Phenotypic Mutation 'woolly'

• Allele: woolly
• Mutation Type: missense
• Chromosome: 1
• Coordinate: 9,956,329 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Sgk3
• Gene Name: serum/glucocorticoid regulated kinase 3
• Synonym(s): cytokine-independent survival kinase, fy, A330005P07Rik, 2510015P22Rik, Cisk
• Chromosomal Location: 9,868,332-9,971,070 bp (+) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mutations in this gene result in wavy vibrissae and coat/ hair abnormalities, including sparse and waved hair, due to impaired hair follicle development and/or hair cycle defects. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q9ERE3
• PDB Structure: crystal structure of CISK-PX domain [X-RAY DIFFRACTION] ; crystal structure of CISK-PX domain with sulfates [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000095437; Gene: ENSMUSG00000025915; AA Change: C346R

Domain	Start	End	E-Value	Type
PX	13	120	3.9e-19	SMART
S_TKc	162	419	1.07e-105	SMART
S_TK_X	420	489	1.96e-12	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000097826)
• SMART Domains: Protein: ENSMUSP00000130078; Gene: ENSMUSG00000025915; AA Change: C346R

Domain	Start	End	E-Value	Type
PX	13	120	3.9e-19	SMART
S_TKc	162	419	1.07e-105	SMART
S_TK_X	420	489	1.96e-12	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000166384)
• SMART Domains: Protein: ENSMUSP00000126861; Gene: ENSMUSG00000025915; AA Change: C346R

Domain	Start	End	E-Value	Type
PX	13	120	3.9e-19	SMART
S_TKc	162	419	1.07e-105	SMART
S_TK_X	420	489	1.96e-12	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000168907)
• SMART Domains: Protein: ENSMUSP00000127462; Gene: ENSMUSG00000025915; AA Change: C346R

Domain	Start	End	E-Value	Type
PX	13	120	3.9e-19	SMART
S_TKc	162	419	1.07e-105	SMART
S_TK_X	420	489	1.96e-12	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000171265)
• SMART Domains: Protein: ENSMUSP00000139942; Gene: ENSMUSG00000025915

Domain	Start	End	E-Value	Type
Pfam:PX	11	66	4.5e-7	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000140496; Gene: ENSMUSG00000025915

Domain	Start	End	E-Value	Type
PX	13	120	2.4e-21	SMART
S_TKc	162	333	2.1e-8	SMART

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000140318; Gene: ENSMUSG00000025915

Domain	Start	End	E-Value	Type
PX	13	120	2.4e-21	SMART
S_TKc	162	343	4.3e-9	SMART

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Possibly nonessential (E-score: 0.297)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 032233-UCD
• Last Updated: 2019-04-01 11:31 AM by Stephen Lyon
• Record Created: 2009-11-09 12:00 AM
• Record Posted: 2010-01-29
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Owen M. Siggs, Bruce Beutler

Accession Number

NCBI RefSeq: NM_133220; MGI: 2182368

Alleles Listed at MGI

All alleles(17) : Targeted, knock-out(2) Gene trapped(7) Spontaneous(7) Chemically induced(1)

Phenotypic Description

The woolly mutation was originally discovered as a visible coat texture phenotype that arose amongst the F2 mapping progeny of brown, suggesting that it was present in heterozygous form in the brown index male. Homozygous woolly mice display a curly coat, but are otherwise normal.

Nature of Mutation

The woolly phenotype was mapped to Chromosome 1 by backcrossing F1 offspring from crosses of the index brown male and C3H females, and Sgk3 was identified as a candidate gene in the mapped region.  Sequencing of Sgk3 revealed a T to C transition at position 87975 of the genomic DNA sequence (Genbank genomic region NC_000067 for linear genomic DNA sequence of Sgk3). The mutation occurs in exon 16 of 19 total exons. The mutated residue corresponds to nucleotide 1382 of Sgk3 transcript variant 1.

 

87960 ACTGTGGACTGGTGGTGCCTGGGCGCTGTTCTG

341   -T--V--D--W--W--C--L--G--A--V--L-

 

Genomic sequence and numbering are shown.  The mutated nucleotide is indicated in red lettering, and results in a cysteine to arginine substitution at amino acid 346 of the SGK3 protein.

Protein Prediction

The serum/glucocorticoid regulated kinase 3 (SGK3) is a 496 amino acid protein belonging to the SGK family of kinases, which are members of the AGC-type kinase (protein kinase A/protein kinase G/protein kinase C) superfamily. The SGK family is encoded by three genes in mammalian genomes: SGK1, 2, and 3, and the catalytic domains of these kinases share 80% sequence identity. In addition, the SGK proteins are structurally similar to the protein kinase B (PKB)/Akt family of kinases, sharing approximately 55% identity with the kinase domains of PKB proteins, and containing a C-terminal hydrophobic motif (HM) as well as conserved residues required for kinase activation [reviewed by (1;2)] (Figure 2).

 

At amino acids 162-419, SGK3 has a 9-motif catalytic domain important for ATP-binding and catalysis. These motifs include the highly conserved catalytic structure Ala329-Pro330-Glu331 in motif 8 and the conserved Lys191 in motif 2, which transfers the phosphoryl group during phosphorylation (3-5). Mutagenesis of this residue abolishes kinase activity (5;6). Nucleotide binding occurs at amino acids 168-176, while Asp286 is the SGK3 proton acceptor. SGK3 also contains a C-terminal domain similar to those found in other AGC-type kinases at amino acids 420-489, which contains the conserved HM. In order to become functional, both PKB and SGK kinases require phosphorylation at two conserved sites; a threonine present within the activation loop of the kinase domain, and a serine located in the C-terminal HM (Thr253 and Ser486 in SGK3). Phosphorylation at this serine is mediated by a phosphatidylinositol 3 kinase (PI3K)-dependent kinase likely to be mTOR (mammalian target of Rapamycin) (7;8), while the PI3K-dependent phosphoinositide-dependent kinase 1 (PDK1) phosphorylates the active loop threonine (1-3). PDK1-mediated phosphorylation of PKB/SGK proteins is facilitated by Ser486 phosphorylation, which promotes binding to PDK1 (9;10). Replacement of this conserved serine with aspartate leads to a constitutively active enzyme (6).

