Phenotypic Mutation 'brown' (pdf version)
List |< first << previous [record 41 of 511] next >> last >|
Allelebrown
Mutation Type missense
ChromosomeX
Coordinate106,088,491 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Atp7a
Gene Name ATPase, Cu++ transporting, alpha polypeptide
Synonym(s) MNK, br, Menkes protein
Chromosomal Location 106,027,276-106,124,926 bp (+)
MGI Phenotype Mutations in this gene affect copper metabolism and, depending on the allele, result in abnormal pigmentation, vibrissae, hair, and skeleton. Behavior may be abnormal and defects of collagen and elastin fibers are reported. Some alleles are hemizygous lethal.
Accession Number

NCBI RefSeq: NM_009726; MGI: 99400

Mapped Yes 
Amino Acid Change Isoleucine changed to Threonine
Institutional SourceBeutler Lab
Ref Sequences
I483T in Ensembl: ENSMUSP00000109186 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:HMA 11 72 1.5e-9 PFAM
Pfam:HMA 174 235 2.2e-8 PFAM
Pfam:HMA 280 344 1.9e-9 PFAM
low complexity region 348 362 N/A INTRINSIC
Pfam:HMA 380 441 6.4e-11 PFAM
Pfam:HMA 482 543 2.5e-7 PFAM
Pfam:HMA 558 619 9.3e-10 PFAM
transmembrane domain 643 665 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Pfam:E1-E2_ATPase 777 1025 6.5e-47 PFAM
Pfam:Hydrolase 1029 1304 1.3e-40 PFAM
Pfam:Hydrolase_3 1272 1336 5.4e-2 PFAM
transmembrane domain 1350 1372 N/A INTRINSIC
transmembrane domain 1376 1398 N/A INTRINSIC
Predicted Effect possibly damaging

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
(Using Ensembl: ENSMUSP00000109186)
Phenotypic Category pigmentation, skin/coat/nails
Penetrance 100% 
Alleles Listed at MGI

All alleles(104) : Targeted(2) Gene trapped(63) Spontaneous(24) Chemically induced(9) Radiation induced(8)          

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Atp7a APN X 106109830 unclassified probably damaging 0.97
IGL02023:Atp7a APN X 106094982 unclassified probably damaging 0.99
IGL02597:Atp7a APN X 106069888 unclassified probably benign 0.44
IGL03285:Atp7a APN X 106109775 unclassified probably benign
Golden UTSW X unclassified
Silver UTSW X unclassified
Tigrou UTSW X 106088407 nonsense
Tigrou-like UTSW X 106105250 missense probably damaging 1.00
Ups UTSW X 106088491 missense possibly damaging 0.48
JAX1:Atp7a UTSW X 106094857 missense probably benign 0.00
R0240:Atp7a UTSW X 106109841 missense probably damaging 1.00
R0240:Atp7a UTSW X 106109841 missense probably damaging 1.00
R3434:Atp7a UTSW X 106094857 missense probably benign 0.00
R3435:Atp7a UTSW X 106094857 missense probably benign 0.00
R3756:Atp7a UTSW X 106101843 intron probably null
R4911:Atp7a UTSW X 106120374 missense probably damaging 0.99
R5072:Atp7a UTSW X 106109768 missense probably benign
R5073:Atp7a UTSW X 106109768 missense probably benign
R5074:Atp7a UTSW X 106109768 missense probably benign
Mode of Inheritance X-linked Recessive
Local Stock Sperm, gDNA
MMRRC Submission 036697-MU
Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created 09/29/2009 12:00 AM
Record Posted 07/12/2012
Phenotypic Description
Figure 1.  The brown mice exhibit a brown coat.
Figure 2. Reduced copper content in Atp7abrown mutant brains is associated with prolonged survival after intracranial RML scrapie infection. (A) The amount of copper in the brains of uninfected Atp7a+/Y and Atp7abrown/Y littermates was determined by ICP-MS (n=5; error bars represent SEM). (B) Atp7a+/Y and Atp7abrown/Y mice were inoculated intracranially with RML scrapie and sacrificed when clinical signs of prion disease were observed (n=10). (C) The presence of proteinase resistant PrP (PrPres) in the brains of clinically ill Atp7a+/Y and Atp7abrown/Y mice was confirmed by Western blot (n=3). Similar results to those shown were obtained for all other samples analysed in each experiment. RML, Rocky Mountain Laboratory scrapie.
Figure 3. Normal spongiosis, dendrite loss, and astrogliosis in the brains of RML scrapie-infected Atp7abrown mutants. Brain sections from uninfected Atp7a+/Y, RML scrapie-infected Atp7a+/Y, and RML scrapie-infected Atp7abrown/Y mice sacrificed when clinically ill were stained with Haematoxylin and eosin (H&E), antibodies against the dendrite marker MAP2, and antibodies against the astroglial marker GFAP. Arrows indicate areas of MAP2 staining and highlight dendrite loss in the RML scrapie-infected sections.  Similar results to those shown were obtained for all other samples in each group (n=3). 
Figure 4. Reduced PrP and PrPres in the brains of RML scrapie-infected Atp7abrown mutants. (A) Brain sections from clinically ill RML scrapie-infected Atp7a+/Y and Atp7abrown/Y mice were stained for proteinase K-resistant PrP (PrPres) (n=3). Low (upper panels) and high (lower panels) magnification images are shown. (B) Representative Western blots of PrP and PrPres levels in the brains of uninfected and RML scrapie-infected Atp7a+/Y (lanes 1-4) and Atp7abrown/Y (lanes 5-8) mice. (C and D) Quantification of total PrP (C) and PrPres (D) in the brains of uninfected and RML scrapie-infected Atp7a+/Y and Atp7abrown/Y mice as determined by Western blot using GE ImageQuant software (n=5; error bars represent SEM). Similar results to those shown were obtained for all other samples analysed in each experiment.

