Phenotypic Mutation 'tortellini'

• Allele: tortellini
• Mutation Type: critical splice donor site (1 bp from exon)
• Chromosome: 2
• Coordinate: 129,866,505 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Tgm3
• Gene Name: transglutaminase 3, E polypeptide
• Synonym(s): we, TG E
• Chromosomal Location: 129,854,269-129,892,319 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 103735349 - 146096051 bp
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q08189
• SMART Domains: Protein: ENSMUSP00000105928; Gene: ENSMUSG00000027401

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	5	118	8.3e-33	PFAM
TGc	265	357	6.4e-39	SMART
Pfam:Transglut_C	483	588	3.9e-26	PFAM
Pfam:Transglut_C	595	693	4.9e-24	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 036192-MU
• Last Updated: 2016-05-13 3:09 PM by Stephen Lyon
• Record Created: 2009-09-30 12:00 AM
• Record Posted: 2011-08-15
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Sungyong Won, Bruce Beutler

Accession Number

Genbank: NM_009374; MGI: 98732

Alleles Listed at MGI

All alleles(1) : Gene trapped(1)

Phenotypic Description

Two ENU-mutagenized G3 siblings were found to have rough-looking, curly hair. One of them (C8071) died at nine days post-infection (dpi) in the In Vivo RVFV Susceptibility Screen.  The other one (C8597) was used for breeding to generate a homozygous stock of mice with curly hair.  Curly-haired breeders yielded 100% of offspring with curly hair, demonstrating that the curly hair phenotype is 100% penetrant.  Of seven curly-haired mice (2 males, 5 females) tested for RVFV susceptibility, one (male) was found susceptible, dying at eight dpi.  These data suggest that two separate mutations are responsible for the curly hair phenotype, designated tortellini, and the RVFV susceptibility phenotype.

Nature of Mutation

The curly hair phenotype was mapped by bulk segregation analysis of F2 backcross offspring using C57BL/10J as the mapping strain (n=18 with mutant phenotype, 15 with normal phenotype).  Strongest linkage was observed with the marker at position 122094116 bp on chromosome 2 (synthetic LOD=9.9); separate genotyping of DNA samples defined a critical region bounded by 103735349 and 146096051 bp.  Whole genome SOLiD sequencing of a tortellini mutant was carried out, yielding ≥1X, ≥2X, and ≥3X coverage of coding/splice junction nucleotides of 78.6%, 66.7%, and 55.9%, respectively.  Across chromosome 2, ≥1X, ≥2X, and ≥3X coverage of coding/splice junction nucleotides was 81.3%, 70.2%, and 59.8%, respectively.  Thirteen discrepancies from the reference sequence were identified among coding/splice junction nucleotides within the critical region.  Of these, a mutation at position 129850321 bp was validated by capillary sequencing (validation efficiency 12/13).  The mutation corresponds to a G to A transition at position 12212 bp of the genomic sequence of Tgm3 (NC_000068), affecting the first nucleotide of intron 3.  Tgm3 contains 13 exons.  

The effect of the mutation on Tgm3 transcript and protein is unknown.  It is predicted that in tortellini mice, skipping of the 240 nucleotide exon 3 would result in in-frame splicing from exon 2 to exon 4. 

          <--exon 2       exon 3         intron 3-->  exon4-->

11477 ATTGTTTCCACAG GTCCCCAAC……GGTTGCAAG GTAGGTCTTTA… CGGATGATGTCTTT…

57    -I--V--S--T-- G--P--Q--……W--L--Q--              A--D--D--V--F-…

         correct          deleted                         correct

The mutated nucleotide is indicated in red lettering; the splice donor site is shown in blue.  The translated Tgm3 mutant protein would lack 80 amino acids encoded by exon 3.

Protein Prediction

Transglutaminases crosslink proteins by catalyzing the calcium-dependent formation of an isopeptide bond between a glutamine residue from one protein and a lysine residue from another protein (1).  The reaction involves the glutamine γ-carboxyamide group and the lysine ε-NH₂ group, and yields an insoluble N^ε-(γ-glutamyl)lysine isopeptide bond linking the two proteins (Figure 1).  Besides ε-NH₂ groups of lysine residues, the acceptor nucleophile in TGase-catalyzed reactions may be a polyamine (such as spermidine), water, or the terminal ω-alcohol group of certain long chain ceramides; in these cases, TGase catalyzes the formation, respectively, of a mono- or bis-(γ-glutamyl) bond, glutamic acid (by deamidation of glutamine), or a glutamate ester linkage.  Nine transglutaminases are recognized in mammals.  Tgm3 is 76.5% identical in sequence in mice and humans.