 

Unlike other SGK kinases, SGK3 contains an N-terminal Phox homology (PX) domain at amino acids 13-90, which are typically found in proteins that localize to endosomal membranes (11). The SGK3 PX domain can bind to the monophosphorylated lipid, phosphatidylinositol 3’ phosphate [PI(3)P] (1;12), a PI3K product, the localization of which is restricted to the limiting membranes of early endosomes and to the internal vesicles of multivesicular bodies (13). The SGK3 PX domain has also been shown to bind to PI(3,5)P₂, PI(3,4,5)P₃ and to a lesser extent PI(4,5)P₂ (14). Mutation or disruption of the PX domain diminishes binding to phosphoinositides, and disrupts SGK3 localization and activity (5;12;14;15). The crystal structure of the SGK3 PX domain identified the presence of a conserved positively charged phosphoinositide (PI)-binding pocket that determines the lipid specificity (16). The PX domain is composed of a β-sheet with three antiparallel β-strands (β1, β2, and β3), and a helical subdomain consisting of four α -helices (α1, α2, α3 and α3‘), a type II polyproline (PPII) region and a 3₁₀ helix, which are both less commonly found in proteins (Figure 3, PDB ID 1XTE). The bottom of the PI-binding pocket is formed by residues from α2, while those from the N-terminus of β2, the β3/ α1 loop and the PPII/ α2 loop constitute the walls of the pocket. The SGK3 PI-binding pocket has a wider opening between the PPII/ α2 loop (residues 75-82) and the N-terminus of β2 than homologous structures (16;17), which may favor binding of a PI with a highly phosphorylated head group such as PI(3,4,5)P₃ and PI(3,5)P₂. Two arginines in the PX domain, Arg50 and Arg90 are thought to be the PI binding determinants, although surrounding residues also play important roles. A hydrophobic region in the PPII/ α2 loop (Ile77 and Phe78) along with tandem lysine residues in the β1/β2 loop promotes the localization of SGK3 by interacting nonspecifically with the membrane surface. When the linker region between the PX and the kinase domains was included in the protein fragment used for crystallization, PX dimerization was observed. This dimerization may also play a role in the association of SGK3 with the membrane (16). 

 

Like PKB/Akt, SGK kinases preferentially phosphorylate an RXRXXS/T motif (1;2). However, PKB kinases prefer a serine residue as the phosphoacceptor and require the presence of a bulky hydrophobic amino acid at the +1 position of the motif, while SGKs prefer a threonine at the phosphorylation site and have no requirements for a hydrophobic residue at that position (18). SGK3 has been shown to phosphorylate a number of substrates, but the majority of these studies involved overexpression of the kinase. Thus, physiological SGK substrates are mostly unknown (1;2), but may include glycogen synthase kinase 3β (GSK3β) (19;20), and Flightless I (Fll1), an actin-binding protein that has been shown to be a coactivator of nuclear hormone receptors (21). In addition, SGK3 has been shown to bind to and phosphorylate a number of other proteins including histone H2B, the pro-apoptotic factors Bcl2-related BAD and FKHRL1/FOXO3A, and the E3 ubiquitin ligases Nedd4-2 and AIP4. The latter two proteins bind to SGK3 via a PPFY motif at amino acids 359-362 (22;23). 

 

The SGK3 kinase domain also contains an atypical nuclear localization signal at amino acids 195-205 within the kinase domain (15)

 

The woolly mutation results in replacement of a cysteine at amino acid 246 with an arginine within the kinase domain (Figure 2).

Expression/Localization

Figure 4. Hair follicle and cycle. A, The hair follicle consists of eight epithelial layers including the outer root sheath, companion layer, inner root sheath (consisting of Henle’s, Huxley’s and cuticle layers) and the hair shaft (consisting of cuticle, cortex and medulla).  All layers, with the exception of the outer root sheath, are derived from proliferative cells of the hair matrix, located around the dermal papilla at the base of the hair bulb.  B, After hair follicles are established, hair is periodically shed and replaced, involving periodic destruction and regeneration of hair follicles.  The hair cycle is divided into three periods: Anagen Phase(follicle growth), Catagen Phase(regression), and Telogen Phase(rest). Several signaling pathways are implicated in hair follicle regeneration. Mutations that affect the indicated stages of the cycle are noted in red text. Genes affected by these mutations are noted in black, italic text. Click on the mutations for more specific information.

SGK3 is constitutively expressed in most mammalian tissues (3). Northern blot analysis of human SGK3 expression found mRNA in all tissues examined (3;4). Expression was highest in lung, intermediate in liver, peripheral blood leukocytes, placenta, thymus, brain, kidney, pancreas, and colon, and low in heart, ovary, testis, prostate, small intestine, spleen, and skeletal muscle (4).

 

In the mouse, Northern blot analysis of mouse tissues revealed moderate to high expression levels of Sgk3 mRNA in heart, kidney, liver, lung, skeletal muscle, and thymus, with lower expression in adrenal gland, brain, skin, spleen, and fat (24). RT-PCR and in situ hybridization demonstrated the presence of Sgk3 mRNA in CA1, pyramidal cell layers of CA3 and the granular cell layer of the dentate gyrus in the hippocampus (25). Sgk3 mRNA is also present in the small intestine, especially within the crypts (26). A detailed analysis using in situ hybridization during the hair cycle revealed that Sgk3 expression was low at postnatal day 0 (P0), increased gradually to P14, and then decreased. Sgk3 mRNA expression is first detected in the inner root sheath (IRS) of the hair follicle (20;24;27). By P4, expression increased and was particularly intense in a subset of root sheath cells with lower level expression in matrix cells, which give rise to the IRS and precursors of the hair shaft. At P5, intense expression was found in the inner and outer root sheath (ORS) and some matrix cells, with lower level expression seen in numerous matrix cells of the hair bulb (24). During the early stage of catagen of the hair cycle, Sgk3 mRNA was still expressed in the remaining IRS, but this expression gradually disappeared, along with the involution of IRS through catagen progression. High levels of SGK3 protein can be found in the hair follicle and the cuticle and cortex of the hair shaft (20).

 

According to SymAtlas, SGK3/Sgk3 mRNA levels are particularly high in macrophages, monocytes and myeloid cells in humans and mice. These observations are supported by a study that identified SGK3 as a member of the macrophage phagosomal proteome (28).

 

Due to its PX domain, SGK3 localizes to vesicle-like structures and is present in early endosomal membranes containing the PI3K product PI(3)P (5;12-14). Mutation in the PX domain results in the kinase being relocated to the cytosol (5;12;14). SGK3 can be localized to the nucleus only in the absence of a functional PX domain (15). 

Background

The first member of the genes encoding the SGK family of kinases, SGK1, was first identified through a differential screen for glucocorticoid-inducible genes in a rat mammary tumor cell line (29). The SGK1 gene is also upregulated by serum, aldosterone, follicle stimulating hormone (FSH), extracellular osmolarity, the tumor suppressor protein p53, transforming growth factor (TGF)-β, and hyperosmotic stress (30-32). Unlike SGK1, SGK2 and SGK3 are generally not subject to transcriptional regulation (3). Human SGK2 and SGK3 were identified by homology to SGK1 (3;4), while the mouse homologue of SGK3 was first identified as the gene encoding the cytokine independent survival kinase (CISK), which allowed interleukin (IL)-3 independent survival in lymphoblast cells (33).

