interferon-Alpha Genes by Positive Feedback through Interferon Regulatory Factor-7. EMBO J. 17, 6660-6669.

  17. Nonkwelo, C., Ruf, I. K., and Sample, J. (1997) Interferon-Independent and -Induced Regulation of Epstein-Barr Virus EBNA-1 Gene Transcription in Burkitt Lymphoma. J. Virol. 71, 6887-6897.

  18. Veals, S. A., Schindler, C., Leonard, D., Fu, X. Y., Aebersold, R., Darnell, J. E.,Jr., and Levy, D. E. (1992) Subunit of an Alpha-Interferon-Responsive Transcription Factor is Related to Interferon Regulatory Factor and Myb Families of DNA-Binding Proteins. Mol. Cell. Biol. 12, 3315-3324.

  19. Darnell, J. E.,Jr., Kerr, I. M., and Stark, G. R. (1994) Jak-STAT Pathways and Transcriptional Activation in Response to IFNs and Other Extracellular Signaling Proteins. Science. 264, 1415-1421.

  20. Tanaka, N., Kawakami, T., and Taniguchi, T. (1993) Recognition DNA Sequences of Interferon Regulatory Factor 1 (IRF-1) and IRF-2, Regulators of Cell Growth and the Interferon System. Mol. Cell. Biol. 13, 4531-4538.

  21. Thanos, D., and Maniatis, T. (1995) Virus Induction of Human IFN Beta Gene Expression Requires the Assembly of an Enhanceosome. Cell. 83, 1091-1100.

  22. Wathelet, M. G., Lin, C. H., Parekh, B. S., Ronco, L. V., Howley, P. M., and Maniatis, T. (1998) Virus Infection Induces the Assembly of Coordinately Activated Transcription Factors on the IFN-Beta Enhancer in Vivo. Mol. Cell. 1, 507-518.

  23. Yang, H., Lin, C. H., Ma, G., Baffi, M. O., and Wathelet, M. G. (2003) Interferon Regulatory Factor-7 Synergizes with Other Transcription Factors through Multiple Interactions with p300/CBP Coactivators. J. Biol. Chem. 278, 15495-15504.

  24. Panne, D., Maniatis, T., and Harrison, S. C. (2007) An Atomic Model of the Interferon-Beta Enhanceosome. Cell. 129, 1111-1123.

  25. Honda, K., Yanai, H., Negishi, H., Asagiri, M., Sato, M., Mizutani, T., Shimada, N., Ohba, Y., Takaoka, A., Yoshida, N., and Taniguchi, T. (2005) IRF-7 is the Master Regulator of Type-I Interferon-Dependent Immune Responses. Nature. 434, 772-777.

  26. Sato, M., Suemori, H., Hata, N., Asagiri, M., Ogasawara, K., Nakao, K., Nakaya, T., Katsuki, M., Noguchi, S., Tanaka, N., and Taniguchi, T. (2000) Distinct and Essential Roles of Transcription Factors IRF-3 and IRF-7 in Response to Viruses for IFN-alpha/beta Gene Induction. Immunity. 13, 539-548.

  27. Wang, X., Hussain, S., Wang, E. J., Wang, X., Li, M. O., Garcia-Sastre, A., and Beg, A. A. (2007) Lack of Essential Role of NF-Kappa B p50, RelA, and cRel Subunits in Virus-Induced Type 1 IFN Expression. J. Immunol. 178, 6770-6776.

  28. Escalante, C. R., Yie, J., Thanos, D., and Aggarwal, A. K. (1998) Structure of IRF-1 with Bound DNA Reveals Determinants of Interferon Regulation. Nature. 391, 103-106.

  29. Fujii, Y., Shimizu, T., Kusumoto, M., Kyogoku, Y., Taniguchi, T., and Hakoshima, T. (1999) Crystal Structure of an IRF-DNA Complex Reveals Novel DNA Recognition and Cooperative Binding to a Tandem Repeat of Core Sequences. EMBO J. 18, 5028-5041.

