Allele | honey | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 13 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 30,935,734 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ T (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Irf4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | interferon regulatory factor 4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | IRF-4, Spip | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 30,933,209-30,950,959 bp (+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the IRF (interferon regulatory factor) family of transcription factors, characterized by an unique tryptophan pentad repeat DNA-binding domain. The IRFs are important in the regulation of interferons in response to infection by virus, and in the regulation of interferon-inducible genes. This family member is lymphocyte specific and negatively regulates Toll-like-receptor (TLR) signaling that is central to the activation of innate and adaptive immune systems. A chromosomal translocation involving this gene and the IgH locus, t(6;14)(p25;q32), may be a cause of multiple myeloma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2010] PHENOTYPE: Mice homozygous for disruptions in this gene display immune system abnormalities involving development of both T and B cells and affecting susceptibility to both bacterial and viral infections as well as impaired thermogenic gene expression and energy expenditure. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Arginine changed to Serine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q64287 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000021784 Gene: ENSMUSG00000021356 AA Change: R96S
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000105936 Gene: ENSMUSG00000021356 AA Change: R96S
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Possibly essential (E-score: 0.590) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All alleles(4) : Targeted, knock-out(2) Targeted, other(1) Chemically induced(1) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Sperm, gDNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 032881-MU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2017-03-28 4:08 PM by Katherine Timer | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2009-11-10 12:00 AM | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2010-06-16 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other Mutations in This Stock |
Stock #: D4216 Run Code: SLD00204 Coding Region Coverage: 1x: 58.2% 3x: 22.7% Validation Efficiency: 27/40
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description | The honey mutation was discovered while screening N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice for aberrant T-dependent and T-independent B cell responses. The index mouse mounted no detectable T-independent immunoglobin M (IgM) response to haptenated ficoll or T-dependent IgG response to model antigens encoded by a recombinant suicide vector based on the Semliki Forest Virus (rSFV). Flow cytometric analysis of blood from this mouse showed normal frequencies of transitional and mature follicular B cells and cluster of differentiation (CD) 4+ T cells (Figure 1).
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation | The Irf4 gene was directly sequenced as a candidate gene and an A to T transversion was found at position 358 of the Irf4 transcript in exon 3 of 9 using Genbank record NM_013674 (Figure 2).
341 CCTACTTGGAAGACAAGATTACGATGTGCTCTG
91 -P--T--W--K--T--R--L--R--C--A--L-
The mutated nucleotide is indicated in red lettering, and causes an arginine to serine substitution at residue 96 of the IRF4 protein.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction | In mouse and human, the Irf4 gene encodes one of nine members of the interferon regulatory factor (IRF) family of transcription factors, which regulate the transcription of type I interferons (IFN-α/β) and IFN-inducible genes during immune system development, homeostasis and activation by microbes [reviewed by (1;2)]. Mouse IRF4 contains 450 amino acids and displays 92% sequence identity to its human homologue (3-6). An additional IRF, IRF10, has been identified in chickens (7), and several viral homologs have also been described (8). Amongst all IRF family members, IRF4 is most similar to IRF8 (see the record for Gemini) (1;2).
Crystal structure analyses of IRF DBDs suggest that they comprise a four-stranded antiparallel β-sheet (β1-β4), three helices (α1-α3), and three long loops (L1-L3) connecting β2 to α2, α2 to α3, and β3 to β4, respectively (21-25). IRF DBDs bind to DNA over a 12 base pair (bp) stretch with protein-DNA contacts in the major and minor grooves determining specificity. Crystallization of the DNA binding domains of PU.1 and IRF4 in complex with DNA suggests that the DNA in the complex contorts into an S shape in order to juxtapose PU.1 and IRF4 and allow electrostatic and hydrophobic interactions across the central minor groove. The IRF4 and PU.1 DBDs bind to opposite faces of the DNA in a head-to-tail orientation. Loop L3 of the IRF4 DBD is actually a short 310 helix. The PU.1 α3 recognition helix lies in the major groove perpendicular to the DNA axis, while the IRF4 α3 recognition helix is tilted in the major groove with its axis almost parallel to the DNA backbone. IRF4 interacts with PU.1 in this complex with Asp 117, Leu 116, Val 111 and His 56, residues that are all conserved in IRF8, but not in other IRF members. Mutation of these residues reduces ternary complex formation. Amino acids in the IRF4 DBD contacting the DNA include Trp 54, Ala 57, Arg 64, Lys 94, Thr 95, Asn 102 and Lys 123. His 56, which also interacts with PU.1, specifies adenines found commonly upstream of the IRF GAAA core sequence. The outer three base pairs of the IRF core (GAAA) are recognized by Arg 98 and Cys 99. Lys 103 at the end of the recognition helix is also important for DNA recognition (23).