 

In eukaryotes, the phosphatidylinositol 3’ kinase (PI3K)-signaling pathway triggers a wide range of cellular responses, from cytoskeletal rearrangements to cellular survival. Deregulation of this pathway is associated with several diseases, including diabetes, and cancer (1). PI3Ks selectively phosphorylate the 3’ position of the inositol ring of phosphatidylinositides (PI). Stimulation of cells by hormones such as insulin, growth factors or cytokines typically results in the phosphorylation of specific receptor tyrosine kinases (RTKs) at multiple tyrosine residues, or in the activation of serpentine receptors-induced GTP binding to the Gα subunit of G proteins. These signals recruit PI3Ks to the plasma membrane where they can phosphorylate PI leading to the generation of 3’ phosphorylated phosphoinositides near the activated receptors. Generation of 3’ phosphorylated phosphoinotides is transient and is reversed by the action of the 3’-phosphoinositide 3’-phosphatase PTEN (phosphatase and tensin homologue). Membrane localized and newly generated 3’ phosphorylated PI recruits proteins that contain lipid-binding domains, including pleckstrin homology (PH) domains. PDK1 is one of these proteins and plays a critical role in activating many AGC-type kinases by binding to the phosphorylated HMs on these proteins and phosphorylating their activation loop threonine [reviewed by (1;2)]. All three SGK isoforms require PI3K activation for function and are also direct substrates of PDK1 (3;5). SGK kinases do not contain a PH domain like PKB proteins, which allow PKB to localize to the plasma membrane and associate with PI3K. However, SGK3 can localize to endosomal membranes via its PX domain where it colocalizes with PDK1 (5;12;14;23). SGK1 contains a novel PX-like PI-binding domain, but does not localize to endosomes (34). The activation of SGK kinases by PDK1 may also involve the serine/threonine kinase WNK1 (with no lysine kinase 1) via insulin growth factor (IGF)-1 signaling. IGF-1 induces SGK activity by stimulating PKB/Akt-dependent WNK1 phosphorylation, which then binds to SGK proteins and serves as a scaffold protein to assemble other molecules required for maximal SGK activation (33). 

 

In vitro, SGK1, SGK3, and to a lesser extent SGK2, have been shown to be potent positive regulators of membrane channel and transporter activity by increasing the expression of these proteins in the membrane. In addition to regulating ubiquitously expressed voltage-gated potassium (K⁺) channels, the chloride (Cl) channel ClC2, and the sodium (Na⁺)-K⁺ ATPase (35-37), SGK3 is able to regulate channels and transporters involved in cardiac function such as the cardiac voltage-gated Na⁺ channel SCN5A (38;39), and the HERG (human ether-a-go-go) channels and K⁺ channel complex KCNE1/KCNQ1, both of which are involved in repolarization of the cardiac action potential (40;41). SGK3 also regulates channels that are critical for normal kidney and intestinal function including the renal epithelial sodium (Na⁺) channel (ENaC), the renal and inner ear voltage-gated chloride (Cl) channel ClC-Ka (42), the electrogenic Na⁺-coupled dicarboxylate transporter NaDC-1 important in renal tubular citrate transport (43), the intestinal type IIb Na⁺-phosphate (NaPi IIb) and Na⁺-glucose (SGLT1) cotransporters (22;44), and epithelial calcium (Ca²⁺) channels TRPV5 and TRPV6 present in kidney and intestine, respectively (45). In addition, SGK3 regulates the neuronal glutamate receptors GluR1 and GluR6 (25;46), the amino acid transporters ASCT2, SN1, EEAT1, EEAT2, EEAT4, and EEAT5 that are mostly involved in glutamine or glutamate transport (47-52), the sodium-myo-inositol transporter SMIT1/SLC5A3 important in maintaining osmolarity (53), and the creatine transporter SLC6A8 (54). In general, SGK1 and SGK3 have largely overlapping abilities to upregulate these membrane proteins with some exceptions. For instance, SGK1 has no effect on GluR1 activity (25).

 

The mechanisms by which SGK kinases upregulate the activity of channels and transporters are not completely understood, but includes increased protein trafficking to the membrane and/or inhibition of protein degradation [reviewed by (1;2)]. As described above (Protein Prediction), SGK3 is able to interact with and phosphorylate the E3 ubiquitin ligases Nedd4-2 and AIP4 (1;22;23). Nedd4-2 ubiquitinates and promotes the degradation of many of the membrane proteins under SGK regulation. However, SGK phosphorylation of Nedd4-2 promotes its interaction with members of the 14-3-3 family of regulatory proteins, which inhibits Nedd4-2 ubiquitination (55). Similarly, SGK3 phosphorylation of AIP4 inhibits the ubiquitination of the chemokine receptor, CXCR4, which is often overexpressed downstream of PI3K pathway hyperactivation in cancer cells. SGK3 prevents CXCR4 degradation by inhibiting sorting of the receptor from early endosomes to lysosomes (23).

 

Due to the mostly in vitro aspect of these studies, the physiological relevance of SGK regulation of these channels and transporters remains to be determined in many cases. Indeed, many of the proteins phosphorylated and regulated by SGK kinases are also affected by PKB/Akt kinase activity. The analysis of knockout mice has provided some insight into the functional redundancies and in vivo roles of these kinases. Mice homozygous for a knockout of the Akt1 gene display retarded prenatal and postnatal growth, and exhibit increased apoptosis and decreased lifespan with genotoxic stress (56;57). They also display retardation of postnatal hair follicle morphogenesis (58). Akt2^-/- animals are insulin resistant and have elevated plasma triglycerides (59), while Akt3^-/- mice display a reduction in brain size (60). Knockout of the Sgk1 gene resulted in a mild reduction of salt retention by the kidneys in response to a low salt diet as well as other subtle defects (61;62), while Sgk3^-/- animals mostly display coat abnormalities due to defects in hair cycling and differentiation (24;63).  Considering the widespread use of these kinases in multiple tissues and processes, the relatively mild phenotypes seen in the single knockout mouse models suggests these kinases can be functionally redundant. Indeed, absence of both Akt1 and Akt2 results in neonatal lethality with respiratory failure, dwarfism, impaired skin development and adipogenesis, skeletal muscle atrophy, and delayed bone development (64). Akt1/Akt3 double knockout mice die around embryonic day 12(E12) with severe impairments in growth, cardiovascular development,and organization of the nervous system, and nonproportional hypotrophy of the thymus, heart, and skin (65). Mice lacking both Akt2 and Akt3, display a general growth defect in addition to reducedbrain size (66), while Akt2/Sgk3 double knockouts display a similar, but more severe defect in hair follicle morphogenesis relative to Sgk3^-/-mice (67). Mice lacking both Sgk1 and Sgk3 do not display more severe defects than the single knockouts, suggesting that these two kinases are not functionally redundant (62).

 

Certain in vitro activities of SGK3 are likely to have in vivo relevance. These include the ability of SGK3 to upregulate the activity of glutamate transporters, K⁺ channels, Na⁺-K⁺ ATPase and glutamate receptors, which are known to have important roles in neuronal function. Indeed, Sgk3^-/- mice exhibit behavioral defects such as reduced locomotion, disturbed navigation, and increased anxiety, which may be due to reduced activity of one or more of these membrane proteins (68). The upregulation by SGK3 of Na⁺-glucose cotransporter SGLT1 activity is also likely to have physiological relevance (22). SGTL1 allows the absorbance of intestinal glucose, and Sgk3^-/- animals exhibit decreased basal intestinal glucose transport resulting in hypoglycemia (26). SGK3 activation of the KCNE1/KCNQ1 K⁺ channel complex may also affect this process, as this channel is required for normal intestinal glucose absorption (69). However, analysis of Sgk3^-/- animals did not reveal any in vivo roles in amino acid transport in the intestine, nor any roles in the retention of salt by the kidneys as demonstrated for SGK1 (26;62). 