The brown phenotype was originally discovered as a visible variant among G3 mice homozygous for mutations induced by N-ethyl-N-nitrosourea (ENU). Hemizygous males and homozygous females from this strain exhibited a brown coat and normal pigmentation of the skin and eyes (Figure 1(1). Two additional phenotypes emerged while the pigmentation phenotype was being mapped; a wavy coat (see the record for woolly) and hyperactivity. These phenotypes are due to independent mutations.  The heterozygous brown females displayed normal black coats.

 

Examination of the copper content in the brains of brown hemizygotes found that there was a 60% reduction when compared to the wild-type littermates (Figure 2A(1). The brown mice displayed delayed onset of prion disease compared to wild type littermates following intracranial inoculation with the Rocky Mountain Laboratory (RML) strain of mouse scrapie (Figure 2B(1).  However, the brains of both brown mice and wild type mice contained the proteinase K-resistant, abnormally folded, disease-associated form of cellular prion protein (PrPres), as detected by Western blot analysis (Figure 2C(1).   In addition, the brains of both the wild-type and brown mice exhibited spongiosis (Figure 3, top), damage to pyramidal neurons (as observed from loss of MAP2-immunoreactive dendrites in the neocortex and hippocampus) (Figure 3, center), and astrogliosis (as observed from changes in GFAP staining) (Figure 3, bottom) (1).  Further analysis by immunohistochemistry (Figure 4A) and Western blot (Figure 4B-D) demonstrated that the total levels of PrP, and the levels of PrPres were reduced in clinically ill brown animals when compared to wild-type animals (1).

Nature of Mutation

To map the brown mutation, the index brown male was outcrossed to C3H/HeN females, and then backcrossed to his F1 daughters.  Among 17 offspring, 6 had black coats (1 female, 5 male), and 11 had brown coats (7 female, 4 male).  Linkage mapping using 128 polymorphic sites across the genome demonstrated strongest linkage of the brown mutation with the marker DXMit172, flanked by the distal marker DXMit114 and proximal marker DXMit121 on chromosome X (LOD=3.86). This region contained three genes previously described to affect coat pigmentation when mutated (Atp7aEda, and Htr2c).  Because brown mice did not display ectodermal dysplasia or postnatal grown retardation, which have been observed in Eda and Htr2c mutants, respectively, these two genes were not considered as candidates for causation of the brown phenotype.  Capillary sequencing of coding exons and splice junctions of Atp7a revealed a T to C transition at position 1570 of the Atp7a transcript, in exon 5 of 23 total exons.