IRF4 also contains an activation domain located within amino acids 150-450. Two regions within this sequence may serve as the potential activation domain: a proline-rich segment (amino acids 151-237) and a carboxy-terminal region (amino acids 354-419) containing 15% glutamine residues (13). A conserved bipartite nuclear retention signal is located within amino acids 50-100 of the DBD. Mutations of clustered basic residues within this sequence (amino acids 78, 80, 82 or 94, 96, 98) disrupted the nuclear localization of IRF4 (34).
A second isoform of IRF4 has been identified in both human and mouse. This isoform contains an extra glutamine residue at position 164 and occurs by alternative splicing at the intron 4 acceptor site (4;6).
The honey mutation results in an arginine to serine substitution at position 96 of IRF4 in the α3 helix of the DBD (Figure 4). IRF4 expression and localization have not been examined in homozygous honey mice.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | In both mouse and human, the expression of IRF4 is mostly restricted to cells of the immune system including B cells, T cells, macrophages and dendritic cell (DC) subsets (3-6;19;35-38). IRF4 is found at all stages of B cell development in the mouse (4;13) and is expressed in mature and activated T cells (4-6). IRF4 is detected in all CD4+ T cell subsets including T helper (Th) and regulatory T (Treg) cells (17;39), but differences in its expression pattern in these subsets have been reported. During in vitro differentiation of CD4+ T cells into T helper cells (Th1, Th2 and Th17), Irf4 mRNA is strongly expressed initially in all these subsets, but remains preferentially expressed by Th2 cells (39;40). IRF4 is highly expressed in CD8α-CD4- double negative (DN) and CD4+ conventional DCs (cDCs), expressed at lower levels in plasmacytoid DCs (pDCs), and is not present in CD8α+ DCs (see Background). This expression pattern contrasts to the high levels of IRF8 found in CD8α+ DCs and pDCs (36;37). During human monocyte differentiation to macrophages or myeloid DCs, Irf4 mRNA is specifically upregulated during DC differentiation (41). In immune cells, IRF4 localizes mainly to the nucleus, but is also present in the cytoplasm (13;33). Nuclear localization can be induced under certain conditions (35).
Although generally constitutive, Irf4 mRNA is induced upon T cell receptor (TCR) activation in T cells (4-6), B cell receptor (BCR) stimulation, and interleukin-4 (IL-4) and CD40 co-stimulation in B cells (4;18), and TLR stimulation in macrophages (33). In human NK and T cells, the macrophage-derived cytokines IFN-α and IL-12 strongly upregulated IRF4 mRNA and protein expression (40). A number of transcription factors are implicated in directly regulating Irf4 gene transcription downstream of these signaling pathways. These include nuclear factor (NF)-κB family members (see the record for xander) (42;43), the Treg master regulator Foxp3 (17), and NFAT (4;43;44). The Irf4 promoter also contains IFN-γ-activated sequence (GAS) elements, which can be bound by STAT proteins (see the records for domino and poison) (40). Interestingly, many of these factors can also physically interact with IRF4 to regulate the transcription of downstream genes (see Protein Prediction).