 

The most striking phenotype caused by mutations in the Sgk3 gene in mice is the coat abnormality caused by defects in hair follicle morphogenesis and cycling (20;24;63;70). Hair is produced and maintained by the pilosebaceous unit consisting of a hair-producing follicle and a sebaceous gland composed of many different cell types.  The hair follicle can be divided into 3 regions: the lower segment (bulb and suprabulb), the middle segment (isthmus), and the upper segment (infundibulum). Eight epithelial layers are present in the hair follicle including the outer root sheath (ORS) that is continuous with the epidermis, the companion layer (CL), the inner root sheath (IRS) consisting of three layers (Henle’s, Huxley’s and cuticle) and the hair shaft, which also consists of three layers (cuticle, cortex and medulla) (71).  The layers of the hair follicle, except the ORS, are derived from proliferative cells of the hair matrix, which is located around the opening of the dermal papilla at the base of the hair bulb.  After hair follicles are established, hair is periodically shed and then replaced, involving periodic destruction and regeneration of hair follicles.  The hair cycle is divided into periods of follicle growth (anagen), followed by regression (catagen) and rest (telogen) (72).  During catagen, the lower half of the follicle undergoes apoptosis.  During anagen, hair follicle growth is reinitiated as follicle stem cells are induced to proliferate.  A number of signaling pathways are implicated in hair follicle morphogenesis and regeneration including Sonic hedgehog (Shh), WNTs, TGF-β and BMP family members, epidermal growth factor receptor (EGFR; see the records for Velvet and wavedX), fibroblast growth factor (FGF; see the record for porcupine), IGFs, and platelet-derived frowth factor (PDGF) [reviewed in (73;74)].

 

Nine different Sgk3 alleles, including the two knockout mouse strains, have now been identified including the classical YPC and fuzzy mutants. YPC and Sgk3^fz-Mdf both result in truncation of the C-terminal domain (27;75). Other fuzzy alleles truncate the protein within the kinase domain or contain a retrotransposon insertion, while a mouse mutant known as frowzy (fy) contains in-frame deletions within the kinase domain (75). The majority of these animals exhibit similar disruptions of hair morphogenesis and cycling, including reduced cell proliferation and increased apoptosis of hair follicle cells, as well as a drastic shortening and acceleration of all phases of the hair cycle. These defects generally resulted in thin, short or curly hairs and poorly developed hair bulbs and dermal papillae. Although hair matrix cells of these mutant mice were able to differentiate into the IRS, cuticle, or cortex of the hair shaft, the medullas were absent, and the different structures of the hair displayed multiple abnormalities (20;24;27;63;70;75). 

Putative Mechanism

Unlike the nuclear corepressor Hairless and the putative transcription factor Gsdma3, which appear to be necessary for terminal differentiation of cells in skin and its appendages (see the records for prune and Michelin), the phenotypes of Sgk3 mutant mice suggest that SGK3 is a pro-survival, anti-apoptotic factor necessary for the proliferation and survival of hair follicle cells. SGK3 has been shown to regulate a number of factors that may contribute to its ability to promote cell survival including FKHRL1/FOXO3A and BAD. Both FOXOA3 and BAD are pro-apoptotic factors and phosphorylation by AGC-type kinases, including SGK3, inhibits their function by promoting binding to the 14-3-3 chaperone protein and preventing localization to the nucleus and mitochondria, respectively (5;76). The effect of SGK1 and SGK3 on cell proliferation may also be due to K⁺ channel regulation as K⁺ channel activity is important for IGF-1-induced cell proliferation (1). SGK3 has also been shown to phosphorylate and inhibit the activity of GSK3β (19). Unphosphorylated GSK3β phosphorylates and induces the degradation of such substrates as glycogen synthase in the PI3K pathway and β-catenin in WNT signaling. As WNT signaling and β-catenin play important roles in hair morphogenesis, it is possible that SGK3 may regulate this pathway by inhibiting GSK3β activity. GSK3β phosphorylation is suppressed in the hair follicles of YPC mice (20), and SGK3 (and Akt2) is able to induce transcription of a β-catenin-dependent reporter gene in cultured keratinocytes (67). In addition, a keratinocyte-specific PTEN knockout results in accelerated hair follicle morphogenesis due to an inhibition in β-catenin activity (77), which indicates that the PI3K signaling pathway positively regulates β -catenin. However, other studies indicate that β-catenin activity may be normal in Sgk3^-/- hair follicle cells, and WNT-dependent expression of keratins appears unaltered in Sgk3 mutant mice (63). The pro-survival activity of SGK3 is apparent only in hair follicle cells, which suggests that SGK3 does not play a significant role in other tissues or that its role in other tissues is functionally redundant with other AGC-type kinases. Some studies using a PDK1 mutant mouse expressing a PDK1 protein that is able to activate PKB/Akt, but not SGK kinases, suggests that both FOXOA3 and GSK3β are mainly regulated by PKB/Akt in vivo in most tissues (78). 

 

In addition to WNT signaling, SGK3 may function downstream of growth factor receptors as the phenotypes found in mice with Sgk3 mutations bear some overlap with those displayed by mice with mutations in EGFR signaling components (79). EGFR signaling is known to activate the PI3K pathway and also has been shown to result in β-catenin activation, potentially providing an explanation of the hair defects found in mice carrying mutant alleles of Sgk3. However, the evaluation of growth factor signaling in primary keratinocytes cultured from Sgk3^-/- mice, discovered normal EGF-dependent PI3K signaling. Moreover, SGK3 does not regulate the degradation or trafficking of EGFR to lysosomes as it does for CXCR4 (23). Keratinocytes lacking Sgk3 do exhibit an increased responsiveness to IGF-1, suggesting the existence of a novel feedback pathway in which SGK3 may inhibit PI3K pathway activation in response to IGF-1 (63), and the overexpression of IGF-1 in keratinocytes accelerates hair follicle formation and cycling in mice (80). 

 

The similar coat phenotypes of mice harboring mutations at the Sgk3 locus suggest that most of these mutations lead to absence of SGK3 function. However, some of the alleles do show a less severe phenotype, such as the mouse knockout described by McCormick et al, which displayed a sparse coat at younger ages and a thicker, curly coat as an adult (24). Interestingly, this group reported a prolonging of the anagen phase in this mouse, unlike the shortening of all phases of the hair cycle described for the other alleles (20;63;70). However, another knockout allele exhibited a sparse coat at all ages, similar to the phenotypes described in the spontaneous and induced alleles of Sgk3 (27;63;70;75). As neither of these knockouts contained SGK3 protein, it is possible that genetic background influences the phenotypes of these mice. Additionally, the presence of aberrant protein in the YPC mouse mutant, which displays a much more severe coat phenotype, suggests that dominant-negative protein function may also contribute to the phenotypic differences seen in these animals (20;27). The phenotypes displayed by the woolly mouse appear to be less severe, and it is possible that the woolly allele results in a protein with hypomorphic function as it is a missense allele resulting in the substitution of a cysteine for an arginine within the kinase domain. Although conserved with the other SGKs, this amino acid is not located within any of the critical kinase motifs, and is not conserved in PKB/Akt kinases. The arginine substitution may affect the overall conformation of the kinase domain.

Primers

Primers cannot be located by automatic search.