  30. Escalante, C. R., Shen, L., Escalante, M. C., Brass, A. L., Edwards, T. A., Singh, H., and Aggarwal, A. K. (2002) Crystallization and Characterization of PU.1/IRF-4/DNA Ternary Complex. J. Struct. Biol. 139, 55-59.

  31. Panne, D., Maniatis, T., and Harrison, S. C. (2004) Crystal Structure of ATF-2/c-Jun and IRF-3 Bound to the Interferon-Beta Enhancer. EMBO J. 23, 4384-4393.

  32. Lin, R., Genin, P., Mamane, Y., and Hiscott, J. (2000) Selective DNA Binding and Association with the CREB Binding Protein Coactivator Contribute to Differential Activation of alpha/beta Interferon Genes by Interferon Regulatory Factors 3 and 7. Mol. Cell. Biol. 20, 6342-6353.

  33. Morin, P., Braganca, J., Bandu, M. T., Lin, R., Hiscott, J., Doly, J., and Civas, A. (2002) Preferential Binding Sites for Interferon Regulatory Factors 3 and 7 Involved in Interferon-A Gene Transcription. J. Mol. Biol. 316, 1009-1022.

  34. Caillaud, A., Prakash, A., Smith, E., Masumi, A., Hovanessian, A. G., Levy, D. E., and Marie, I. (2002) Acetylation of Interferon Regulatory Factor-7 by p300/CREB-Binding Protein (CBP)-Associated Factor (PCAF) Impairs its DNA Binding. J. Biol. Chem. 277, 49417-49421.

  35. Lin, R., Mamane, Y., and Hiscott, J. (2000) Multiple Regulatory Domains Control IRF-7 Activity in Response to Virus Infection. J. Biol. Chem. 275, 34320-34327.

  36. Au, W. C., Yeow, W. S., and Pitha, P. M. (2001) Analysis of Functional Domains of Interferon Regulatory Factor 7 and its Association with IRF-3. Virology. 280, 273-282.

  37. Caillaud, A., Hovanessian, A. G., Levy, D. E., and Marie, I. J. (2005) Regulatory Serine Residues Mediate Phosphorylation-Dependent and Phosphorylation-Independent Activation of Interferon Regulatory Factor 7. J. Biol. Chem. 280, 17671-17677.

  38. Sharf, R., Azriel, A., Lejbkowicz, F., Winograd, S. S., Ehrlich, R., and Levi, B. Z. (1995) Functional Domain Analysis of Interferon Consensus Sequence Binding Protein (ICSBP) and its Association with Interferon Regulatory Factors. J. Biol. Chem. 270, 13063-13069.

  39. Sharf, R., Meraro, D., Azriel, A., Thornton, A. M., Ozato, K., Petricoin, E. F., Larner, A. C., Schaper, F., Hauser, H., and Levi, B. Z. (1997) Phosphorylation Events Modulate the Ability of Interferon Consensus Sequence Binding Protein to Interact with Interferon Regulatory Factors and to Bind DNA. J. Biol. Chem. 272, 9785-9792.

  40. Meraro, D., Hashmueli, S., Koren, B., Azriel, A., Oumard, A., Kirchhoff, S., Hauser, H., Nagulapalli, S., Atchison, M. L., and Levi, B. Z. (1999) Protein-Protein and DNA-Protein Interactions Affect the Activity of Lymphoid-Specific IFN Regulatory Factors. J. Immunol. 163, 6468-6478.

  41. Kawai, T., Sato, S., Ishii, K. J., Coban, C., Hemmi, H., Yamamoto, M., Terai, K., Matsuda, M., Inoue, J., Uematsu, S., Takeuchi, O., and Akira, S. (2004) Interferon-Alpha Induction through Toll-Like Receptors Involves a Direct Interaction of IRF7 with MyD88 and TRAF6. Nat. Immunol. 5, 1061-1068.

  42. Huye, L. E., Ning, S., Kelliher, M., and Pagano, J. S. (2007) Interferon Regulatory Factor 7 is Activated by a Viral Oncoprotein through RIP-Dependent Ubiquitination. Mol. Cell. Biol. 27, 2910-2918.