In addition to immune cells, IRF4 protein is found in the mouse lens (45), while mRNA expression has been reported in human melanocytes and newborn mouse skin (6). IRF4 has also been reported to be highly expressed in lymphoid malignancies in humans. IRF4 mRNA is induced upon human T cell leukemia virus type I (HTLV-I) infection (5;43;44), and IRF4 is overexpressed in some multiple myelomas (46).
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
Interestingly, IRF4 has now been found to act in concert with IRF8 during B cell differentiation [reviewed by (1;2)] (Figure 5). The development of B cells in the bone marrow is characterized by the differential expression of marker proteins such as CD45 (B220) (see the record for belittle) and CD43, and sequential recombination of Ig gene loci [reviewed in (48)]. Pro-B cells rearrange their immunoglobulin heavy (IgH) chains in a process known as VDJ recombination, which is mediated by the RAG1 (recombination activating gene 1)-RAG2 complex (see the record for maladaptive). Successful VDJ recombination gives rise to the Igμ chain, two of which combine with the surrogate light chains (SLCs), λ-5 and Vpre5, and the signaling subunits Igα and Igβ to form a pre-BCR complex initiating proliferation and further differentiation in pre-B cells. Subsequent rearrangement of the immunologlobin light (IgL) chain forms the BCR (or surface IgM) characteristic of immature B cells. During B cell development, both IRF4 and 8 are expressed in pre-B cells (49), and there is a redundant role for these factors in promoting the transition from pre-B cells to IgM+ B cells. B cells from Irf4-/-Irf8-/- double knockout mice arrest at the cycling pre-B stage (50), and either IRF4 or IRF8 expression can rescue this defect (51). IRF4 and IRF8 induce Ig light chain gene transcription and rearrangement, and also inhibit the expression of pre-BCR components (50-53). These double knockout cells are also hyperproliferative, suggesting that IRF4 and 8 are critical for limiting pre-B cell expansion, which is also necessary for further B cell differentiation (50;52;54). IRF4 attenuates IL-7 signaling, which is essential for pre-B cell proliferation and survival (52). Although IRF4 and 8 function redundantly to control pre-B cell development, IRF4 is the only IRF factor required for receptor editing, which is used by B cells to revise antigen receptors and maintain self-tolerance. Expression of IRF4 is induced by self-antigen in immature B cells leading to secondary immunoglobulin gene rearrangements. These secondary rearrangements are defective in IRF4-deficient mice (55).
The severe reduction in serum immunoglobulin and lack of GCs observed in IRF4-deficient mice (47) is due to the critical role IRF4 plays in isotype switching and plasma cell differentiation (56;57). Using mice with conditional or conventional deletion of Irf4 alleles, these studies showed that class switch recombination and plasma cell differentiation from centrocytes or memory B cells require IRF4. Both studies also showed that IRF4 is indispensable for Aicda gene induction, which encodes the activation-induced cytidine deaminase (AID) required for somatic hypermutation and class switch recombination. IRF4 may also directly induce the Prdm1 gene, which encodes the master regulator of plasma cell differentiation Blimp-1 (56). IRF4 expression is upregulated by CD40 stimulation of immature cells in the GC through activation of the NF-κB pathway, leading to downregulation of the BCL6 repressor and terminal differentiation to post-GC lymphocytes (58)
Dendritic cells (DCs) are professional antigen-presenting cells that link the innate and adaptive immune systems. DCs are able to sense pathogens and upregulate the expression of major histocompatibility complex (MHC) II and co-stimulatory molecules on their cell surface as well as secrete different cytokines. They also process and present antigenic peptides on MHC molecules to T cells, eliciting Th responses or inducing tolerance. DCs can regulate other immune cells, including B and natural killer (NK) cells, and are composed of distinct subsets that are classified according to phenotypic markers, functional features, localization and lineage [reviewed by (59)]. In the mouse, two major subsets of DCs have been identified based on the levels of the cell surface integrin subunit CD11c or the receptor protein tyrosine phosphatase CD45, CD11chighCD45- myeloid-derived conventional DCs (cDCs) and CD11clowCD45+ lymphoid-derived plasmacytoid DCs (pDCs). Conventional DCs can be further distinguished by expression levels of CD8α, CD4 and CD11b. The spleen contains three cDC subsets: CD4+CD8α-CD11bhigh, CD4-CD8α+CD11blow and