Genotyping

Woolly genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

Primers

Woolly(F): 5’- AAGGAATCGCTATTTCTGATACCACCAC -3’

Woolly(R): 5’- GGAAATGCCTGTATTAACTCATCCCCG -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

Woolly_seq(F): 5'- CACAACTTTTTGTGGTACACCAG -3'

Woolly_seq(R): 5’- GGGTGTCTATTTCTAAAACTGCC -3’

 

The following sequence of 848 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 7, bases 9,875,785 to 9,876,632) is amplified:

 

                                     aaggaa tcgctatttc tgataccacc

acaacttttt gtggtacacc agaggtaaga aatatgtctg atcattgata taatttataa

gatataaata caagtcatac cctacatcta cagaagaggt aaaataaaac ctgttagagc

tcccagcttt ctagggactt agagtgtaca gtgggtattt ttcactggtt gtgacagcct

caagacccaa ctcatttgaa aatctagata gcacttcttt agtgtgagta acagtaccta

aaatttgttc ccttttcaga tcctaaattg tgtcttgtgt tcactgggct gctgtaatgt

ttccattttt tctgtagtac cttgcacctg aagtaatcag aaaacagccc tatgacaaca

ctgtggactg gtggtgcctg ggcgctgttc tgtatgagat gctgtacggg ctggtatgtg

tttctgttcc tcattgtcca ctgcaccatt gatgacatag taattagtaa tcctgaagat

gcctaggtgg taccaacaat gccttgttaa atgagtctga aaccatttta ggaatactta

cataaagaaa ggcttcatta ctttcaaaca ccaatatgta atttcggtgt tcctttaggc

atttcttggg gcagttttag aaatagacac ccagtcacaa tgttgaactt tgttgtttcc

tttcattttg tttacatcag acatcacctg cctaatttcc gaaagatgga aataaaagag

ttttccgtta ttaacatatt gctattacgt cttagaagat gatgctttgg ggttttgcct

tccattctgt tttttcgggg atgagttaat acaggcattt cc

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References

1. Tessier, M., and Woodgett, J. R. (2006) Serum and Glucocorticoid-Regulated Protein Kinases: Variations on a Theme. J. Cell. Biochem. 98, 1391-1407.

2. Lang, F., Bohmer, C., Palmada, M., Seebohm, G., Strutz-Seebohm, N., and Vallon, V. (2006) (Patho)Physiological Significance of the Serum- and Glucocorticoid-Inducible Kinase Isoforms. Physiol. Rev. 86, 1151-1178.

3. Kobayashi, T., Deak, M., Morrice, N., and Cohen, P. (1999) Characterization of the Structure and Regulation of Two Novel Isoforms of Serum- and Glucocorticoid-Induced Protein Kinase. Biochem. J. 344 Pt 1, 189-197.

4. Dai, F., Yu, L., He, H., Zhao, Y., Yang, J., Zhang, X., and Zhao, S. (1999) Cloning and Mapping of a Novel Human serum/glucocorticoid Regulated Kinase-Like Gene, SGKL, to Chromosome 8q12.3-q13.1. Genomics. 62, 95-97.

5. Liu, D., Yang, X., and Songyang, Z. (2000) Identification of CISK, a New Member of the SGK Kinase Family that Promotes IL-3-Dependent Survival. Curr. Biol. 10, 1233-1236.

6. Boehmer, C., Rajamanickam, J., Schniepp, R., Kohler, K., Wulff, P., Kuhl, D., Palmada, M., and Lang, F. (2005) Regulation of the Excitatory Amino Acid Transporter EAAT5 by the Serum and Glucocorticoid Dependent Kinases SGK1 and SGK3. Biochem. Biophys. Res. Commun. 329, 738-742.

7. Hong, F., Larrea, M. D., Doughty, C., Kwiatkowski, D. J., Squillace, R., and Slingerland, J. M. (2008) MTOR-Raptor Binds and Activates SGK1 to Regulate p27 Phosphorylation. Mol. Cell. 30, 701-711.

8. Garcia-Martinez, J. M., and Alessi, D. R. (2008) MTOR Complex 2 (mTORC2) Controls Hydrophobic Motif Phosphorylation and Activation of Serum- and Glucocorticoid-Induced Protein Kinase 1 (SGK1). Biochem. J. 416, 375-385.

9. Biondi, R. M., Kieloch, A., Currie, R. A., Deak, M., and Alessi, D. R. (2001) The PIF-Binding Pocket in PDK1 is Essential for Activation of S6K and SGK, but Not PKB. EMBO J. 20, 4380-4390.

10. Nilsen, T., Slagsvold, T., Skjerpen, C. S., Brech, A., Stenmark, H., and Olsnes, S. (2004) Peroxisomal Targeting as a Tool for Assaying Potein-Protein Interactions in the Living Cell: Cytokine-Independent Survival Kinase (CISK) Binds PDK-1 in Vivo in a Phosphorylation-Dependent Manner. J. Biol. Chem. 279, 4794-4801.

11. Ellson, C. D., Andrews, S., Stephens, L. R., and Hawkins, P. T. (2002) The PX Domain: A New Phosphoinositide-Binding Module. J. Cell. Sci. 115, 1099-1105.

12. Virbasius, J. V., Song, X., Pomerleau, D. P., Zhan, Y., Zhou, G. W., and Czech, M. P. (2001) Activation of the Akt-Related Cytokine-Independent Survival Kinase Requires Interaction of its Phox Domain with Endosomal Phosphatidylinositol 3-Phosphate. Proc. Natl. Acad. Sci. U. S. A. 98, 12908-12913.

13. Gillooly, D. J., Raiborg, C., and Stenmark, H. (2003) Phosphatidylinositol 3-Phosphate is found in Microdomains of Early Endosomes. Histochem. Cell Biol. 120, 445-453.

14. Xu, J., Liu, D., Gill, G., and Songyang, Z. (2001) Regulation of Cytokine-Independent Survival Kinase (CISK) by the Phox Homology Domain and Phosphoinositides. J. Cell Biol. 154, 699-705.

15. Tessier, M., and Woodgett, J. R. (2006) Role of the Phox Homology Domain and Phosphorylation in Activation of Serum and Glucocorticoid-Regulated Kinase-3. J. Biol. Chem. 281, 23978-23989.

16. Xing, Y., Liu, D., Zhang, R., Joachimiak, A., Songyang, Z., and Xu, W. (2004) Structural Basis of Membrane Targeting by the Phox Homology Domain of Cytokine-Independent Survival Kinase (CISK-PX). J. Biol. Chem. 279, 30662-30669.

17. Bravo, J., Karathanassis, D., Pacold, C. M., Pacold, M. E., Ellson, C. D., Anderson, K. E., Butler, P. J., Lavenir, I., Perisic, O., Hawkins, P. T., Stephens, L., and Williams, R. L. (2001) The Crystal Structure of the PX Domain from p40(Phox) Bound to Phosphatidylinositol 3-Phosphate. Mol. Cell. 8, 829-839.

18. Kobayashi, T., and Cohen, P. (1999) Activation of Serum- and Glucocorticoid-Regulated Protein Kinase by Agonists that Activate Phosphatidylinositide 3-Kinase is Mediated by 3-Phosphoinositide-Dependent Protein Kinase-1 (PDK1) and PDK2. Biochem. J. 339 ( Pt 2), 319-328.

19. Dai, F., Yu, L., He, H., Chen, Y., Yu, J., Yang, Y., Xu, Y., Ling, W., and Zhao, S. (2002) Human Serum and Glucocorticoid-Inducible Kinase-Like Kinase (SGKL) Phosphorylates Glycogen Syntheses Kinase 3 Beta (GSK-3beta) at Serine-9 through Direct Interaction. Biochem. Biophys. Res. Commun. 293, 1191-1196.