  43. Song, Y. J., Izumi, K. M., Shinners, N. P., Gewurz, B. E., and Kieff, E. (2008) IRF7 Activation by Epstein-Barr Virus Latent Membrane Protein 1 Requires Localization at Activation Sites and TRAF6, but Not TRAF2 Or TRAF3. Proc. Natl. Acad. Sci. U. S. A. 105, 18448-18453.

  44. Sharma, S., tenOever, B. R., Grandvaux, N., Zhou, G. P., Lin, R., and Hiscott, J. (2003) Triggering the Interferon Antiviral Response through an IKK-Related Pathway. Science. 300, 1148-1151.

  45. Uematsu, S., Sato, S., Yamamoto, M., Hirotani, T., Kato, H., Takeshita, F., Matsuda, M., Coban, C., Ishii, K. J., Kawai, T., Takeuchi, O., and Akira, S. (2005) Interleukin-1 Receptor-Associated Kinase-1 Plays an Essential Role for Toll-Like Receptor (TLR)7- and TLR9-Mediated Interferon-{Alpha} Induction. J. Exp. Med. 201, 915-923.

  46. Hoshino, K., Sugiyama, T., Matsumoto, M., Tanaka, T., Saito, M., Hemmi, H., Ohara, O., Akira, S., and Kaisho, T. (2006) IkappaB Kinase-Alpha is Critical for Interferon-Alpha Production Induced by Toll-Like Receptors 7 and 9. Nature. 440, 949-953.

  47. Ning, S., Campos, A. D., Darnay, B. G., Bentz, G. L., and Pagano, J. S. (2008) TRAF6 and the Three C-Terminal Lysine Sites on IRF7 are Required for its Ubiquitination-Mediated Activation by the Tumor Necrosis Factor Receptor Family Member Latent Membrane Protein 1. Mol. Cell. Biol. 28, 6536-6546.

  48. Hemmi, H., Kaisho, T., Takeda, K., and Akira, S. (2003) The Roles of Toll-Like Receptor 9, MyD88, and DNA-Dependent Protein Kinase Catalytic Subunit in the Effects of Two Distinct CpG DNAs on Dendritic Cell Subsets. J. Immunol. 170, 3059-3064.

  49. Izaguirre, A., Barnes, B. J., Amrute, S., Yeow, W. S., Megjugorac, N., Dai, J., Feng, D., Chung, E., Pitha, P. M., and Fitzgerald-Bocarsly, P. (2003) Comparative Analysis of IRF and IFN-Alpha Expression in Human Plasmacytoid and Monocyte-Derived Dendritic Cells. J. Leukoc. Biol. 74, 1125-1138.

  50. Kerkmann, M., Rothenfusser, S., Hornung, V., Towarowski, A., Wagner, M., Sarris, A., Giese, T., Endres, S., and Hartmann, G. (2003) Activation with CpG-A and CpG-B Oligonucleotides Reveals Two Distinct Regulatory Pathways of Type I IFN Synthesis in Human Plasmacytoid Dendritic Cells. J. Immunol. 170, 4465-4474.

  51. Daffis, S., Samuel, M. A., Suthar, M. S., Keller, B. C., Gale, M.,Jr, and Diamond, M. S. (2008) Interferon Regulatory Factor IRF-7 Induces the Antiviral Alpha Interferon Response and Protects Against Lethal West Nile Virus Infection. J. Virol. 82, 8465-8475.

  52. Sato, M., Hata, N., Asagiri, M., Nakaya, T., Taniguchi, T., and Tanaka, N. (1998) Positive Feedback Regulation of Type I IFN Genes by the IFN-Inducible Transcription Factor IRF-7. FEBS Lett. 441, 106-110.

  53. Colina, R., Costa-Mattioli, M., Dowling, R. J., Jaramillo, M., Tai, L. H., Breitbach, C. J., Martineau, Y., Larsson, O., Rong, L., Svitkin, Y. V., Makrigiannis, A. P., Bell, J. C., and Sonenberg, N. (2008) Translational Control of the Innate Immune Response through IRF-7. Nature. 452, 323-328.