Tgm3 is expressed as an inactive 693-amino acid 77-kDa soluble pro-enzyme (Figure 2).  Activation requires cleavage at serine 469 (guinea pig Tgm3) (2;3) or serine 465 (mouse and human Tgm3) (4), which dissociates the protein into a catalytically active N-terminal fragment of 50 kDa and a non-catalytic C-terminal fragment of 27 kDa.  The fragments remain associated noncovalently in a native complex the same size as the inactive pro-enzyme.  The proteases dispase, proteinase K, trypsin, thrombin (3), and cathepsin L (5) can cleave Tgm3 to produce active enzyme in vitro; however, the identity of its natural protease remains unknown.

The X-ray crystal structure of Tgm3 in both the pro-enzyme form and cleaved, active form has been reported (6;7) (Figure 3).  Both forms of Tgm3, as well as other crystallized transglutaminases, have a similar architecture of four folded domains: an N-terminal β-sandwich domain (aa 1-134), a catalytic core domain (aa 135-472), a β-barrel 1 domain (aa 473-592), and a C-terminal β-barrel 2 domain (aa 593-692) (aa numbers for Tgm3).  The β-sandwich domain contains nine β-sheets and three interspersed α-helices.  The catalytic core consists of fifteen β-sheets and fifteen α-helices; the longest of these helices is located in center of the molecule and contains one of the residues of the catalytic triad, Cys272.  The other two residues of the triad are His330 and Asp353, which are positioned in adjacent β-sheets.  The active site triad is buried in the hydrophobic center of the enzyme, within a narrow cleft bounded on two sides by β-sheets of the catalytic core domain and the C terminus of β-barrel 1.  Residues 462-471 form a flexible solvent-exposed loop joining the last α-helical segment of the catalytic core with the first β-strand of the β-barrel 1 domain.  It is within this loop that proteolytic cleavage occurs to activate the pro-enzyme.  Ser465/469 is flanked by polar residues predicted to reside near the surface of the protein and serve as a recognition site for the activating protease(s).

Once activated by proteolysis, Tgm3 activity is further regulated by Ca²⁺ ion binding.  Biochemical experiments demonstrated that a single Ca²⁺ is tightly bound in the catalytic core domain of the Tgm3 zymogen (7).  This Ca²⁺ ion is constitutively bound to the enzyme and is believed to be required for stability.  Upon proteolysis, two additional Ca²⁺ ions readily bind and are required for full enzymatic activation.  Binding of the second Ca²⁺ produces a small conformational change in the active site, but binding of the third Ca²⁺ results in a substantial conformational change in which a loop on the surface of the enzyme moves 9 Å to expose a channel leading inward to the catalytic triad (6;7).  The third ion binding site can also be occupied by Mg²⁺, in which case the enzyme is inactive and the channel is closed.  Thus, intracellular cation levels could control enzyme activity through regulation of channel opening.  Although this channel is thought to be the entry point for substrates to access the active site, further evidence is needed to support this hypothesis since without further structural changes the channel dimensions appear to be too narrow and too deep for substrate glutamine and lysine side chains to reach the active site (8).  Two Trp residues (aa 326 and 327) shown in biochemical experiments to be important in the transglutaminase reaction mechanism (9;10) are exposed after binding of the second and third Ca²⁺ ions and may serve as docking sites for substrate glutamine and lysine side chains (6;11).

In addition to Ca²⁺ ions, guanine nucleotides also regulate Tgm3 activity (12).  In crystal structures, GTPγS and GDP nucleotides bind to the same site in Tgm3, a pocket formed between the catalytic core domain and the β-barrel 1 domain.  This pocket bears little similarity to the GTP-binding pockets of G-proteins, but Tgm3 is able to hydrolyze GTP.  The role of GTPase activity in the physiological functions of Tgm3 is unknown, and has been proposed to provide Tgm3 with signal transduction capability.  GTP binding to Tgm3 is associated with substitution of Ca²⁺ by Mg²⁺ at ion binding site three, and therefore inhibits Tgm3 activity.  Conversely, Ca²⁺ binding inhibits GTP binding and activates the enzyme.  When GDP is bound, Tgm3 is able to shift between the channel open and channel closed conformations.  Interestingly, three nucleotide analogs that bound to the GTP-binding pocket were found to increase enzymatic activity 10-fold (13), supporting the idea that nucleotide interactions with Tgm3 are a significant aspect of the regulatory mechanism governing enzymatic activity.

An isoform of mouse Tgm3 lacking exons 6 and 7 and an isoform of human Tgm3 lacking exons 9 and 10 were identified by RT-PCR; the existence of these isoforms in mouse or human tissue at the protein level has not been demonstrated (14).

The tortellini mutation is predicted to result in a 613 amino acid protein product that is lacking the 80 amino acids encoded by exon 3.

Expression/Localization

By RT-PCR, Tgm3 was found in brain (cortex, cerebellum), stomach, spleen, small intestine, testis, skeletal muscle, and skin (15).  BioGPS reports high expression in tongue (in human and mouse) and in large intestine (in mouse).