20. Okada, T., Ishii, Y., Masujin, K., Yasoshima, A., Matsuda, J., Ogura, A., Nakayama, H., Kunieda, T., and Doi, K. (2006) The Critical Roles of serum/glucocorticoid-Regulated Kinase 3 (SGK3) in the Hair Follicle Morphogenesis and Homeostasis: The Allelic Difference Provides Novel Insights into Hair Follicle Biology. Am. J. Pathol. 168, 1119-1133.

21. Xu, J., Liao, L., Qin, J., Xu, J., Liu, D., and Songyang, Z. (2009) Identification of Flightless-I as a Substrate of the Cytokine-Independent Survival Kinase CISK. J. Biol. Chem. 284, 14377-14385.

22. Dieter, M., Palmada, M., Rajamanickam, J., Aydin, A., Busjahn, A., Boehmer, C., Luft, F. C., and Lang, F. (2004) Regulation of Glucose Transporter SGLT1 by Ubiquitin Ligase Nedd4-2 and Kinases SGK1, SGK3, and PKB. Obes. Res. 12, 862-870.

23. Slagsvold, T., Marchese, A., Brech, A., and Stenmark, H. (2006) CISK Attenuates Degradation of the Chemokine Receptor CXCR4 Via the Ubiquitin Ligase AIP4. EMBO J. 25, 3738-3749.

24. McCormick, J. A., Feng, Y., Dawson, K., Behne, M. J., Yu, B., Wang, J., Wyatt, A. W., Henke, G., Grahammer, F., Mauro, T. M., Lang, F., and Pearce, D. (2004) Targeted Disruption of the Protein Kinase SGK3/CISK Impairs Postnatal Hair Follicle Development. Mol. Biol. Cell. 15, 4278-4288.

25. Strutz-Seebohm, N., Seebohm, G., Mack, A. F., Wagner, H. J., Just, L., Skutella, T., Lang, U. E., Henke, G., Striegel, M., Hollmann, M., Rouach, N., Nicoll, R. A., McCormick, J. A., Wang, J., Pearce, D., and Lang, F. (2005) Regulation of GluR1 Abundance in Murine Hippocampal Neurones by Serum- and Glucocorticoid-Inducible Kinase 3. J. Physiol. 565, 381-390.

26. Sandu, C., Rexhepaj, R., Grahammer, F., McCormick, J. A., Henke, G., Palmada, M., Nammi, S., Lang, U., Metzger, M., Just, L., Skutella, T., Dawson, K., Wang, J., Pearce, D., and Lang, F. (2005) Decreased Intestinal Glucose Transport in the sgk3-Knockout Mouse. Pflugers Arch. 451, 437-444.

27. Masujin, K., Okada, T., Tsuji, T., Ishii, Y., Takano, K., Matsuda, J., Ogura, A., and Kunieda, T. (2004) A Mutation in the Serum and Glucocorticoid-Inducible Kinase-Like Kinase (Sgkl) Gene is Associated with Defective Hair Growth in Mice. DNA Res. 11, 371-379.

28. Trost, M., English, L., Lemieux, S., Courcelles, M., Desjardins, M., and Thibault, P. (2009) The Phagosomal Proteome in Interferon-Gamma-Activated Macrophages. Immunity. 30, 143-154.

29. Webster, M. K., Goya, L., Ge, Y., Maiyar, A. C., and Firestone, G. L. (1993) Characterization of Sgk, a Novel Member of the serine/threonine Protein Kinase Gene Family which is Transcriptionally Induced by Glucocorticoids and Serum. Mol. Cell. Biol. 13, 2031-2040.

30. Waldegger, S., Barth, P., Raber, G., and Lang, F. (1997) Cloning and Characterization of a Putative Human serine/threonine Protein Kinase Transcriptionally Modified during Anisotonic and Isotonic Alterations of Cell Volume. Proc. Natl. Acad. Sci. U. S. A. 94, 4440-4445.

31. Bell, L. M., Leong, M. L., Kim, B., Wang, E., Park, J., Hemmings, B. A., and Firestone, G. L. (2000) Hyperosmotic Stress Stimulates Promoter Activity and Regulates Cellular Utilization of the Serum- and Glucocorticoid-Inducible Protein Kinase (Sgk) by a p38 MAPK-Dependent Pathway. J. Biol. Chem. 275, 25262-25272.

32. Gonzalez-Robayna, I. J., Falender, A. E., Ochsner, S., Firestone, G. L., and Richards, J. S. (2000) Follicle-Stimulating Hormone (FSH) Stimulates Phosphorylation and Activation of Protein Kinase B (PKB/Akt) and Serum and Glucocorticoid-Lnduced Kinase (Sgk): Evidence for A Kinase-Independent Signaling by FSH in Granulosa Cells. Mol. Endocrinol. 14, 1283-1300.

33. Xu, B. E., Stippec, S., Chu, P. Y., Lazrak, A., Li, X. J., Lee, B. H., English, J. M., Ortega, B., Huang, C. L., and Cobb, M. H. (2005) WNK1 Activates SGK1 to Regulate the Epithelial Sodium Channel. Proc. Natl. Acad. Sci. U. S. A. 102, 10315-10320.

34. Pao, A. C., McCormick, J. A., Li, H., Siu, J., Govaerts, C., Bhalla, V., Soundararajan, R., and Pearce, D. (2007) NH2 Terminus of Serum and Glucocorticoid-Regulated Kinase 1 Binds to Phosphoinositides and is Essential for Isoform-Specific Physiological Functions. Am. J. Physiol. Renal Physiol. 292, F1741-50.

35. Gamper, N., Fillon, S., Feng, Y., Friedrich, B., Lang, P. A., Henke, G., Huber, S. M., Kobayashi, T., Cohen, P., and Lang, F. (2002) K+ Channel Activation by all Three Isoforms of Serum- and Glucocorticoid-Dependent Protein Kinase SGK. Pflugers Arch. 445, 60-66.

36. Palmada, M., Dieter, M., Boehmer, C., Waldegger, S., and Lang, F. (2004) Serum and Glucocorticoid Inducible Kinases Functionally Regulate ClC-2 Channels. Biochem. Biophys. Res. Commun. 321, 1001-1006.

37. Henke, G., Setiawan, I., Bohmer, C., and Lang, F. (2002) Activation of Na+/K+-ATPase by the Serum and Glucocorticoid-Dependent Kinase Isoforms. Kidney Blood Press. Res. 25, 370-374.

38. Friedrich, B., Feng, Y., Cohen, P., Risler, T., Vandewalle, A., Broer, S., Wang, J., Pearce, D., and Lang, F. (2003) The serine/threonine Kinases SGK2 and SGK3 are Potent Stimulators of the Epithelial Na+ Channel Alpha,Beta,Gamma-ENaC. Pflugers Arch. 445, 693-696.

39. Boehmer, C., Wilhelm, V., Palmada, M., Wallisch, S., Henke, G., Brinkmeier, H., Cohen, P., Pieske, B., and Lang, F. (2003) Serum and Glucocorticoid Inducible Kinases in the Regulation of the Cardiac Sodium Channel SCN5A. Cardiovasc. Res. 57, 1079-1084.