  54. Pestka, S., Krause, C. D., and Walter, M. R. (2004) Interferons, Interferon-Like Cytokines, and their Receptors. Immunol. Rev. 202, 8-32.

  55. Yoneyama, M., Suhara, W., Fukuhara, Y., Fukuda, M., Nishida, E., and Fujita, T. (1998) Direct Triggering of the Type I Interferon System by Virus Infection: Activation of a Transcription Factor Complex Containing IRF-3 and CBP/p300. EMBO J. 17, 1087-1095.

  56. Tailor, P., Tamura, T., Kong, H. J., Kubota, T., Kubota, M., Borghi, P., Gabriele, L., and Ozato, K. (2007) The Feedback Phase of Type I Interferon Induction in Dendritic Cells Requires Interferon Regulatory Factor 8. Immunity. 27, 228-239.

  57. Steinberg, C., Eisenacher, K., Gross, O., Reindl, W., Schmitz, F., Ruland, J., and Krug, A. (2009) The IFN Regulatory Factor 7-Dependent Type I IFN Response is Not Essential for Early Resistance Against Murine Cytomegalovirus Infection. Eur. J. Immunol. 39, 1007-1018.

  58. Kawai, T., and Akira, S. (2006) Innate Immune Recognition of Viral Infection. Nat. Immunol. 7, 131-137.

  59. Banerjee, A., and Gerondakis, S. (2007) Coordinating TLR-Activated Signaling Pathways in Cells of the Immune System. Immunol. Cell Biol. 85, 420-424.

  60. Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., Takeuchi, O., Sugiyama, M., Okabe, M., Takeda, K., and Akira, S. (2003) Role of Adaptor TRIF in the MyD88-Independent Toll-Like Receptor Signaling Pathway. Science. 301, 640-643.

  61. Honda, K., Yanai, H., Mizutani, T., Negishi, H., Shimada, N., Suzuki, N., Ohba, Y., Takaoka, A., Yeh, W. C., and Taniguchi, T. (2004) Role of a Transductional-Transcriptional Processor Complex Involving MyD88 and IRF-7 in Toll-Like Receptor Signaling. Proc. Natl. Acad. Sci. U. S. A. 101, 15416-15421.

  62. Yasuda, K., Richez, C., Maciaszek, J. W., Agrawal, N., Akira, S., Marshak-Rothstein, A., and Rifkin, I. R. (2007) Murine Dendritic Cell Type I IFN Production Induced by Human IgG-RNA Immune Complexes is IFN Regulatory Factor (IRF)5 and IRF7 Dependent and is Required for IL-6 Production. J. Immunol. 178, 6876-6885.

  63. Takaoka, A., Yanai, H., Kondo, S., Duncan, G., Negishi, H., Mizutani, T., Kano, S., Honda, K., Ohba, Y., Mak, T. W., and Taniguchi, T. (2005) Integral Role of IRF-5 in the Gene Induction Programme Activated by Toll-Like Receptors. Nature. 434, 243-249.

  64. Oganesyan, G., Saha, S. K., Guo, B., He, J. Q., Shahangian, A., Zarnegar, B., Perry, A., and Cheng, G. (2006) Critical Role of TRAF3 in the Toll-Like Receptor-Dependent and -Independent Antiviral Response. Nature. 439, 208-211.

  65. Shinohara, M. L., Lu, L., Bu, J., Werneck, M. B., Kobayashi, K. S., Glimcher, L. H., and Cantor, H. (2006) Osteopontin Expression is Essential for Interferon-Alpha Production by Plasmacytoid Dendritic Cells. Nat. Immunol. 7, 498-506.

  66. Kaisho, T. (2008) Type I Interferon Production by Nucleic Acid-Stimulated Dendritic Cells. Front. Biosci. 13, 6034-6042.

  67. Barbalat, R., Lau, L., Locksley, R. M., and Barton, G. M. (2009) Toll-Like Receptor 2 on Inflammatory Monocytes Induces Type I Interferon in Response to Viral but Not Bacterial Ligands. Nat. Immunol. 10, 1200-1207.

