Allele | brown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | X | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 105,132,097 bp (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ C (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Atp7a | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | ATPase, Cu++ transporting, alpha polypeptide | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Menkes protein, MNK, br | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 105,070,882-105,168,532 bp (+) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions in copper transport across membranes. This protein is localized to the trans Golgi network, where it is predicted to supply copper to copper-dependent enzymes in the secretory pathway. It relocalizes to the plasma membrane under conditions of elevated extracellular copper, and functions in the efflux of copper from cells. Mutations in this gene are associated with Menkes disease, X-linked distal spinal muscular atrophy, and occipital horn syndrome. Alternatively-spliced transcript variants have been observed. [provided by RefSeq, Aug 2013] PHENOTYPE: Mutations in this gene affect copper metabolism and, depending on the allele, result in abnormal pigmentation, vibrissae, hair, and skeleton. Behavior may be abnormal and defects of collagen and elastin fibers are reported. Some alleles are hemizygous lethal. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Isoleucine changed to Threonine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q64430 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000058840 Gene: ENSMUSG00000033792 AA Change: I498T
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000109186 Gene: ENSMUSG00000033792 AA Change: I497T
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Possibly essential (E-score: 0.739) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | X-linked Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All alleles(104) : Targeted(2) Gene trapped(63) Spontaneous(24) Chemically induced(9) Radiation induced(8) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | X-linked Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Sperm, gDNA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 036697-MU | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2016-05-13 3:09 PM by Stephen Lyon | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2009-09-29 12:00 AM | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2012-07-12 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The brown phenotype was originally discovered as a visible variant among G3 mice homozygous for mutations induced by N-ethyl-N-nitrosourea (ENU). Hemizygous males and homozygous females from this strain exhibited a brown coat and normal pigmentation of the skin and eyes (Figure 1) (1). Two additional phenotypes emerged while the pigmentation phenotype was being mapped; a wavy coat (see the record for woolly) and hyperactivity. These phenotypes are due to independent mutations. The heterozygous brown females displayed normal black coats. Examination of the copper content in the brains of brown hemizygotes found that there was a 60% reduction when compared to the wild-type littermates (Figure 2A) (1). The brown mice displayed delayed onset of prion disease compared to wild type littermates following intracranial inoculation with the Rocky Mountain Laboratory (RML) strain of mouse scrapie (Figure 2B) (1). However, the brains of both brown mice and wild type mice contained the proteinase K-resistant, abnormally folded, disease-associated form of cellular prion protein (PrPres), as detected by Western blot analysis (Figure 2C) (1). In addition, the brains of both the wild-type and brown mice exhibited spongiosis (Figure 3, top), damage to pyramidal neurons (as observed from loss of MAP2-immunoreactive dendrites in the neocortex and hippocampus) (Figure 3, center), and astrogliosis (as observed from changes in GFAP staining) (Figure 3, bottom) (1). Further analysis by immunohistochemistry (Figure 4A) and Western blot (Figure 4B-D) demonstrated that the total levels of PrP, and the levels of PrPres were reduced in clinically ill brown animals when compared to wild-type animals (1). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation | To map the brown mutation, the index brown male was outcrossed to C3H/HeN females, and then backcrossed to his F1 daughters. Among 17 offspring, 6 had black coats (1 female, 5 male), and 11 had brown coats (7 female, 4 male). Linkage mapping using 128 polymorphic sites across the genome demonstrated strongest linkage of the brown mutation with the marker DXMit172, flanked by the distal marker DXMit114 and proximal marker DXMit121 on chromosome X (LOD=3.86). This region contained three genes previously described to affect coat pigmentation when mutated (Atp7a, Eda, and Htr2c). Because brown mice did not display ectodermal dysplasia or postnatal grown retardation, which have been observed in Eda and Htr2c mutants, respectively, these two genes were not considered as candidates for causation of the brown phenotype. Capillary sequencing of coding exons and splice junctions of Atp7a revealed a T to C transition at position 1570 of the Atp7a transcript, in exon 5 of 23 total exons.