In human skin, Tgm3 protein was expressed in the upper layers of the epidermis, i.e. in cells of the granular and cornified layers (16;17) (Figure 4).  In the adult human hair follicle, Tgm3 protein was reported to be exclusively expressed in the cortex and cuticle (18).  In contrast, during the fetal period, its expression was observed in the bulbous hair peg and differentiated lanugo hair follicle in cells of the inner root sheath, in hair canals, and in inner cells of the outer root sheath in the region of the isthmus (19).  Mouse anagen hair follicles showed Tgm3 expression in the inner root sheath and outer root sheath, and in the medulla (but not cortex) (20-23).  In contrast to these antibody-based localization studies, detection of Tgm3 in mouse hair follicles by visualization of in situ activity towards a Tgm3-specific substrate peptide localized Tgm3 in the medulla and cortex of the hair shaft (24).

In cultured keratinocytes, Tgm3 is localized diffusely in the cytoplasm (16). 

Background

Crosslinking of proteins by transglutaminases increases their resistance to proteolytic degradation.  Transglutaminases therefore function in a variety of biological processes requiring tissue strengthening or barrier formation, including bone ossification and extracellular matrix assembly, blood coagulation, and epithelial differentiation (25).

Transglutaminases in the epidermis

Protection against physical, chemical, and microbial insults is provided by the epidermis, a multilayered stratified squamous epithelium of keratinocytes that forms the outermost compartment of the skin.  Construction of the epidermis begins in the innermost epidermal layer, the basal layer, containing the proliferative cells.  These cells produce non-dividing daughter cells that initiate a terminal differentiation program as they are displaced outward toward the cell surface to form the suprabasal layers, which include the spinous, granular, transition, and cornified layers.  These layers mark stages of the differentiation process that ends in the cornified layer, an association of flattened, dead cell remnants in the uppermost layer of the skin.

The transglutaminases Tgm1, Tgm3, and Tgm5 participate to varying degrees in crosslink formation during generation of the cornified envelope, an insoluble, durable structure located beneath the plasma membrane of cells of the cornified layer (corneocytes) (26) (Figure 5).  The cornified envelope is 15 nm thick, consisting of covalently crosslinked proteins (10 nm thick) and an outer coating of covalently linked lipids (5 nm thick), and endows the skin with impermeability to many substances including, importantly, water.  Formation of the cornified envelope occurs by sequential deposition of proteins.  Tgm1- and Tgm5-mediated crosslinking of envoplakin and periplakin beneath the plasma membrane likely initiates cornified envelope formation in the spinous layer (27).  Involucrin is also deposited to form a scaffold early in cornified envelope development (28;29), likely crosslinked by Tgm1 (30).  Reinforcement of these initial linkages occurs in the granular layer, where Tgm3 first crosslinks loricrin and small proline-rich proteins (SPRs) together to form small interchain oligomers, which are then permanently crosslinked to the developing cornified envelope by Tgm1 (31).  Tgm1 and Tgm3 were shown to preferentially utilize different residues for crosslinking (31).  Finally, in the cornified layer, extruded long-chain ω-hydoxyceramides are crosslinked to involucrin by Tgm1 (32), and to other previously crosslinked proteins such as envoplakin and periplakin.  Thus, Tgm1, Tgm3, and Tgm5 have distinct but complementary roles in crosslink formation in the cornified envelope.

Occurring simultaneously with the formation of the cornified envelope is the destruction of intracellular organelles and the keratin-mediated morphological transformation of keratinocytes from a more rounded shape to the flattened shape of corneocytes.  Expression of keratin (K) 1 and K10 begins in the spinous layer, and gradually replaces the preexisting K5 and K14 keratin intermediate filament (KIF) network.  Filaggrin aggregates the K1 and K10 filaments into tight arrays, which is believed to promote flattening of the cell into the characteristic shape of corneocytes of the cornified layer (33).  KIF are crosslinked to the cornified envelope by the action of transglutaminases at a specific lysine residue located in a conserved region of the head domain of type II keratins (34).  This integrates the KIF cytoskeleton with the cornified envelope, thereby stabilizing the entire structure.  Mutation of this lysine residue in K1 causes nonepidermolytic palmar-plantar keratoderma (35), in which thickening of the palms and soles is observed, due to abnormal organization of the keratin filaments adjacent to the cornified envelope. 

Hypomorphic mutations in TGM1 cause lamellar ichthyosis in humans (36;37) (OMIM #2423000), a recessive disorder causing affected babies to be born in a collodion membrane, a shiny film over the skin that is shed about two weeks after birth to reveal extensive scaling of the skin caused by hyperkeratosis.  Tgm1^-/- mice died within five hours after birth due to defective development of the cornified layer leading to impaired skin barrier function (38).  Skin from Tgm1^-/- mice lacked a cornified envelope and displayed transepidermal water loss; transplanted skin developed ichthyosis (39).  Mutations in TGM5 cause recessive acral peeling skin syndrome in humans (40)(OMIM #609796), in which painless shedding of the outer epidermis predominantly on the back of the hands and feet occurs continuously.  Separation of the skin occurs between the granular layer and the cornified layer of the epidermis.