  68. Xiao, N., Eidenschenk, C., Krebs, P., Brandl, K., Blasius, A. L., Xia, Y., Khovananth, K., Smart, N. G., and Beutler, B. (2009) The Tpl2 Mutation Sluggish Impairs Type I IFN Production and Increases Susceptibility to Group B Streptococcal Disease. J. Immunol. 183,7975-7983.

  69. Mielke, L. A., Elkins, K. L., Wei, L., Starr, R., Tsichlis, P. N., O'Shea, J. J., and Watford, W. T. (2009) Tumor Progression Locus 2 (Map3k8) is Critical for Host Defense Against Listeria Monocytogenes and IL-1 Beta Production. J. Immunol. 183, 7984-7993.

  70. Honda, K., Ohba, Y., Yanai, H., Negishi, H., Mizutani, T., Takaoka, A., Taya, C., and Taniguchi, T. (2005) Spatiotemporal Regulation of MyD88-IRF-7 Signalling for Robust Type-I Interferon Induction. Nature. 434, 1035-1040.

  71. Kagan, J. C., Su, T., Horng, T., Chow, A., Akira, S., and Medzhitov, R. (2008) TRAM Couples Endocytosis of Toll-Like Receptor 4 to the Induction of Interferon-Beta. Nat. Immunol. 9, 361-368.

  72. Fitzgerald, K. A., McWhirter, S. M., Faia, K. L., Rowe, D. C., Latz, E., Golenbock, D. T., Coyle, A. J., Liao, S. M., and Maniatis, T. (2003) IKKepsilon and TBK1 are Essential Components of the IRF3 Signaling Pathway. Nat. Immunol. 4, 491-496.

  73. Hemmi, H., Takeuchi, O., Sato, S., Yamamoto, M., Kaisho, T., Sanjo, H., Kawai, T., Hoshino, K., Takeda, K., and Akira, S. (2004) The Roles of Two IkappaB Kinase-Related Kinases in Lipopolysaccharide and Double Stranded RNA Signaling and Viral Infection. J. Exp. Med. 199, 1641-1650.

  74. Honda, K., and Taniguchi, T. (2006) IRFs: Master Regulators of Signalling by Toll-Like Receptors and Cytosolic Pattern-Recognition Receptors. Nat. Rev. Immunol. 6, 644-658.

  75. Perry, A. K., Chow, E. K., Goodnough, J. B., Yeh, W. C., and Cheng, G. (2004) Differential Requirement for TANK-Binding Kinase-1 in Type I Interferon Responses to Toll-Like Receptor Activation and Viral Infection. J. Exp. Med. 199, 1651-1658.

  76. Sasai, M., Shingai, M., Funami, K., Yoneyama, M., Fujita, T., Matsumoto, M., and Seya, T. (2006) NAK-Associated Protein 1 Participates in both the TLR3 and the Cytoplasmic Pathways in Type I IFN Induction. J. Immunol. 177, 8676-8683.

  77. Sakaguchi, S., Negishi, H., Asagiri, M., Nakajima, C., Mizutani, T., Takaoka, A., Honda, K., and Taniguchi, T. (2003) Essential Role of IRF-3 in Lipopolysaccharide-Induced Interferon-Beta Gene Expression and Endotoxin Shock. Biochem. Biophys. Res. Commun. 306, 860-866.

  78. Werner, S. L., Barken, D., and Hoffmann, A. (2005) Stimulus Specificity of Gene Expression Programs Determined by Temporal Control of IKK Activity. Science. 309, 1857-1861.

  79. Richez, C., Yasuda, K., Watkins, A. A., Akira, S., Lafyatis, R., van Seventer, J. M., and Rifkin, I. R. (2009) TLR4 Ligands Induce IFN-Alpha Production by Mouse Conventional Dendritic Cells and Human Monocytes After IFN-Beta Priming. J. Immunol. 182, 820-828.

  80. Georgel, P., Jiang, Z., Kunz, S., Janssen, E., Mols, J., Hoebe, K., Bahram, S., Oldstone, M. B., and Beutler, B. (2007) Vesicular Stomatitis Virus Glycoprotein G Activates a Specific Antiviral Toll-Like Receptor 4-Dependent Pathway. Virology. 362, 304-313.