40. Maier, G., Palmada, M., Rajamanickam, J., Shumilina, E., Bohmer, C., and Lang, F. (2006) Upregulation of HERG Channels by the Serum and Glucocorticoid Inducible Kinase Isoform SGK3. Cell. Physiol. Biochem. 18, 177-186.

41. Embark, H. M., Bohmer, C., Vallon, V., Luft, F., and Lang, F. (2003) Regulation of KCNE1-Dependent K(+) Current by the Serum and Glucocorticoid-Inducible Kinase (SGK) Isoforms. Pflugers Arch. 445, 601-606.

42. Embark, H. M., Bohmer, C., Palmada, M., Rajamanickam, J., Wyatt, A. W., Wallisch, S., Capasso, G., Waldegger, P., Seyberth, H. W., Waldegger, S., and Lang, F. (2004) Regulation of CLC-Ka/barttin by the Ubiquitin Ligase Nedd4-2 and the Serum- and Glucocorticoid-Dependent Kinases. Kidney Int. 66, 1918-1925.

43. Boehmer, C., Embark, H. M., Bauer, A., Palmada, M., Yun, C. H., Weinman, E. J., Endou, H., Cohen, P., Lahme, S., Bichler, K. H., and Lang, F. (2004) Stimulation of Renal Na+ Dicarboxylate Cotransporter 1 by Na+/H+ Exchanger Regulating Factor 2, Serum and Glucocorticoid Inducible Kinase Isoforms, and Protein Kinase B. Biochem. Biophys. Res. Commun. 313, 998-1003.

44. Palmada, M., Dieter, M., Speil, A., Bohmer, C., Mack, A. F., Wagner, H. J., Klingel, K., Kandolf, R., Murer, H., Biber, J., Closs, E. I., and Lang, F. (2004) Regulation of Intestinal Phosphate Cotransporter NaPi IIb by Ubiquitin Ligase Nedd4-2 and by Serum- and Glucocorticoid-Dependent Kinase 1. Am. J. Physiol. Gastrointest. Liver Physiol. 287, G143-50.

45. Bohmer, C., Palmada, M., Kenngott, C., Lindner, R., Klaus, F., Laufer, J., and Lang, F. (2007) Regulation of the Epithelial Calcium Channel TRPV6 by the Serum and Glucocorticoid-Inducible Kinase Isoforms SGK1 and SGK3. FEBS Lett. 581, 5586-5590.

46. Strutz-Seebohm, N., Seebohm, G., Shumilina, E., Mack, A. F., Wagner, H. J., Lampert, A., Grahammer, F., Henke, G., Just, L., Skutella, T., Hollmann, M., and Lang, F. (2005) Glucocorticoid Adrenal Steroids and Glucocorticoid-Inducible Kinase Isoforms in the Regulation of GluR6 Expression. J. Physiol. 565, 391-401.

47. Palmada, M., Speil, A., Jeyaraj, S., Bohmer, C., and Lang, F. (2005) The serine/threonine Kinases SGK1, 3 and PKB Stimulate the Amino Acid Transporter ASCT2. Biochem. Biophys. Res. Commun. 331, 272-277.

48. Boehmer, C., Okur, F., Setiawan, I., Broer, S., and Lang, F. (2003) Properties and Regulation of Glutamine Transporter SN1 by Protein Kinases SGK and PKB. Biochem. Biophys. Res. Commun. 306, 156-162.

49. Boehmer, C., Palmada, M., Rajamanickam, J., Schniepp, R., Amara, S., and Lang, F. (2006) Post-Translational Regulation of EAAT2 Function by Co-Expressed Ubiquitin Ligase Nedd4-2 is Impacted by SGK Kinases. J. Neurochem. 97, 911-921.

50. Boehmer, C., Henke, G., Schniepp, R., Palmada, M., Rothstein, J. D., Broer, S., and Lang, F. (2003) Regulation of the Glutamate Transporter EAAT1 by the Ubiquitin Ligase Nedd4-2 and the Serum and Glucocorticoid-Inducible Kinase Isoforms SGK1/3 and Protein Kinase B. J. Neurochem. 86, 1181-1188.

51. Bohmer, C., Philippin, M., Rajamanickam, J., Mack, A., Broer, S., Palmada, M., and Lang, F. (2004) Stimulation of the EAAT4 Glutamate Transporter by SGK Protein Kinase Isoforms and PKB. Biochem. Biophys. Res. Commun. 324, 1242-1248.

52. Boehmer, C., Rajamanickam, J., Schniepp, R., Kohler, K., Wulff, P., Kuhl, D., Palmada, M., and Lang, F. (2005) Regulation of the Excitatory Amino Acid Transporter EAAT5 by the Serum and Glucocorticoid Dependent Kinases SGK1 and SGK3. Biochem. Biophys. Res. Commun. 329, 738-742.

53. Klaus, F., Palmada, M., Lindner, R., Laufer, J., Jeyaraj, S., Lang, F., and Boehmer, C. (2008) Up-Regulation of Hypertonicity-Activated Myo-Inositol Transporter SMIT1 by the Cell Volume-Sensitive Protein Kinase SGK1. J. Physiol. 586, 1539-1547.

54. Shojaiefard, M., Christie, D. L., and Lang, F. (2005) Stimulation of the Creatine Transporter SLC6A8 by the Protein Kinases SGK1 and SGK3. Biochem. Biophys. Res. Commun. 334, 742-746.

55. Bhalla, V., Daidie, D., Li, H., Pao, A. C., LaGrange, L. P., Wang, J., Vandewalle, A., Stockand, J. D., Staub, O., and Pearce, D. (2005) Serum- and Glucocorticoid-Regulated Kinase 1 Regulates Ubiquitin Ligase Neural Precursor Cell-Expressed, Developmentally Down-Regulated Protein 4-2 by Inducing Interaction with 14-3-3. Mol. Endocrinol. 19, 3073-3084.

56. Chen, W. S., Xu, P. Z., Gottlob, K., Chen, M. L., Sokol, K., Shiyanova, T., Roninson, I., Weng, W., Suzuki, R., Tobe, K., Kadowaki, T., and Hay, N. (2001) Growth Retardation and Increased Apoptosis in Mice with Homozygous Disruption of the Akt1 Gene. Genes Dev. 15, 2203-2208.

57. Cho, H., Thorvaldsen, J. L., Chu, Q., Feng, F., and Birnbaum, M. J. (2001) Akt1/PKBalpha is Required for Normal Growth but Dispensable for Maintenance of Glucose Homeostasis in Mice. J. Biol. Chem. 276, 38349-38352.

58. Di-Poi, N., Ng, C. Y., Tan, N. S., Yang, Z., Hemmings, B. A., Desvergne, B., Michalik, L., and Wahli, W. (2005) Epithelium-Mesenchyme Interactions Control the Activity of Peroxisome Proliferator-Activated Receptor beta/delta during Hair Follicle Development. Mol. Cell. Biol. 25, 1696-1712.