In contrast to TGM1 and TGM5, TGM3 mutation has not been etiologically linked to any human disease.  TGM3 is believed to be the autoantigenic target in humans with dermatitis herpetiformis (DH), a blistering skin disease characterized by granular IgA deposits in the papillary dermis (41).  DH is a cutaneous manifestation of celiac disease; although autoantibodies for TGM3 and TGM1 are also found in celiac patients without DH, only those with DH express TGM3 antibodies non-crossreactive with TGM1 (41).  TGM3 has been suggested to crosslink mutant huntingtin protein found in aggregates in neurons of patients with Huntington disease (42).  No Tgm3-deficient mouse model has been reported, and it was suggested that a knockout mouse could not be generated due to a failure in implantation of the blastocyst (8).  However, as reported in (43), Tgm3^-/- mice were successfully generated and preliminary data indicated that they displayed “a curled structure of the fur and whiskers, with irregularities in ultrastructure and increased protein extractability reflecting altered crosslinking of hair structural proteins” (as described in (44)).

Tgm3 function in the hair follicle

Formation of the cornified envelope in the hair follicle occurs in the hair canal, hair cuticle, and outer root sheath in the region of the isthmus, and  follows a similar process as that in the epidermis (19;45).  Tgm1, Tgm3, and Tgm5 are coordinately expressed in the developing hair follicle together with the major cornified envelope proteins involucrin, loricrin, SPR-1, and SPR-2, implicating these transglutaminases in cornified envelope formation in the hair follicle (19).

Although its expression in the hair follicle is undisputed, different reports have described Tgm3 localization in distinct and mutually exclusive regions of the hair follicle possibly due to differences in the developmental stage or species examined (see Expression/Localization).  In inner root sheath cells, Tgm3 has been reported to crosslink trichohyalin to the head and tail end domains of KIF, allowing the cells to harden and form a rigid insoluble multilayer sheath that plays an essential role in shape determination of cortical cells of the hair fiber that lie internal to the sheath structure (22;23;46;47).  In the medulla of the hair shaft, Tgm3 may crosslink trichohyalin to itself to form vacuolated aggregates that entrap air pockets and may therefore contribute to the thermal insulating properties of hair (22).  Tgm3 was also reportedly expressed in the cortex and cuticle of the hair shaft, along with keratins K31, K33-a, K33-b, K34, K83, and K85, and keratin-associated proteins (KAP) 2.n, KAP3.1, KAP3.3, KAP11.1, and KAP13.1 (48).  In vitro, purified activated Tgm3 could crosslink K33-b and a KAP3.1 synthetic peptide, suggesting a role for Tgm3 in crosslinking the interfilamentous matrix of the hair cortex (48), which is known to be crosslinked primarily by disulfide bonds (49). 

Regulation of Tgm3 activity

The activity of Tgm3 is regulated at several levels.  First, gene expression is controlled by at least one promoter region located at -129 to -91 residues from the transcription start site; this promoter can confer epithelial-specific expression to Tgm3 in vitro (50).  Sp1-like and Ets-like recognition motifs are found within this promoter region (50;51).  Second, proteolytic cleavage activates the transglutaminase activity of Tgm3, although the natural activating protease remains unknown (2;3).  Third, calcium ion binding to Tgm3 is required for expression of maximal enzymatic activity (7).  A gradient of Ca²⁺ that increases from the basal to the granular layers of the epidermis (52;53)contributes to the expression of cornified envelope proteins and to the increasing rate of protein crosslinking activity by transglutaminases in suprabasal layers (54).  Fourth, guanine nucleotides affect Tgm3 activity, with GTP inhibiting and GDP favoring transglutaminase activity (12). 

Putative Mechanism

The hair shaft is composed of three concentric layers (Figure 4).  The outermost layer is the cuticle, made up of thin, flat, overlapping cuticle cells.  The middle layer is the cortex, which comprises the bulk of the hair shaft, consisting of elongated, keratinized cortical cells.  The third and innermost part of the hair shaft is the medulla, and consists of a strand of highly vacuolated hardened cell remnants called medulla cells; the medulla is not present in all hair shafts.  The cuticle and medulla lack bilateral structural asymmetry, and therefore are not believed to contribute to hair curvature (55).  Thus, mutation of Tgm3 is predicted to result in curly or wavy hair due to deficiency of crosslinking ability toward hair keratins or other proteins present in the hair cortex.  Tgm3 has not been shown to directly crosslink keratins, but has been suggested to crosslink keratins to KAPs.  The identity of the specific keratins and KAPs crosslinked by Tgm3 is not known.  In the absence of Tgm3, asymmetric crosslinking of keratins to KAPs may lead to hair bending.

