Phenotypic Mutation 'honey' (pdf version)
Allelehoney
Mutation Type missense
Chromosome13
Coordinate30,751,751 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Irf4
Gene Name interferon regulatory factor 4
Synonym(s) IRF-4, Spip
Chromosomal Location 30,749,226-30,766,927 bp (+)
MGI Phenotype Mice homozygous for disruptions in this gene display immune system abnormalities involving development of both T and B cells and affecting susceptibility to both bacterial and viral infections.
Accession Number

NCBI RefSeq: NM_013674; MGI: 1096873

Mapped Yes 
Amino Acid Change Arginine changed to Serine
Institutional SourceBeutler Lab
Ref Sequences
R96S in Ensembl: ENSMUSP00000021784 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
IRF 17 130 6.96e-64 SMART
Pfam:IRF-3 249 418 4.7e-58 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000021784)
Phenotypic Category T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance 100% 
Alleles Listed at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(1) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Irf4 APN 13 30751784 missense possibly damaging 0.89
IGL01154:Irf4 APN 13 30757421 missense probably damaging 1.00
IGL01669:Irf4 APN 13 30757471 missense probably damaging 1.00
IGL02729:Irf4 APN 13 30753591 splice site 0.00
IGL03197:Irf4 APN 13 30763520 splice site 0.00
Honey2 UTSW 13 30761490 splice donor site probably benign
R1300:Irf4 UTSW 13 30757585 missense possibly damaging 0.95
R1474:Irf4 UTSW 13 30757437 synonymous probably null
R1656:Irf4 UTSW 13 30757502 missense probably benign 0.00
R1914:Irf4 UTSW 13 30761462 missense probably benign 0.00
R1915:Irf4 UTSW 13 30761462 missense probably benign 0.00
R3889:Irf4 UTSW 13 30761490 splice site probably benign
R4648:Irf4 UTSW 13 30763597 missense probably benign 0.00
R5553:Irf4 UTSW 13 30751828 missense probably damaging 1.00
R5913:Irf4 UTSW 13 30757758 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 032881-MU
Last Updated 03/28/2017 4:08 PM by Katherine Timer
Record Created 11/10/2009 12:00 AM
Record Posted 06/16/2010
Other Mutations in This Stock Stock #: D4216 Run Code: SLD00204
Coding Region Coverage: 1x: 58.2% 3x: 22.7%
Validation Efficiency: 27/40

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
Fbxo33 A to T 12: 59,206,050 V221E probably benign Het
Gm626 T to A 14: 33,552,057 F1047L possibly damaging Homo
Kcnrg T to G 14: 61,611,793 Y234* probably null Homo
Mrgpra6 T to A 7: 47,188,756 L200F probably benign Het
Naca T to C 10: 128,044,240 S1714P possibly damaging Homo
Rapgef6 T to C 11: 54,668,746 probably benign Homo
Ric8b T to C 10: 85,015,141 L546P possibly damaging Het
Slc34a2 A to G 5: 53,065,497 T310A probably benign Homo
Ssc5d C to T 7: 4,943,983 T1112I possibly damaging Homo
Stau1 A to G 2: 166,949,750 V489A probably benign Homo
Phenotypic Description
The honey mutation was discovered while screening N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice for aberrant T-dependent and T-independent B cell responses. The index mouse mounted no detectable T-independent immunoglobin M (IgM) response to haptenated ficoll or T-dependent IgG response to model antigens encoded by a recombinant suicide vector based on the Semliki Forest Virus (rSFV). Flow cytometric analysis of blood from this mouse showed normal frequencies of transitional and mature follicular B cells and cluster of differentiation (CD) 4+ T cells (Figure 1).  
Nature of Mutation
The Irf4 gene was directly sequenced as a candidate gene and an A to T transversion was found at position 358 of the Irf4 transcript in exon 3 of 9 using Genbank record NM_013674 (Figure 2).
 