 
1554  CAGAACAAGTGTTACATACAGGTCTCTGGGATG
478   -Q--N--K--C--Y--I--Q--V--S--G--M-
 

The mutated nucleotide is indicated in red lettering, and results in an isoleucine to threonine substitution at amino acid 483 of the ATP7A protein.

Protein Prediction
Figure 5. Domain organization and function of ATP7A. A, Topography. B, Domain structure. MBD1-MBD6 represent the N-terminal metal binding domains with the Cu-binding cysteines indicated. Critical residues thought to bind Cu in transmembrane domains 6, 7, and 8 are shown. The canonical A-domain and P-domain residues are also indicated. The LL and PBM motifs in the C-terminal tail are necessary for subcellular localization of ATP7A. Conversion of ATP to ADP by the N-domain leads to phosphorylation of the P-domain and copper transport. The A-domain dephosphorylates the P-domain. Numbers 1, 2, and 3 indicate the order of copper binding and transport (see text). The brown mutation results in an isoleucine to threonine substitution at amino acid 483 of the ATP7A protein. This image is interactive. Click on the image to view other mutations found in ATP7A (red). Click on the mutations for more specific information.   
The brown mutation results in an isoleucine to threonine amino acid substitution just prior to the fifth metal-binding domain (Figure 5).
 
 Please see the record for Tigrou-like for information about Atp7a.
Putative Mechanism

In humans, ATP7A deficiency causes Menkes disease (MD; OMIM #309400) and the milder occipital horn syndrome (OHS; OMIM #304150). Mice with mutations in Atp7a are collectively known as mottled mice after the variegated pigmentation pattern present in heterozygous females. Mottled mice display a wide range of phenotypes, from prenatal death to more subtle defects in hemizygous males (2).  Like brown, the classical Blotchy mouse mutant is viable (2). Blotchy mice are considered to be a model of OHS (2). The Blotchy mutation occurs at a splice site resulting in the production of both aberrant and wild type transcripts (3), and low levels of wild type functional protein likely explain the milder phenotype.  Male mice carrying another allele of Atp7a on a CBA/J background, known as mottled pewter, display a light gray coat color and no other phenotypes. The Atp7a mutation in mottled pewter mice results in an alanine to threonine substitution at amino acid 998 of ATP7A (4). The mutated alanine resides in the highly conserved transduction sequence CPCSLGLA in the sixth transmembrane domain of ATP7A. The two cysteines in this sequence are responsible for copper binding and the proline mediates the conformational change associated with copper transport. The mild phenotype found in mottled pewter mice, suggests that the substitution of a threonine residue for an alanine residue interferes minimally with ATP7A copper transport.

 

The brown mutation substitutes a threonine for an isoleucine that lies close to the fifth metal-binding motif in the ATP7A N-terminal region.  The mild phenotype found in brown males and absence of phenotype in heterozygous females suggests that the brown mutation results in an ATP7A protein that retains most of its function (1). Although each of the six N-terminal copper-binding motifs in ATP7A is capable of binding to a reduced Cu(I) ion, functional studies suggest that the entire N-terminal region of ATP7A binds a total of four copper ions and that the metal binding sites can be functionally redundant (5-7). However, the fifth and sixth of these motifs appear to be important for ATP7A function because at least one of these two sites needs to bind copper in order for copper transport to occur (8;9).  The proximity of the residue affected by the brown mutation to the fifth metal-binding site may alter the efficiency of copper binding to this motif and consequently impair copper transport.  In support of this hypothesis, the copper content of the brains of brown mice was reduced by 60% compared to wild type mice (1).