Several common genetic variants of the gene encoding trichohyalin, a Tgm3 substrate, were associated with straight hair in Europeans in a genome-wide association study (56).  Although the effect of the polymorphisms is unknown, the finding suggests that structural alteration of trichohyalin can influence hair curvature.  Crosslinking of trichohyalin by Tgm3 may also contribute to the determination of hair morphology.

Primers

Primers cannot be located by automatic search.

Genotyping

Tortellini genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

Primers

tortellini (F): 5’-AGTGGCATCAGAGCCTGATTTCTTC -3’

tortellini (R): 5’- TCACACAGCCAGGTAAGTGCAGAC -3’

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7)  4°C              ∞

Primers for sequencing

tortellini_seq(F): 5’- GCCAGGACAAAGGCTGTATTTTC -3’

tortellini_seq(R): 5’- TAAGTGCAGACCTCCTGACTAGTAG -3’

The following sequence of 493 nucleotides (from Genbank genomic region NC_000068.6 for linear genomic sequence of Tgm3, sense strand) is amplified:

11896                 agtgg catcagagcc tgatttcttc taggtcctac ccagctccct

11941 ttgtttcctt cattttctgt ttctctgaca ggtccccaac cctctgagtc agccaggaca

12001 aaggctgtat tttccatctc tgggagaagc acgggtggct ggaatgcagc gctcaaagcc

12061 aacagtggca ataatctggc cattgctatt gccagtcctg tcagtgctcc catcggattg

12121 tacacactga gtgttgagat ctcctccagg ggcagggcct cctctctgaa acttggcacg

12181 tttataatgc tcttcaaccc gtggttgcaa ggtaggtctt taagcacggc attccccaca

12241 catccctgat agaaacaatg agtgtgaaaa agagagatgg ctaacctgtg ccccgtatgg

12301 gcttagatct ggttggagaa agcctgtggg ccatgggagg agcagaaaag ctactagtca

12361 ggaggtctgc acttacctgg ctgtgtga

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is indicated in red.

References

  1. Folk, J. E. (1980) Transglutaminases. Annu. Rev. Biochem.. 49, 517-531.

  2. Kim, I. G., Gorman, J. J., Park, S. C., Chung, S. I., and Steinert, P. M. (1993) The Deduced Sequence of the Novel Protransglutaminase E (TGase3) of Human and Mouse. J. Biol. Chem.. 268, 12682-12690.

  3. Kim, H. C., Lewis, M. S., Gorman, J. J., Park, S. C., Girard, J. E., Folk, J. E., and Chung, S. I. (1990) Protransglutaminase E from Guinea Pig Skin. Isolation and Partial Characterization. J. Biol. Chem.. 265, 21971-21978.

  4. Hitomi, K., Ikeda, N., and Maki, M. (2003) Immunological Detection of Proteolytically Activated Epidermal-Type Transglutaminase (TGase 3) using Cleavage-Site-Specific Antibody. Biosci. Biotechnol. Biochem.. 67, 2492-2494.

  5. Cheng, T., Hitomi, K., van Vlijmen-Willems, I. M., de Jongh, G. J., Yamamoto, K., Nishi, K., Watts, C., Reinheckel, T., Schalkwijk, J., and Zeeuwen, P. L. (2006) Cystatin M/E is a High Affinity Inhibitor of Cathepsin V and Cathepsin L by a Reactive Site that is Distinct from the Legumain-Binding Site. A Novel Clue for the Role of Cystatin M/E in Epidermal Cornification. J. Biol. Chem.. 281, 15893-15899.

  6. Ahvazi, B., Boeshans, K. M., Idler, W., Baxa, U., and Steinert, P. M. (2003) Roles of Calcium Ions in the Activation and Activity of the Transglutaminase 3 Enzyme. J. Biol. Chem.. 278, 23834-23841.

  7. Ahvazi, B., Kim, H. C., Kee, S. H., Nemes, Z., and Steinert, P. M. (2002) Three-Dimensional Structure of the Human Transglutaminase 3 Enzyme: Binding of Calcium Ions Changes Structure for Activation. EMBO J.. 21, 2055-2067.

  8. Ahvazi, B., Boeshans, K. M., and Rastinejad, F. (2004) The Emerging Structural Understanding of Transglutaminase 3. J. Struct. Biol.. 147, 200-207.

  9. Iismaa, S. E., Holman, S., Wouters, M. A., Lorand, L., Graham, R. M., and Husain, A. (2003) Evolutionary Specialization of a Tryptophan Indole Group for Transition-State Stabilization by Eukaryotic Transglutaminases. Proc. Natl. Acad. Sci. U. S. A.. 100, 12636-12641.