  81. Alexopoulou, L., Holt, A. C., Medzhitov, R., and Flavell, R. A. (2001) Recognition of Double-Stranded RNA and Activation of NF-kappaB by Toll-Like Receptor 3. Nature. 413, 732-738.

  82. Kato, H., Takeuchi, O., Sato, S., Yoneyama, M., Yamamoto, M., Matsui, K., Uematsu, S., Jung, A., Kawai, T., Ishii, K. J., Yamaguchi, O., Otsu, K., Tsujimura, T., Koh, C. S., Reis e Sousa, Matsuura, Y., Fujita, T., and Akira, S. (2006) Differential Roles of MDA5 and RIG-I Helicases in the Recognition of RNA Viruses. Nature. 441, 101-105.

  83. Hornung, V., Ellegast, J., Kim, S., Brzozka, K., Jung, A., Kato, H., Poeck, H., Akira, S., Conzelmann, K. K., Schlee, M., Endres, S., and Hartmann, G. (2006) 5'-Triphosphate RNA is the Ligand for RIG-I. Science. 314, 994-997.

  84. Pichlmair, A., Schulz, O., Tan, C. P., Naslund, T. I., Liljestrom, P., Weber, F., and Reis e Sousa. (2006) RIG-I-Mediated Antiviral Responses to Single-Stranded RNA Bearing 5'-Phosphates. Science. 314, 997-1001.

  85. Gitlin, L., Barchet, W., Gilfillan, S., Cella, M., Beutler, B., Flavell, R. A., Diamond, M. S., and Colonna, M. (2006) Essential Role of Mda-5 in Type I IFN Responses to Polyriboinosinic:Polyribocytidylic Acid and Encephalomyocarditis Picornavirus. Proc. Natl. Acad. Sci. U. S. A. 103, 8459-8464.

  86. Kawai, T., Takahashi, K., Sato, S., Coban, C., Kumar, H., Kato, H., Ishii, K. J., Takeuchi, O., and Akira, S. (2005) IPS-1, an Adaptor Triggering RIG-I- and Mda5-Mediated Type I Interferon Induction. Nat. Immunol. 6, 981-988.

  87. Seth, R. B., Sun, L., Ea, C. K., and Chen, Z. J. (2005) Identification and Characterization of MAVS, a Mitochondrial Antiviral Signaling Protein that Activates NF-kappaB and IRF 3. Cell. 122, 669-682.

  88. Xu, L. G., Wang, Y. Y., Han, K. J., Li, L. Y., Zhai, Z., and Shu, H. B. (2005) VISA is an Adapter Protein Required for Virus-Triggered IFN-Beta Signaling. Mol. Cell. 19, 727-740.

  89. Meylan, E., Curran, J., Hofmann, K., Moradpour, D., Binder, M., Bartenschlager, R., and Tschopp, J. (2005) Cardif is an Adaptor Protein in the RIG-I Antiviral Pathway and is Targeted by Hepatitis C Virus. Nature. 437, 1167-1172.

  90. Saha, S. K., Pietras, E. M., He, J. Q., Kang, J. R., Liu, S. Y., Oganesyan, G., Shahangian, A., Zarnegar, B., Shiba, T. L., Wang, Y., and Cheng, G. (2006) Regulation of Antiviral Responses by a Direct and Specific Interaction between TRAF3 and Cardif. EMBO J. 25, 3257-3263.

  91. Tang, E. D., and Wang, C. Y. (2010) TRAF5 is a Downstream Target of MAVS in Antiviral Innate Immune Signaling. PLoS One. 5, e9172.

  92. Zhao, T., Yang, L., Sun, Q., Arguello, M., Ballard, D. W., Hiscott, J., and Lin, R. (2007) The NEMO Adaptor Bridges the Nuclear Factor-kappaB and Interferon Regulatory Factor Signaling Pathways. Nat. Immunol. 8, 592-600.

  93. Ryzhakov, G., and Randow, F. (2007) SINTBAD, a Novel Component of Innate Antiviral Immunity, Shares a TBK1-Binding Domain with NAP1 and TANK. EMBO J. 26, 3180-3190.