1554 CAGAACAAGTGTTACATACAGGTCTCTGGGATG
478 -Q--N--K--C--Y--I--Q--V--S--G--M-
The mutated nucleotide is indicated in red lettering, and results in an isoleucine to threonine substitution at amino acid 483 of the ATP7A protein. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Please see the record for Tigrou-like for information about Atp7a.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | In humans, ATP7A deficiency causes Menkes disease (MD; OMIM #309400) and the milder occipital horn syndrome (OHS; OMIM #304150). Mice with mutations in Atp7a are collectively known as mottled mice after the variegated pigmentation pattern present in heterozygous females. Mottled mice display a wide range of phenotypes, from prenatal death to more subtle defects in hemizygous males (2). Like brown, the classical Blotchy mouse mutant is viable (2). Blotchy mice are considered to be a model of OHS (2). The Blotchy mutation occurs at a splice site resulting in the production of both aberrant and wild type transcripts (3), and low levels of wild type functional protein likely explain the milder phenotype. Male mice carrying another allele of Atp7a on a CBA/J background, known as mottled pewter, display a light gray coat color and no other phenotypes. The Atp7a mutation in mottled pewter mice results in an alanine to threonine substitution at amino acid 998 of ATP7A (4). The mutated alanine resides in the highly conserved transduction sequence CPCSLGLA in the sixth transmembrane domain of ATP7A. The two cysteines in this sequence are responsible for copper binding and the proline mediates the conformational change associated with copper transport. The mild phenotype found in mottled pewter mice, suggests that the substitution of a threonine residue for an alanine residue interferes minimally with ATP7A copper transport. The brown mutation substitutes a threonine for an isoleucine that lies close to the fifth metal-binding motif in the ATP7A N-terminal region. The mild phenotype found in brown males and absence of phenotype in heterozygous females suggests that the brown mutation results in an ATP7A protein that retains most of its function (1). Although each of the six N-terminal copper-binding motifs in ATP7A is capable of binding to a reduced Cu(I) ion, functional studies suggest that the entire N-terminal region of ATP7A binds a total of four copper ions and that the metal binding sites can be functionally redundant (5-7). However, the fifth and sixth of these motifs appear to be important for ATP7A function because at least one of these two sites needs to bind copper in order for copper transport to occur (8;9). The proximity of the residue affected by the brown mutation to the fifth metal-binding site may alter the efficiency of copper binding to this motif and consequently impair copper transport. In support of this hypothesis, the copper content of the brains of brown mice was reduced by 60% compared to wild type mice (1). When inoculated with RML scrapie, the onset of clinical signs of scrapie were delayed in brown mice relative to wild type mice. Furthermore, levels of total PrP and PrPres were reduced in brown mice with clinical signs of scrapie compared to similarly affected wild type mice. These data support previous findings indicating that copper chelation delays the onset of scrapie (10), and that copper may induce proteinase resistance of PrP (11-13). However, brown mice displayed extensive neurodegeneration and scrapie symptoms similar in severity to those observed in infected wild type mice, indicating that the reduced levels of PrPres present in brown mice remain sufficient to cause disease and death. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping |
Brown genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change using the same primers used in Tigrou sequencing.
Primers for PCR amplification
Tig(F): 5’- TGATGCCAGGGTACAAATTGTCAGC -3’
Tig(R): 5’- GGTTAGGGCAGCCTAAGTACCAAAC -3’
PCR program
1) 94°C 2:00
2) 94°C 0:30
3) 56°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 29X
6) 72°C 7:00
7) 4°C ∞
Primers for sequencing
Tig_seq(F): 5’- GCACAAGAACTGTCTAGTAACTG -3’
Tig_seq(R): 5’- CTAGGCAACTTGGATCTTACAAGG -3’
The following sequence of 1173 nucleotides (from Genbank genomic region NC_000086 for linear DNA sequence of Atp7a) is amplified:
60664 tgatgcc agggtacaaa ttgtcagcat gataaggcta gttaaataca agcacaagaa
60721 ctgtctagta actggttatt ttctactcgg ggttgggttt ggagataata gctagaagaa 60781 tctgacataa ctaaattttt tgtactcact tgagtcagat tttcttggga cccccctgag 60841 gtggacagta aagaaattca aagtcagtgt tgggaatggg taataacaat atatttgttg 60901 agagctttta ggaccttgct gattttatag aaatgcattg gcaggcctag aggtgtggct 60961 gtgacttttg acaaggtgta agctagagaa taaatgaaaa gaacctttct ctctccagca 61021 gacatgaaag agccactggt agtgatagct cagccctcac tggaaacacc tcttttgccc 61081 tcaagtaatg agctagaaaa tgtgatgacg tcagttcaga acaagtgtta catacaggtc 61141 tctgggatga cctgtgcttc ttgtgtagca aacattgaac gcaatttaag acgagaagaa 61201 ggtaagtgtt gttattttta tgtcccttat ttccagattc tgtccaatct gtgttttatg 61261 gccatgcttt gaagtctttc caaggcttcc ttcccaaaga tcatccttga tgaacaatac 61321 atccctgaat ttctggaagt ttttaattag tgttatttct tttacaatcc cattttagtg 61381 ccagtgaaat ctactaaaaa gtttatagca gaaggaaata catagcatta ctattatgag 61441 ccatggctat aatagccttt aagaaactaa attttttgtt aaagctgttt taaaaagtga 61501 taatgaataa gttaggtatt gtcttatcta gattaaacag cagagccaaa ccatatttgt 61561 gtagaattat attgtctcct ctagcagttt gacctctgat ctttccttgt aagatccaag 61621 ttgcctagta ctgtgtattt taacttcagg ttacaaaatc tttgaaaatc aacaccactg 61681 tttttctgta gttgctcaaa tgttttagtc tataaattta tatacatttt ataggtatat 61741 caataatata gcatagtacc ttagttaacc gtataaatat atgattatgt ttaatgagac 61801 caaagtctta agtttggtac ttaggctgcc ctaacc
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References |
4. Levinson, B., Packman, S., and Gitschier, J. (1997) Mutation Analysis of Mottled Pewter. Mouse Genome. 95, 163-165.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Nora G. Smart, Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Owen M. Siggs, Bruce Beutler |