 

When inoculated with RML scrapie, the onset of clinical signs of scrapie were delayed in brown mice relative to wild type mice.  Furthermore, levels of total PrP and PrPres were reduced in brown mice with clinical signs of scrapie compared to similarly affected wild type mice.  These data support previous findings indicating that copper chelation delays the onset of scrapie (10), and that copper may induce proteinase resistance of PrP (11-13).  However, brown mice displayed extensive neurodegeneration and scrapie symptoms similar in severity to those observed in infected wild type mice, indicating that the reduced levels of PrPres present in brown mice remain sufficient to cause disease and death.

 

Primers Primers cannot be located by automatic search.
Genotyping
Brown genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change using the same primers used in Tigrou sequencing.  
 
Primers for PCR amplification
Tig(F): 5’- TGATGCCAGGGTACAAATTGTCAGC -3’
Tig(R): 5’- GGTTAGGGCAGCCTAAGTACCAAAC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
Tig_seq(F): 5’- GCACAAGAACTGTCTAGTAACTG -3’
Tig_seq(R): 5’- CTAGGCAACTTGGATCTTACAAGG -3’
 
The following sequence of 1173 nucleotides (from Genbank genomic region NC_000086 for linear DNA sequence of Atp7a) is amplified:
 
60664    tgatgcc agggtacaaa ttgtcagcat gataaggcta gttaaataca agcacaagaa
60721 ctgtctagta actggttatt ttctactcgg ggttgggttt ggagataata gctagaagaa
60781 tctgacataa ctaaattttt tgtactcact tgagtcagat tttcttggga cccccctgag
60841 gtggacagta aagaaattca aagtcagtgt tgggaatggg taataacaat atatttgttg
60901 agagctttta ggaccttgct gattttatag aaatgcattg gcaggcctag aggtgtggct
60961 gtgacttttg acaaggtgta agctagagaa taaatgaaaa gaacctttct ctctccagca
61021 gacatgaaag agccactggt agtgatagct cagccctcac tggaaacacc tcttttgccc
61081 tcaagtaatg agctagaaaa tgtgatgacg tcagttcaga acaagtgtta catacaggtc
61141 tctgggatga cctgtgcttc ttgtgtagca aacattgaac gcaatttaag acgagaagaa
61201 ggtaagtgtt gttattttta tgtcccttat ttccagattc tgtccaatct gtgttttatg
61261 gccatgcttt gaagtctttc caaggcttcc ttcccaaaga tcatccttga tgaacaatac
61321 atccctgaat ttctggaagt ttttaattag tgttatttct tttacaatcc cattttagtg
61381 ccagtgaaat ctactaaaaa gtttatagca gaaggaaata catagcatta ctattatgag
61441 ccatggctat aatagccttt aagaaactaa attttttgtt aaagctgttt taaaaagtga
61501 taatgaataa gttaggtatt gtcttatcta gattaaacag cagagccaaa ccatatttgt
61561 gtagaattat attgtctcct ctagcagttt gacctctgat ctttccttgt aagatccaag
61621 ttgcctagta ctgtgtattt taacttcagg ttacaaaatc tttgaaaatc aacaccactg
61681 tttttctgta gttgctcaaa tgttttagtc tataaattta tatacatttt ataggtatat
61741 caataatata gcatagtacc ttagttaacc gtataaatat atgattatgt ttaatgagac
61801 caaagtctta agtttggtac ttaggctgcc ctaacc                                                    
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
  4. Levinson, B., Packman, S., and Gitschier, J. (1997) Mutation Analysis of Mottled Pewter. Mouse Genome. 95, 163-165.
Science Writers Nora G. Smart, Anne Murray
Illustrators Diantha La Vine
AuthorsOwen M. Siggs, Bruce Beutler
List |< first << previous [record 41 of 511] next >> last >|
Edit History
08/03/2011 3:40 PM (current)
08/03/2011 3:39 PM
01/28/2011 6:53 PM
09/09/2010 2:57 PM
09/09/2010 2:57 PM
03/04/2010 11:05 AM