341 CCTACTTGGAAGACAAGATTACGATGTGCTCTG
91  -P--T--W--K--T--R--L--R--C--A--L-
 
The mutated nucleotide is indicated in red lettering, and causes an arginine to serine substitution at residue 96 of the IRF4 protein.
Protein Prediction
In mouse and human, the Irf4 gene encodes one of nine members of the interferon regulatory factor (IRF) family of transcription factors, which regulate the transcription of type I interferons (IFN-α/β) and IFN-inducible genes during immune system development, homeostasis and activation by microbes [reviewed by (1;2)]. Mouse IRF4 contains 450 amino acids and displays 92% sequence identity to its human homologue (3-6). An additional IRF, IRF10, has been identified in chickens (7), and several viral homologs have also been described (8). Amongst all IRF family members, IRF4 is most similar to IRF8 (see the record for Gemini(1;2)
 
Figure 3. Domain structure of the IRF4 protein. DBD = DNA binding domain; PRD = Proline-rich domain; IAD1=IRF association domain.The honey mutation causes an arginine to serine substitution at residue 96.
As in the other IRFs, the N-terminal half of IRF4 (residues 20-137) serves as the DNA binding region (9), and is characterized by the presence of five highly conserved tryptophans (residues 27, 42, 54, 74 and 93) each separated by 10-18 amino acids (Figure 3) (4). The DNA binding region bears similarity to that of the c-Myb oncoprotein that also contains a tryptophan cluster (10), but not to any other transcription factor classes.  IRF family proteins share sequence and structural homology in their DNA binding regions, and all bind to a similar DNA motif (A/G NGAAANNGAAACT) called the IFN-stimulated response element (ISRE) (11) or IFN regulatory element (12) that is present in the regulatory regions of interferons and interferon-stimulated genes (ISGs). By itself, IRF4 only possesses weak DNA binding affinity (9), but can function as both a transcriptional activator and repressor depending upon the specific promoter and binding partner. These binding partners include the ETS (E26-transformation specific) family members PU.1 or Spi-B, E2A, nuclear factor of activate T cells (NFAT), forkhead box protein 3 (Foxp3; see the record for crusty), signal transducer and activator of transcription 6 (STAT6), the Krüppel zinc finger transcriptional repressor BCL6, as well as other IRF proteins (3;13-19). Through its DNA binding domain, IRF4 can antagonize transactivation of certain target genes by IRF1 (see the record for Endeka) possibly by preventing IRF1 from binding to the promoters of these genes (20)
 
Crystal structure analyses of IRF DBDs suggest that they comprise a four-stranded antiparallel β-sheet (β1-β4), three helices (α1-α3), and three long loops (L1-L3) connecting β2 to α2, α2 to α3, and β3 to β4, respectively (21-25). IRF DBDs bind to DNA over a 12 base pair (bp) stretch with protein-DNA contacts in the major and minor grooves determining specificity.  Crystallization of the DNA binding domains of PU.1 and IRF4 in complex with DNA suggests that the DNA in the complex contorts into an S shape in order to juxtapose PU.1 and IRF4 and allow electrostatic and hydrophobic interactions across the central minor groove. The IRF4 and PU.1 DBDs bind to opposite faces of the DNA in a head-to-tail orientation. Loop L3 of the IRF4 DBD is actually a short 310 helix. The PU.1 α3 recognition helix lies in the major groove perpendicular to the DNA axis, while the IRF4 α3 recognition helix is tilted in the major groove with its axis almost parallel to the DNA backbone. IRF4 interacts with PU.1 in this complex with Asp 117, Leu 116, Val 111 and His 56, residues that are all conserved in IRF8, but not in other IRF members. Mutation of these residues reduces ternary complex formation.  Amino acids in the IRF4 DBD contacting the DNA include Trp 54, Ala 57, Arg 64, Lys 94, Thr 95, Asn 102 and Lys 123.  His 56, which also interacts with PU.1, specifies adenines found commonly upstream of the IRF GAAA core sequence.  The outer three base pairs of the IRF core (GAAA) are recognized by Arg 98 and Cys 99.  Lys 103 at the end of the recognition helix is also important for DNA recognition (23).
 