CD4-CD8α-CD11bhigh double negative (DN) DCs. The thymus is missing the CD4+CD8α- DCs. Lymph nodes contain two additional DC subsets that are derived from epidermal DCs (Langerhans cells) and interstitial DCs. In humans, two major blood-derived DC subsets are characterized as CD11c+ myeloid DCs (mDCs) and pDCs, but the markers used to distinguish these cells are generally not conserved in mouse DC subsets. In both mouse and human, pDCs are the major source of type I IFNs produced in response to infection [reviewed by (60)]. In vitro, several growth factors are capable of stimulating DC differentiation in a subset-specific manner. Granulocyte macrophage colony-stumulating factor (GM-CSF) supports the generation of CD11b+ cDCs from bone marrow (BM), while fms-like tyrosine kinase 3 ligand (Flt3L) can expand both CD11b+ cDCsand pDCs (60-63). Analysis of DC subsets in mice lacking IRF4 and IRF8 suggests that the pattern of expression of these IRFs in DC subsets strictly correlates with their requirement for DC development. Thus, IRF4, but not IRF8, is necessary for CD4+ DC differentiation, both IRFs support the development of DN DCs, and IRF8 is important for both CD8α+, pDC, Langerhans and interstitial DC differentiation (36;37;64). IRF4 also supports pDC development, but to a lesser extent (37). Furthermore, IRF4 was shown to be important for GM-CSF-mediated DC differentiation, while Flt3L-dependent development required IRF8 (36;37).
Although generally important in activated T cells (47), IRF4 has also been shown to play a role in the differentiation of specific subsets of CD4+ T cells including Th2, Th17 and Tregs [reviewed by (65)]. CD4+ T cells can differentiate into the T helper cell subsets Th1, Th2, Th3, Th17 and follicular helper (TFH) cells (please see the record for sanroque), as well as immune-suppressive Tregs. Th cells are involved in activating and directing other immune cells, and do so by producing cytokines that are specific to each subset. Th1 cells produce IFN-γ and tumor necrosis factor β (TNF-β) and are important in stimulating macrophages and cytotoxic CD8+ T cells, whereas Th2 cells produce IL-4,-5,-6,-10 and -13 and stimulate B cells. Th17 cells produce IL-17 and IL-21 and play an important role in the development of autoimmune diseases like rheumatoid arthritis, as well as being critical in the clearance of fungal and extracellular bacterial infections. The differentiation of CD4+ T cells into various Th subtypes depends on the environment encountered by the naïve Th cell [reviewed by (65)]. Irf4-/- T cells do not undergo Th2 differentiation in vitro and cannot produce IL-4 or other Th2 cytokines, and fail to express GATA3, a transcription factor critical for Th2 development (66;67). At the molecular level, IRF4 in association with NFAT activates the IL-4 promoter (16;68). Production of this cytokine further promotes Th2 differentiation. IRF4 also interacts with BCL6 and BCL6 deficiency in T cells promotes Th2 differentiation, suggesting that BCL6 may negatively regulate IRF4 function in T cells as it does in B cells (18). In vivo, Irf4-/-mice are partially susceptible to the intracellular pathogen Leishmania major due to these defects in Th2 differentiation (66;67). Some of these effects may be partially extrinsic as CD4+ DCs are thought to stimulate Th2 responses. Interestingly, IRF4 has been shown to have differential effects on naïve CD4+ T cells versus effector/memory CD4+ T cells by promoting Th2 development in the latter, while inhibiting Th2 cytokine production in the former (69). This latter finding is consistent with the role of IRF4 in Tregs and the negative regulation of Th2 differentiation in these cells (17). In Tregs, Foxp3 upregulates IRF4 expression and then interacts with IRF4 to modulate the expression of certain IRF4 target genes that are important for Th2 differentiation, thus suppressing the Th2 response. Conditional knockout mice in which Irf4 was specifically ablated in Tregs displayed a selective dysregulation of Th2 responses and an increase in the numbers of Th2 cells leading to autoimmune disease. Interestingly, the complete Irf4-/-knockout mice are actually resistant to the development of autoimmune diseases due to the inability of Irf4-/- naïve T helper cells to differentiate into Th17 cells (39). Irf4-/- cells express less RORγt (see the record for 4-limb clasper), a factor necessary for Th17 differentiation, as well as more Foxp3. Furthermore, IRF4 directly induces Il17 and Il21, a function that is inhibited by its binding partner, IBP. IBP-deficient mice develop a rheumatoid arthritis-like disease (70). Collectively, these results suggest that IRF4 is important in modulating autoimmune responses.