  10. Murthy, S. N., Iismaa, S., Begg, G., Freymann, D. M., Graham, R. M., and Lorand, L. (2002) Conserved Tryptophan in the Core Domain of Transglutaminase is Essential for Catalytic Activity. Proc. Natl. Acad. Sci. U. S. A.. 99, 2738-2742.

  11. Ahvazi, B., and Steinert, P. M. (2003) A Model for the Reaction Mechanism of the Transglutaminase 3 Enzyme. Exp. Mol. Med.. 35, 228-242.

  12. Ahvazi, B., Boeshans, K. M., Idler, W., Baxa, U., Steinert, P. M., and Rastinejad, F. (2004) Structural Basis for the Coordinated Regulation of Transglutaminase 3 by Guanine Nucleotides and calcium/magnesium. J. Biol. Chem.. 279, 7180-7192.

  13. Ahvazi, B., Boeshans, K. M., and Steinert, P. M. (2004) Crystal Structure of Transglutaminase 3 in Complex with GMP: Structural Basis for Nucleotide Specificity. J. Biol. Chem.. 279, 26716-26725.

  14. Zocchi, L., Terrinoni, A., Candi, E., Ahvazi, B., Bagetta, G., Corasaniti, M. T., Lena, A. M., and Melino, G. (2007) Identification of Transglutaminase 3 Splicing Isoforms. J. Invest. Dermatol.. 127, 1791-1794.

  15. Hitomi, K., Horio, Y., Ikura, K., Yamanishi, K., and Maki, M. (2001) Analysis of Epidermal-Type Transglutaminase (TGase 3) Expression in Mouse Tissues and Cell Lines. Int. J. Biochem. Cell Biol.. 33, 491-498.

  16. Hitomi, K., Presland, R. B., Nakayama, T., Fleckman, P., Dale, B. A., and Maki, M. (2003) Analysis of Epidermal-Type Transglutaminase (Transglutaminase 3) in Human Stratified Epithelia and Cultured Keratinocytes using Monoclonal Antibodies. J. Dermatol. Sci.. 32, 95-103.

  17. Candi, E., Oddi, S., Paradisi, A., Terrinoni, A., Ranalli, M., Teofoli, P., Citro, G., Scarpato, S., Puddu, P., and Melino, G. (2002) Expression of Transglutaminase 5 in Normal and Pathologic Human Epidermis. J. Invest. Dermatol.. 119, 670-677.

  18. Thibaut, S., Candi, E., Pietroni, V., Melino, G., Schmidt, R., and Bernard, B. A. (2005) Transglutaminase 5 Expression in Human Hair Follicle. J. Invest. Dermatol.. 125, 581-585.

  19. Akiyama, M., Matsuo, I., and Shimizu, H. (2002) Formation of Cornified Cell Envelope in Human Hair Follicle Development. Br. J. Dermatol.. 146, 968-976.

  20. Chung, S. I., and Folk, J. E. (1972) Transglutaminase from Hair Follicle of Guinea Pig (Crosslinking-Fibrin-Glutamyllysine-Isoenzymes-Purified Enzyme). Proc. Natl. Acad. Sci. U. S. A.. 69, 303-307.

  21. Peterson, L. L., and Wuepper, K. D. (1984) Epidermal and Hair Follicle Transglutaminases and Crosslinking in Skin. Mol. Cell. Biochem.. 58, 99-111.

  22. Tarcsa, E., Marekov, L. N., Andreoli, J., Idler, W. W., Candi, E., Chung, S. I., and Steinert, P. M. (1997) The Fate of Trichohyalin. Sequential Post-Translational Modifications by Peptidyl-Arginine Deiminase and Transglutaminases. J. Biol. Chem.. 272, 27893-27901.

  23. Steinert, P. M., Parry, D. A., and Marekov, L. N. (2003) Trichohyalin Mechanically Strengthens the Hair Follicle: Multiple Cross-Bridging Roles in the Inner Root Shealth. J. Biol. Chem.. 278, 41409-41419.

  24. Yamane, A., Fukui, M., Sugimura, Y., Itoh, M., Alea, M. P., Thomas, V., El Alaoui, S., Akiyama, M., and Hitomi, K. (2010) Identification of a Preferred Substrate Peptide for Transglutaminase 3 and Detection of in Situ Activity in Skin and Hair Follicles. FEBS J.. 277, 3564-3574.

  25. Lorand, L., and Graham, R. M. (2003) Transglutaminases: Crosslinking Enzymes with Pleiotropic Functions. Nat. Rev. Mol. Cell Biol.. 4, 140-156.

  26. Eckert, R. L., Sturniolo, M. T., Broome, A. M., Ruse, M., and Rorke, E. A. (2005) Transglutaminase Function in Epidermis. J. Invest. Dermatol.. 124, 481-492.

  27. Candi, E., Schmidt, R., and Melino, G. (2005) The Cornified Envelope: A Model of Cell Death in the Skin. Nat. Rev. Mol. Cell Biol.. 6, 328-340.