Figure 4. DNA binding domain of IRF. β-strands and α-helices are labeled and shown in teal and pink, respectively. The long loops are also labeled. The honey mutation is highlighted in α3. UCSF Chimera structure is based on PDB 2IRF. Click on the image to view the structure rotate.
The C-terminal halves of all IRF family members contain either an IRF association domain 1 (IAD1) or an IAD2, with which they bind to other IRFs, other transcription factors, or self-associate. These interactions allow the IRFs to modulate their activity and target a variety of genes. The IAD1 is approximately 177 amino acids in length, and is conserved in all IRFs except IRF1 and IRF2. IAD2 domains are found only in IRF1 and IRF2 (26-28). By homology, the mouse IRF4 IAD1 domain occurs at amino acids 245-412 (28), and along with the DBD is necessary for interactions with other IRFs, PU.1 and other transcription factors (13). Mutation of Leu 368 in this domain was sufficient to ablate the interaction of IRF4 with PU.1 (28). Structural studies of IRF3 and IRF5 demonstrated that the IAD forms a β-sandwich core flanked by N- and C-terminal α-helical regions (29-31).  These α-helical regions can block access to the IAD and serve an autoinhibitory function, and the C-terminal region of IRF4 from amino acids 138-450 is able to inhibit IRF4 DNA binding (13). In addition to transcription factors, IRF4 interacts with other proteins through its IAD domain including the guanine nucleotide exchange factor (GEF) IBP (IRF4 Binding Protein) (32), and the toll like receptor (TLR) adaptor myeloid differentiation (MyD) 88 (see the records for pococurante and lackadaisical) (33).
 
IRF4 also contains an activation domain located within amino acids 150-450. Two regions within this sequence may serve as the potential activation domain: a proline-rich segment (amino acids 151-237) and a carboxy-terminal region (amino acids 354-419) containing 15% glutamine residues (13). A conserved bipartite nuclear retention signal is located within amino acids 50-100 of the DBD. Mutations of clustered basic residues within this sequence (amino acids 78, 80, 82 or 94, 96, 98) disrupted the nuclear localization of IRF4 (34).
 
A second isoform of IRF4 has been identified in both human and mouse. This isoform contains an extra glutamine residue at position 164 and occurs by alternative splicing at the intron 4 acceptor site (4;6).
 
The honey mutation results in an arginine to serine substitution at position 96 of IRF4 in the α3 helix of the DBD (Figure 4). IRF4 expression and localization have not been examined in homozygous honey mice.
Expression/Localization
In both mouse and human, the expression of IRF4 is mostly restricted to cells of the immune system including B cells, T cells, macrophages and dendritic cell (DC) subsets (3-6;19;35-38). IRF4 is found at all stages of B cell development in the mouse (4;13) and is expressed in mature and activated T cells (4-6).  IRF4 is detected in all CD4+ T cell subsets including T helper (Th) and regulatory T (Treg) cells (17;39), but differences in its expression pattern in these subsets have been reported.  During in vitro differentiation of CD4+ T cells into T helper cells (Th1, Th2 and Th17), Irf4 mRNA is strongly expressed initially in all these subsets, but remains preferentially expressed by Th2 cells (39;40). IRF4 is highly expressed in CD8α-CD4- double negative (DN) and CD4+ conventional DCs (cDCs), expressed at lower levels in plasmacytoid DCs (pDCs), and is not present in CD8α+ DCs (see Background). This expression pattern contrasts to the high levels of IRF8 found in CD8α+ DCs and pDCs (36;37).  During human monocyte differentiation to macrophages or myeloid DCs, Irf4 mRNA is specifically upregulated during DC differentiation (41). In immune cells, IRF4 localizes mainly to the nucleus, but is also present in the cytoplasm (13;33). Nuclear localization can be induced under certain conditions (35).
 
Although generally constitutive, Irf4 mRNA is induced upon T cell receptor (TCR) activation in T cells (4-6), B cell receptor (BCR) stimulation, and interleukin-4 (IL-4) and CD40 co-stimulation in B cells (4;18), and TLR stimulation in macrophages (33). In human NK and T cells, the macrophage-derived cytokines IFN-α and IL-12 strongly upregulated IRF4 mRNA and protein expression (40).  A number of transcription factors are implicated in directly regulating Irf4 gene transcription downstream of these signaling pathways. These include nuclear factor (NF)-κB family members (see the record for xander(42;43), the Treg master regulator Foxp3 (17), and NFAT (4;43;44). The Irf4 promoter also contains IFN-γ-activated sequence (GAS) elements, which can be bound by STAT proteins (see the records for domino and poison) (40). Interestingly, many of these factors can also physically interact with IRF4 to regulate the transcription of downstream genes (see Protein Prediction).    
 