  94. Kato, H., Sato, S., Yoneyama, M., Yamamoto, M., Uematsu, S., Matsui, K., Tsujimura, T., Takeda, K., Fujita, T., Takeuchi, O., and Akira, S. (2005) Cell Type-Specific Involvement of RIG-I in Antiviral Response. Immunity. 23, 19-28.

  95. Yanai, H., Chen, H. M., Inuzuka, T., Kondo, S., Mak, T. W., Takaoka, A., Honda, K., and Taniguchi, T. (2007) Role of IFN Regulatory Factor 5 Transcription Factor in Antiviral Immunity and Tumor Suppression. Proc. Natl. Acad. Sci. U. S. A. 104, 3402-3407.

  96. Takaoka, A., Wang, Z., Choi, M. K., Yanai, H., Negishi, H., Ban, T., Lu, Y., Miyagishi, M., Kodama, T., Honda, K., Ohba, Y., and Taniguchi, T. (2007) DAI (DLM-1/ZBP1) is a Cytosolic DNA Sensor and an Activator of Innate Immune Response. Nature. 448, 501-505.

  97. Wang, Z., Choi, M. K., Ban, T., Yanai, H., Negishi, H., Lu, Y., Tamura, T., Takaoka, A., Nishikura, K., and Taniguchi, T. (2008) Regulation of Innate Immune Responses by DAI (DLM-1/ZBP1) and Other DNA-Sensing Molecules. Proc. Natl. Acad. Sci. U. S. A. 105, 5477-5482.

  98. Chiu, Y. H., Macmillan, J. B., and Chen, Z. J. (2009) RNA Polymerase III Detects Cytosolic DNA and Induces Type I Interferons through the RIG-I Pathway. Cell. 138, 576-591.

  99. Ablasser, A., Bauernfeind, F., Hartmann, G., Latz, E., Fitzgerald, K. A., and Hornung, V. (2009) RIG-I-Dependent Sensing of Poly(dA:DT) through the Induction of an RNA Polymerase III-Transcribed RNA Intermediate. Nat. Immunol. 10, 1065-1072.

100. Schroder, M., Baran, M., and Bowie, A. G. (2008) Viral Targeting of DEAD Box Protein 3 Reveals its Role in TBK1/IKKepsilon-Mediated IRF Activation. EMBO J. 27, 2147-2157.

101. Li, K., Foy, E., Ferreon, J. C., Nakamura, M., Ferreon, A. C., Ikeda, M., Ray, S. C., Gale, M.,Jr., and Lemon, S. M. (2005) Immune Evasion by Hepatitis C Virus NS3/4A Protease-Mediated Cleavage of the Toll-Like Receptor 3 Adaptor Protein TRIF. Proc. Natl. Acad. Sci. U. S. A. 102, 2992-2997.

102. Barro, M., and Patton, J. T. (2007) Rotavirus NSP1 Inhibits Expression of Type I Interferon by Antagonizing the Function of Interferon Regulatory Factors IRF3, IRF5, and IRF7. J. Virol. 81, 4473-4481.

103. Yu, Y., Wang, S. E., and Hayward, G. S. (2005) The KSHV Immediate-Early Transcription Factor RTA Encodes Ubiquitin E3 Ligase Activity that Targets IRF7 for Proteosome-Mediated Degradation. Immunity. 22, 59-70.

104. Joo, C. H., Shin, Y. C., Gack, M., Wu, L., Levy, D., and Jung, J. U. (2007) Inhibition of Interferon Regulatory Factor 7 (IRF7)-Mediated Interferon Signal Transduction by the Kaposi's Sarcoma-Associated Herpesvirus Viral IRF Homolog vIRF3. J. Virol. 81, 8282-8292.

105. Zhao, Y., Xu, D., Jiang, Y., and Zhang, L. (2010) Dual Functions of Interferon Regulatory Factors 7C in Epstein-Barr Virus-Mediated Transformation of Human B Lymphocytes. PLoS One. 5, e9459.