59. Cho, H., Mu, J., Kim, J. K., Thorvaldsen, J. L., Chu, Q., Crenshaw, E. B.,3rd, Kaestner, K. H., Bartolomei, M. S., Shulman, G. I., and Birnbaum, M. J. (2001) Insulin Resistance and a Diabetes Mellitus-Like Syndrome in Mice Lacking the Protein Kinase Akt2 (PKB Beta). Science. 292, 1728-1731.

60. Easton, R. M., Cho, H., Roovers, K., Shineman, D. W., Mizrahi, M., Forman, M. S., Lee, V. M., Szabolcs, M., de Jong, R., Oltersdorf, T., Ludwig, T., Efstratiadis, A., and Birnbaum, M. J. (2005) Role for Akt3/protein Kinase Bgamma in Attainment of Normal Brain Size. Mol. Cell. Biol. 25, 1869-1878.

61. Wulff, P., Vallon, V., Huang, D. Y., Volkl, H., Yu, F., Richter, K., Jansen, M., Schlunz, M., Klingel, K., Loffing, J., Kauselmann, G., Bosl, M. R., Lang, F., and Kuhl, D. (2002) Impaired Renal Na(+) Retention in the sgk1-Knockout Mouse. J. Clin. Invest. 110, 1263-1268.

62. Grahammer, F., Artunc, F., Sandulache, D., Rexhepaj, R., Friedrich, B., Risler, T., McCormick, J. A., Dawson, K., Wang, J., Pearce, D., Wulff, P., Kuhl, D., and Lang, F. (2006) Renal Function of Gene-Targeted Mice Lacking both SGK1 and SGK3. Am. J. Physiol. Regul. Integr. Comp. Physiol. 290, R945-50.

63. Alonso, L., Okada, H., Pasolli, H. A., Wakeham, A., You-Ten, A. I., Mak, T. W., and Fuchs, E. (2005) Sgk3 Links Growth Factor Signaling to Maintenance of Progenitor Cells in the Hair Follicle. J. Cell Biol. 170, 559-570.

64. Peng, X. D., Xu, P. Z., Chen, M. L., Hahn-Windgassen, A., Skeen, J., Jacobs, J., Sundararajan, D., Chen, W. S., Crawford, S. E., Coleman, K. G., and Hay, N. (2003) Dwarfism, Impaired Skin Development, Skeletal Muscle Atrophy, Delayed Bone Development, and Impeded Adipogenesis in Mice Lacking Akt1 and Akt2. Genes Dev. 17, 1352-1365.

65. Yang, Z. Z., Tschopp, O., Di-Poi, N., Bruder, E., Baudry, A., Dummler, B., Wahli, W., and Hemmings, B. A. (2005) Dosage-Dependent Effects of Akt1/protein Kinase Balpha (PKBalpha) and Akt3/PKBgamma on Thymus, Skin, and Cardiovascular and Nervous System Development in Mice. Mol. Cell. Biol. 25, 10407-10418.

66. Dummler, B., Tschopp, O., Hynx, D., Yang, Z. Z., Dirnhofer, S., and Hemmings, B. A. (2006) Life with a Single Isoform of Akt: Mice Lacking Akt2 and Akt3 are Viable but Display Impaired Glucose Homeostasis and Growth Deficiencies. Mol. Cell. Biol. 26, 8042-8051.

67. Mauro, T. M., McCormick, J. A., Wang, J., Boini, K. M., Ray, L., Monks, B., Birnbaum, M. J., Lang, F., and Pearce, D. (2009) Akt2 and SGK3 are both Determinants of Postnatal Hair Follicle Development. FASEB J. 23, 3193-3202.

68. Lang, U. E., Wolfer, D. P., Grahammer, F., Strutz-Seebohm, N., Seebohm, G., Lipp, H. P., McCormick, J. A., Hellweg, R., Dawson, K., Wang, J., Pearce, D., and Lang, F. (2006) Reduced Locomotion in the Serum and Glucocorticoid Inducible Kinase 3 Knock Out Mouse. Behav. Brain Res. 167, 75-86.

69. Vallon, V., Grahammer, F., Volkl, H., Sandu, C. D., Richter, K., Rexhepaj, R., Gerlach, U., Rong, Q., Pfeifer, K., and Lang, F. (2005) KCNQ1-Dependent Transport in Renal and Gastrointestinal Epithelia. Proc. Natl. Acad. Sci. U. S. A. 102, 17864-17869.

70. Mecklenburg, L., Tobin, D. J., Cirlan, M. V., Craciun, C., and Paus, R. (2005) Premature Termination of Hair Follicle Morphogenesis and Accelerated Hair Follicle Cycling in Iasi Congenital Atrichia (Fzica) Mice Points to Fuzzy as a Key Element of Hair Cycle Control. Exp. Dermatol. 14, 561-570.

71. Ito, M., Tazawa, T., Shimizu, N., Ito, K., Katsuumi, K., Sato, Y., and Hashimoto, K. (1986) Cell differentiation in human anagen hair and hair follicles studied with anti-hair keratin monoclonal antibodies, J. Invest Dermatol. 86, 563-569.

72. Muller-Rover, S., Handjiski, B., van, d., V, Eichmuller, S., Foitzik, K., McKay, I. A., Stenn, K. S., and Paus, R. (2001) A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages, J. Invest Dermatol. 117, 3-15.

73. Botchkarev, V. A., and Paus, R. (2003) Molecular Biology of Hair Morphogenesis: Development and Cycling. J. Exp. Zoolog B. Mol. Dev. Evol. 298, 164-180.

74. Fuchs, E. (2007) Scratching the surface of skin development, Nature 445, 834-842.

75. Campagna, D. R., Custodio, A. O., Antiochos, B. B., Cirlan, M. V., and Fleming, M. D. (2008) Mutations in the serum/glucocorticoid Regulated Kinase 3 (Sgk3) are Responsible for the Mouse Fuzzy (Fz) Hair Phenotype. J. Invest. Dermatol. 128, 730-732.

76. Lizcano, J. M., Morrice, N., and Cohen, P. (2000) Regulation of BAD by cAMP-Dependent Protein Kinase is Mediated Via Phosphorylation of a Novel Site, Ser155. Biochem. J. 349, 547-557.

77. Suzuki, A., Itami, S., Ohishi, M., Hamada, K., Inoue, T., Komazawa, N., Senoo, H., Sasaki, T., Takeda, J., Manabe, M., Mak, T. W., and Nakano, T. (2003) Keratinocyte-Specific Pten Deficiency Results in Epidermal Hyperplasia, Accelerated Hair Follicle Morphogenesis and Tumor Formation. Cancer Res. 63, 674-681.

78. Collins, B. J., Deak, M., Arthur, J. S., Armit, L. J., and Alessi, D. R. (2003) In Vivo Role of the PIF-Binding Docking Site of PDK1 Defined by Knock-in Mutation. EMBO J. 22, 4202-4211.

79. Sibilia, M., and Wagner, E. F. (1995) Strain-Dependent Epithelial Defects in Mice Lacking the EGF Receptor. Science. 269, 234-238.

80. Semenova, E., Koegel, H., Hasse, S., Klatte, J. E., Slonimsky, E., Bilbao, D., Paus, R., Werner, S., and Rosenthal, N. (2008) Overexpression of mIGF-1 in Keratinocytes Improves Wound Healing and Accelerates Hair Follicle Formation and Cycling in Mice. Am. J. Pathol. 173, 1295-1310.