In addition to immune cells, IRF4 protein is found in the mouse lens (45), while mRNA expression has been reported in human melanocytes and newborn mouse skin (6). IRF4 has also been reported to be highly expressed in lymphoid malignancies in humans. IRF4 mRNA is induced upon human T cell leukemia virus type I (HTLV-I) infection (5;43;44), and IRF4 is overexpressed in some multiple myelomas (46).
Background
Figure 5. Regulation of cell development by IRF4. Markers are noted in green. The stages influenced by IRF4 (orange) are shaded purple. Please note, IRF4 supports plasmacytoid DC development, but to a lesser extent than IRF8.
IRF4 was independently identified by several groups under several different contexts: (i) as the PU.1-interacting partner (Pip), which binds to a murine immunoglobulin (Ig) light chain enhancer (3); (ii) lymphocyte-specific IRF (LSIRF) (4); and (iii) the interferon consensus sequence binding protein for activated T cells (ICSAT), a factor that was able to bind ISREs and thereby repress IFN-stimulated gene transcription (5). The generation of Irf4 knockout mice provided further insights into the roles of this protein in vivo (47). Initially, IRF4-deficient animals displayed normal lymphocyte levels, but developed generalized lymphadenopathy with expansion of both T and B lymphocytes after four to five weeks. These animals also failed to develop germinal centers (GCs) in B cell follicles or plasma cells after immunization, had poor T and B cell proliferative responses after stimulation with most mitogens, and lacked production of all serum Ig subclasses after immunization with T cell-dependent or -independent antigens. Furthermore, these mice were unable to mount an effective anti-viral response to lymphocyticchoriomeningitis virus suggesting severe immunodeficiency. A block at a late stage of peripheral B cell maturation was discovered in these animals. These results suggest that IRF4 is essential for mature B and T cell function.
 
Interestingly, IRF4 has now been found to act in concert with IRF8 during B cell differentiation [reviewed by (1;2)] (Figure 5). The development of B cells in the bone marrow is characterized by the differential expression of marker proteins such as CD45 (B220) (see the record for belittle) and CD43, and sequential recombination of Ig gene loci [reviewed in (48)]. Pro-B cells rearrange their immunoglobulin heavy (IgH) chains in a process known as VDJ recombination, which is mediated by the RAG1 (recombination activating gene 1)-RAG2 complex (see the record for maladaptive). Successful VDJ recombination gives rise to the Igμ chain, two of which combine with the surrogate light chains (SLCs), λ-5 and Vpre5, and the signaling subunits Igα and Igβ to form a pre-BCR complex initiating proliferation and further differentiation in pre-B cells. Subsequent rearrangement of the immunologlobin light (IgL) chain forms the BCR (or surface IgM) characteristic of immature B cells. During B cell development, both IRF4 and 8 are expressed in pre-B cells (49), and there is a redundant role for these factors in promoting the transition from pre-B cells to IgM+ B cells. B cells from Irf4-/-Irf8-/- double knockout mice arrest at the cycling pre-B stage (50), and either IRF4 or IRF8 expression can rescue this defect (51). IRF4 and IRF8 induce Ig light chain gene transcription and rearrangement, and also inhibit the expression of pre-BCR components (50-53). These double knockout cells are also hyperproliferative, suggesting that IRF4 and 8 are critical for limiting pre-B cell expansion, which is also necessary for further B cell differentiation (50;52;54). IRF4 attenuates IL-7 signaling, which is essential for pre-B cell proliferation and survival (52). Although IRF4 and 8 function redundantly to control pre-B cell development, IRF4 is the only IRF factor required for receptor editing, which is used by B cells to revise antigen receptors and maintain self-tolerance. Expression of IRF4 is induced by self-antigen in immature B cells leading to secondary immunoglobulin gene rearrangements. These secondary rearrangements are defective in IRF4-deficient mice (55).
 