  28. Steinert, P. M., and Marekov, L. N. (1997) Direct Evidence that Involucrin is a Major Early Isopeptide Cross-Linked Component of the Keratinocyte Cornified Cell Envelope. J. Biol. Chem.. 272, 2021-2030.

  29. Yaffe, M. B., Murthy, S., and Eckert, R. L. (1993) Evidence that Involucrin is a Covalently Linked Constituent of Highly Purified Cultured Keratinocyte Cornified Envelopes. J. Invest. Dermatol.. 100, 3-9.

  30. Nemes, Z., Marekov, L. N., and Steinert, P. M. (1999) Involucrin Cross-Linking by Transglutaminase 1. Binding to Membranes Directs Residue Specificity. J. Biol. Chem.. 274, 11013-11021.

  31. Candi, E., Tarcsa, E., Idler, W. W., Kartasova, T., Marekov, L. N., and Steinert, P. M. (1999) Transglutaminase Cross-Linking Properties of the Small Proline-Rich 1 Family of Cornified Cell Envelope Proteins. Integration with Loricrin. J. Biol. Chem.. 274, 7226-7237.

  32. Nemes, Z., Marekov, L. N., Fesus, L., and Steinert, P. M. (1999) A Novel Function for Transglutaminase 1: Attachment of Long-Chain Omega-Hydroxyceramides to Involucrin by Ester Bond Formation. Proc. Natl. Acad. Sci. U. S. A.. 96, 8402-8407.

  33. Presland, R. B., Kuechle, M. K., Lewis, S. P., Fleckman, P., and Dale, B. A. (2001) Regulated Expression of Human Filaggrin in Keratinocytes Results in Cytoskeletal Disruption, Loss of Cell-Cell Adhesion, and Cell Cycle Arrest. Exp. Cell Res.. 270, 199-213.

  34. Candi, E., Tarcsa, E., Digiovanna, J. J., Compton, J. G., Elias, P. M., Marekov, L. N., and Steinert, P. M. (1998) A Highly Conserved Lysine Residue on the Head Domain of Type II Keratins is Essential for the Attachment of Keratin Intermediate Filaments to the Cornified Cell Envelope through Isopeptide Crosslinking by Transglutaminases. Proc. Natl. Acad. Sci. U. S. A.. 95, 2067-2072.

  35. Kimonis, V., DiGiovanna, J. J., Yang, J. M., Doyle, S. Z., Bale, S. J., and Compton, J. G. (1994) A Mutation in the V1 End Domain of Keratin 1 in Non-Epidermolytic Palmar-Plantar Keratoderma. J. Invest. Dermatol.. 103, 764-769.

  36. Russell, L. J., DiGiovanna, J. J., Rogers, G. R., Steinert, P. M., Hashem, N., Compton, J. G., and Bale, S. J. (1995) Mutations in the Gene for Transglutaminase 1 in Autosomal Recessive Lamellar Ichthyosis. Nat. Genet.. 9, 279-283.

  37. Huber, M., Rettler, I., Bernasconi, K., Frenk, E., Lavrijsen, S. P., Ponec, M., Bon, A., Lautenschlager, S., Schorderet, D. F., and Hohl, D. (1995) Mutations of Keratinocyte Transglutaminase in Lamellar Ichthyosis. Science. 267, 525-528.

  38. Matsuki, M., Yamashita, F., Ishida-Yamamoto, A., Yamada, K., Kinoshita, C., Fushiki, S., Ueda, E., Morishima, Y., Tabata, K., Yasuno, H., Hashida, M., Iizuka, H., Ikawa, M., Okabe, M., Kondoh, G., Kinoshita, T., Takeda, J., and Yamanishi, K. (1998) Defective Stratum Corneum and Early Neonatal Death in Mice Lacking the Gene for Transglutaminase 1 (Keratinocyte Transglutaminase). Proc. Natl. Acad. Sci. U. S. A.. 95, 1044-1049.

  39. Kuramoto, N., Takizawa, T., Takizawa, T., Matsuki, M., Morioka, H., Robinson, J. M., and Yamanishi, K. (2002) Development of Ichthyosiform Skin Compensates for Defective Permeability Barrier Function in Mice Lacking Transglutaminase 1. J. Clin. Invest.. 109, 243-250.

  40. Cassidy, A. J., van Steensel, M. A., Steijlen, P. M., van Geel, M., van der Velden, J., Morley, S. M., Terrinoni, A., Melino, G., Candi, E., and McLean, W. H. (2005) A Homozygous Missense Mutation in TGM5 Abolishes Epidermal Transglutaminase 5 Activity and Causes Acral Peeling Skin Syndrome. Am. J. Hum. Genet.. 77, 909-917.