The severe reduction in serum immunoglobulin and lack of GCs observed in IRF4-deficient mice (47) is due to the critical role IRF4 plays in isotype switching and plasma cell differentiation (56;57). Using mice with conditional or conventional deletion of Irf4 alleles, these studies showed that class switch recombination and plasma cell differentiation from centrocytes or memory B cells require IRF4. Both studies also showed that IRF4 is indispensable for Aicda gene induction, which encodes the activation-induced cytidine deaminase (AID) required for somatic hypermutation and class switch recombination. IRF4 may also directly induce the Prdm1 gene, which encodes the master regulator of plasma cell differentiation Blimp-1 (56). IRF4 expression is upregulated by CD40 stimulation of immature cells in the GC through activation of the NF-κB pathway, leading to downregulation of the BCL6 repressor and terminal differentiation to post-GC lymphocytes (58)
 
Dendritic cells (DCs) are professional antigen-presenting cells that link the innate and adaptive immune systems. DCs are able to sense pathogens and upregulate the expression of major histocompatibility complex (MHC) II and co-stimulatory molecules on their cell surface as well as secrete different cytokines. They also process and present antigenic peptides on MHC molecules to T cells, eliciting Th responses or inducing tolerance. DCs can regulate other immune cells, including B and natural killer (NK) cells, and are composed of distinct subsets that are classified according to phenotypic markers, functional features, localization and lineage [reviewed by (59)]. In the mouse, two major subsets of DCs have been identified based on the levels of the cell surface integrin subunit CD11c or the receptor protein tyrosine phosphatase CD45, CD11chighCD45- myeloid-derived conventional DCs (cDCs) and CD11clowCD45+ lymphoid-derived plasmacytoid DCs (pDCs). Conventional DCs can be further distinguished by expression levels of CD8α, CD4 and CD11b. The spleen contains three cDC subsets: CD4+CD8α-CD11bhigh, CD4-CD8α+CD11blow and CD4-CD8α-CD11bhigh double negative (DN) DCs. The thymus is missing the CD4+CD8α- DCs. Lymph nodes contain two additional DC subsets that are derived from epidermal DCs (Langerhans cells) and interstitial DCs. In humans, two major blood-derived DC subsets are characterized as CD11c+ myeloid DCs (mDCs) and pDCs, but the markers used to distinguish these cells are generally not conserved in mouse DC subsets. In both mouse and human, pDCs are the major source of type I IFNs produced in response to infection [reviewed by (60)]. In vitro, several growth factors are capable of stimulating DC differentiation in a subset-specific manner. Granulocyte macrophage colony-stumulating factor (GM-CSF) supports the generation of CD11b+ cDCs from bone marrow (BM), while fms-like tyrosine kinase 3 ligand (Flt3L) can expand both CD11b+ cDCsand pDCs (60-63). Analysis of DC subsets in mice lacking IRF4 and IRF8 suggests that the pattern of expression of these IRFs in DC subsets strictly correlates with their requirement for DC development. Thus, IRF4, but not IRF8, is necessary for CD4+ DC differentiation, both IRFs support the development of DN DCs, and IRF8 is important for both CD8α+, pDC, Langerhans and interstitial DC differentiation (36;37;64). IRF4 also supports pDC development, but to a lesser extent (37). Furthermore, IRF4 was shown to be important for GM-CSF-mediated DC differentiation, while Flt3L-dependent development required IRF8 (36;37).
 
Although generally important in activated T cells (47), IRF4 has also been shown to play a role in the differentiation of specific subsets of CD4+ T cells including Th2, Th17 and Tregs [reviewed by (65)]. CD4+ T cells can differentiate into the T helper cell subsets Th1, Th2, Th3, Th17 and follicular helper (TFH) cells (please see the record for sanroque), as well as immune-suppressive Tregs. Th cells are involved in activating and directing other immune cells, and do so by producing cytokines that are specific to each subset. Th1 cells produce IFN-γ and tumor necrosis factor β (TNF-β) and are important in stimulating macrophages and cytotoxic CD8+ T cells, whereas Th2 cells produce IL-4,-5,-6,-10 and -13 and stimulate B cells. Th17 cells produce IL-17 and IL-21 and play an important role in the development of autoimmune diseases like rheumatoid arthritis, as well as being critical in the clearance of fungal and extracellular bacterial infections. The differentiation of CD4+ T cells into various Th subtypes depends on the environment encountered by the naïve Th cell [reviewed by (65)]. Irf4-/- T cells do not undergo Th2 differentiation in vitro and cannot produce IL-4 or other Th2 cytokines, and fail to express GATA3, a transcription factor critical for Th2 development (66;67). At the molecular level, IRF4 in association with NFAT activates the IL-4 promoter (16;68). Production of this cytokine further promotes Th2 differentiation. IRF4 also interacts with BCL6 and BCL6 deficiency in T cells promotes Th2 differentiation, suggesting that BCL6 may negatively regulate IRF4 function in T cells as it does in B cells (18)In vivo, Irf4-/-mice are partially susceptible to the intracellular pathogen Leishmania major due to these defects in Th2 differentiation (66;67). Some of these effects may be partially extrinsic as CD4+ DCs are thought to stimulate Th2 responses. Interestingly, IRF4 has been shown to have differential effects on naïve CD4+ T cells versus effector/memory CD4+ T cells by promoting Th2 development in the latter, while inhibiting Th2 cytokine production in the former (69). This latter finding is consistent with the role of IRF4 in Tregs and the negative regulation of Th2 differentiation in these cells (17). In Tregs, Foxp3 upregulates IRF4 expression and then interacts with IRF4 to modulate the expression of certain IRF4 target genes that are important for Th2 differentiation, thus suppressing the Th2 response. Conditional knockout mice in which Irf4 was specifically ablated in Tregs displayed a selective dysregulation of Th2 responses and an increase in the numbers of Th2 cells leading to autoimmune disease.  Interestingly, the complete Irf4-/-knockout mice are actually resistant to the development of autoimmune diseases due to the inability of Irf4-/- naïve T helper cells to differentiate into Th17 cells (39)Irf4-/- cells express less RORγt (see the record for 4-limb clasper), a factor necessary for Th17 differentiation, as well as more Foxp3. Furthermore, IRF4 directly induces Il17 and Il21, a function that is inhibited by its binding partner, IBP.  IBP-deficient mice develop a rheumatoid arthritis-like disease (70). Collectively, these results suggest that IRF4 is important in modulating autoimmune responses.
 
Figure 6. IRF4 binds to the TLR adaptor MyD88. The same region of MyD88 binds to IRF5, which was shown to play a positive role in the production of proinflammatory cytokines downstream of TLR stimulation. However, the interaction of IRF4 to MyD88 negatively regulates TLR signaling suggesting that IRF4 competes with and prevents IRF5 from binding to this molecule.
As mentioned above (Protein Prediction), IRF4 binds to the TLR adaptor MyD88 (Figure 6). Interestingly, the same region of MyD88 binds to IRF5, which was shown to play a positive role in the production of proinflammatory cytokines downstream of TLR stimulation (71). By contrast, the interaction of IRF4 to MyD88 negatively regulates TLR signaling suggesting that IRF4 competes with and prevents IRF5 from binding to this molecule (33)Irf4-/-cells display enhanced TLR-induced cytokine production, while Irf4-/- mice are highly sensitive to endotoxin shock induced by TLR-binding ligands (33;72).  IRF4 does not inhibit IRF7 from binding to MyD88 (see the record for inept), an interaction that is essential for robust MyD88-dependent type I IFN gene induction downstream of TLR7 and TLR9 in pDCs (73;74)
 