  41. Sardy, M., Karpati, S., Merkl, B., Paulsson, M., and Smyth, N. (2002) Epidermal Transglutaminase (TGase 3) is the Autoantigen of Dermatitis Herpetiformis. J. Exp. Med.. 195, 747-757.

  42. Zainelli, G. M., Dudek, N. L., Ross, C. A., Kim, S. Y., and Muma, N. A. (2005) Mutant Huntingtin Protein: A Substrate for Transglutaminase 1, 2, and 3. J. Neuropathol. Exp. Neurol.. 64, 58-65.

  43. Thiebach, L., John, S., Paulsson, M., and Smyth, N. (2007) The Role of TG3 and TG6 in Hair Morphogenesis and in the Establishment of the Skin Barrier Function. 9th International Conference on Transglutaminases and Protein Crosslinking, Marrakech, Morocco.

  44. Iismaa, S. E., Mearns, B. M., Lorand, L., and Graham, R. M. (2009) Transglutaminases and Disease: Lessons from Genetically Engineered Mouse Models and Inherited Disorders. Physiol. Rev.. 89, 991-1023.

  45. Akiyama, M., Smith, L. T., Yoneda, K., Holbrook, K. A., and Shimizu, H. (1999) Transglutaminase and Major Cornified Cell Envelope Precursor Proteins, Loricrin, Small Proline-Rich Proteins 1 and 2, and Involucrin are Coordinately Expressed in the Sites Defined to Form Hair Canal in Developing Human Hair Follicle. Exp. Dermatol.. 8, 313-314.

  46. Rothnagel, J. A., and Rogers, G. E. (1986) Trichohyalin, an Intermediate Filament-Associated Protein of the Hair Follicle. J. Cell Biol.. 102, 1419-1429.

  47. O'Guin, W. M., Sun, T. T., and Manabe, M. (1992) Interaction of Trichohyalin with Intermediate Filaments: Three Immunologically Defined Stages of Trichohyalin Maturation. J. Invest. Dermatol.. 98, 24-32.

  48. Thibaut, S., Cavusoglu, N., de Becker, E., Zerbib, F., Bednarczyk, A., Schaeffer, C., van Dorsselaer, A., and Bernard, B. A. (2009) Transglutaminase-3 Enzyme: A Putative Actor in Human Hair Shaft Scaffolding? J. Invest. Dermatol.. 129, 449-459.

  49. Shimomura, Y., and Ito, M. (2005) Human Hair Keratin-Associated Proteins. J. Investig. Dermatol. Symp. Proc.. 10, 230-233.

  50. Lee, J. H., Jang, S. I., Yang, J. M., Markova, N. G., and Steinert, P. M. (1996) The Proximal Promoter of the Human Transglutaminase 3 Gene. Stratified Squamous Epithelial-Specific Expression in Cultured Cells is Mediated by Binding of Sp1 and Ets Transcription Factors to a Proximal Promoter Element. J. Biol. Chem.. 271, 4561-4568.

  51. Kim, C. D., Seo, E. Y., Sung, Y. H., Kim, H. W., Seo, Y. J., Park, J. K., and Lee, J. H. (2004) Characterization of Ets-Binding Sequence of Human Transglutaminase 3 Gene Promoter. Exp. Dermatol.. 13, 529-534.

  52. Menon, G. K., and Elias, P. M. (1991) Ultrastructural Localization of Calcium in Psoriatic and Normal Human Epidermis. Arch. Dermatol.. 127, 57-63.

  53. Menon, G. K., Grayson, S., and Elias, P. M. (1985) Ionic Calcium Reservoirs in Mammalian Epidermis: Ultrastructural Localization by Ion-Capture Cytochemistry. J. Invest. Dermatol.. 84, 508-512.

  54. Yuspa, S. H., Kilkenny, A. E., Steinert, P. M., and Roop, D. R. (1989) Expression of Murine Epidermal Differentiation Markers is Tightly Regulated by Restricted Extracellular Calcium Concentrations in Vitro. J. Cell Biol.. 109, 1207-1217.

  55. Bryson, W. G., Harland, D. P., Caldwell, J. P., Vernon, J. A., Walls, R. J., Woods, J. L., Nagase, S., Itou, T., and Koike, K. (2009) Cortical Cell Types and Intermediate Filament Arrangements Correlate with Fiber Curvature in Japanese Human Hair. J. Struct. Biol.. 166, 46-58.

  56. Medland, S. E., Nyholt, D. R., Painter, J. N., McEvoy, B. P., McRae, A. F., Zhu, G., Gordon, S. D., Ferreira, M. A., Wright, M. J., Henders, A. K., Campbell, M. J., Duffy, D. L., Hansell, N. K., Macgregor, S., Slutske, W. S., Heath, A. C., Montgomery, G. W., and Martin, N. G. (2009) Common Variants in the Trichohyalin Gene are Associated with Straight Hair in Europeans. Am. J. Hum. Genet.. 85, 750-755.