As discussed above, IRF4 appears to be expressed in several types of lymphoid malignancies including T cell leukemias and multiple myeloma (OMIM 254500). Translocations involving the IRF4 gene occur in a subset of peripheral T cell lymphomas (75), and some cases of multiple myeloma contain a chromosomal translocation that juxtaposes the immunoglobulin heavy-chain locus to the Irf4 gene resulting in IRF overexpression (46). IRF4 mRNA expression is a prognostic marker for poor survival in these patients (76), and IRF4 is required for the survival of multiple myeloma cell lines (77). However, the overexpression of IRF4 in lymphocytes is not sufficient to induce these malignancies in transgenic mice (78). Conversely, lower expression of IRF4 is associated with an increased risk of developing chronic lymphocytic leukemia (CLL; OMIM 151400), and a SNP located in the 3-prime untranslated region of the IRF4 gene was found to strongly associate with CLL (79). IRF4 is also expressed at low levels in patients with chronic myeloid leukemia (CML; OMIM 608232) (80).
Putative Mechanism
The honey mutation alters a highly conserved residue located in the α3 helix of the IRF4 DBD. The α3 helix is critical for recognizing and binding appropriate sequences of DNA. Although Arg 96 is not specifically implicated in binding to DNA, it is adjacent to residues that make important DNA contacts (23). It is likely that the substitution of a serine for an arginine at this location will seriously impact the DNA binding ability of the protein. The IRF4 DBD also plays an important role in interacting with various protein partners. Thus, it is possible that the arginine to serine change in honey mice may also impact the ability of IRF4 to interact with its binding partners on DNA.
 
The defective antibody production observed in honey mice, but normal numbers of B and T cells is consistent with the B cell phenotype observed in Irf4-/- animals. These animals display a normal distribution of B and T lymphocyes at 4 to 5 weeks of age, but develop progressive generalized lymphadenopathy with an absence of both T-independent and T-dependent antibody responses (47). The similarity of these phenotypes to those seen in honey mice suggests that the honey mutation severely affects the function of IRF4.
Primers Primers cannot be located by automatic search.
Genotyping
Honey genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 
 
Primers
Honey(F): 5’- AGGACTGATGTCCCCAGAGAACTG -3’
Honey(R): 5’- CCCTAGCAGGCCATGTTAAACCAG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for sequencing
Honey_seq(F): 5'- AACTGGCTCACTGAACTGTG -3'
Honey_seq(R): 5’- GCTTAAAGTCTGCCAGGTCATC -3’
 
The following sequence of 958 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 13, bases 30,843,197 to 30,844,154) is amplified:
 
aggactgatg tccccagaga actggctcac tgaactgtga agcccccagc ctccacctgc
cagcaggccg aggaagggga cttcctgcgg gaatttgttc aaagtacctc tgtgattttg
tagatgtcct ctctggggcc tgccccctcc acagctctgt ccccagtctt gcccacactt
gattcaggcg ctgggcgtgt acagcccata ctaggggtct caggacccca ctaacatcat
gttccacatt tcaggcaaca gcaaatttga aacagtaacc ttccttgctg aaatgcaatc
catagaattc ttttgacgct ctgggcttga cttttcttct catcgttctt aggcttgggc
attgtttaaa ggcaagttcc gagaagggat cgacaagcca gatcctccta cttggaagac
aagattacga tgtgctctga acaagagcaa tgactttgag gaattggtcg agaggagcca
gctggatatc tctgacccat acaaggtgta caggattgtt ccagagggag ccaaaaaagg
taaggggttt tcccagccca ggtggcagga taaaggcatt atggcactca gagagccctt
cttcctagag acagtcacgt cctacctctg ctgtaggtta agcccagatg tccttttgcc
catgtcctct ctgttataag tgacaaccct gtggtgttag tataggatga cctggcagac
tttaagcccc atgggtgtgt gggttatgca cttgaaggca ttattttcag ttactccatt
caattaggat ctggatcaaa tttccaaaca aaatctggaa aatccattaa atgtttactt
acctaatatc ctctagtaag cattttcaag aggagaaagc acatcccaca ccccatacat
attcacactt cttgtaataa aactgctaga gtttctggtt taacatggcc tgctaggg
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsCarrie N. Arnold, Elaine Pirie, and Bruce Beutler
Edit History
06/15/2011 3:34 PM (current)
01/10/2011 2:09 PM
12/02/2010 9:24 AM
11/08/2010 11:12 AM
11/08/2010 10:41 AM
08/02/2010 4:02 PM
07/07/2010 3:42 PM
07/07/2010 11:42 AM
07/07/2010 9:24 AM
07/07/2010 8:51 AM
06/28/2010 6:23 PM
06/28/2010 6:20 PM
06/25/2010 9:59 AM
06/23/2010 9:27 AM
06/22/2010 3:05 PM
06/17/2010 6:36 AM
06/16/2010 1:51 PM
06/16/2010 9:06 AM