As discussed above, IRF4 appears to be expressed in several types of lymphoid malignancies including T cell leukemias and multiple myeloma (OMIM 254500). Translocations involving the IRF4 gene occur in a subset of peripheral T cell lymphomas (75), and some cases of multiple myeloma contain a chromosomal translocation that juxtaposes the immunoglobulin heavy-chain locus to the Irf4 gene resulting in IRF overexpression (46). IRF4 mRNA expression is a prognostic marker for poor survival in these patients (76), and IRF4 is required for the survival of multiple myeloma cell lines (77). However, the overexpression of IRF4 in lymphocytes is not sufficient to induce these malignancies in transgenic mice (78). Conversely, lower expression of IRF4 is associated with an increased risk of developing chronic lymphocytic leukemia (CLL; OMIM 151400), and a SNP located in the 3-prime untranslated region of the IRF4 gene was found to strongly associate with CLL (79). IRF4 is also expressed at low levels in patients with chronic myeloid leukemia (CML; OMIM 608232) (80).
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The honey mutation alters a highly conserved residue located in the α3 helix of the IRF4 DBD. The α3 helix is critical for recognizing and binding appropriate sequences of DNA. Although Arg 96 is not specifically implicated in binding to DNA, it is adjacent to residues that make important DNA contacts (23). It is likely that the substitution of a serine for an arginine at this location will seriously impact the DNA binding ability of the protein. The IRF4 DBD also plays an important role in interacting with various protein partners. Thus, it is possible that the arginine to serine change in honey mice may also impact the ability of IRF4 to interact with its binding partners on DNA.
The defective antibody production observed in honey mice, but normal numbers of B and T cells is consistent with the B cell phenotype observed in Irf4-/- animals. These animals display a normal distribution of B and T lymphocyes at 4 to 5 weeks of age, but develop progressive generalized lymphadenopathy with an absence of both T-independent and T-dependent antibody responses (47). The similarity of these phenotypes to those seen in honey mice suggests that the honey mutation severely affects the function of IRF4.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Honey genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
Primers
Honey(F): 5’- AGGACTGATGTCCCCAGAGAACTG -3’
Honey(R): 5’- CCCTAGCAGGCCATGTTAAACCAG -3’
PCR program
1) 95°C 2:00
2) 95°C 0:30
3) 56°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 29X
6) 72°C 7:00
7) 4°C 8
Primers for sequencing
Honey_seq(F): 5'- AACTGGCTCACTGAACTGTG -3'
Honey_seq(R): 5’- GCTTAAAGTCTGCCAGGTCATC -3’
The following sequence of 958 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 13, bases 30,843,197 to 30,844,154) is amplified:
aggactgatg tccccagaga actggctcac tgaactgtga agcccccagc ctccacctgc
cagcaggccg aggaagggga cttcctgcgg gaatttgttc aaagtacctc tgtgattttg tagatgtcct ctctggggcc tgccccctcc acagctctgt ccccagtctt gcccacactt gattcaggcg ctgggcgtgt acagcccata ctaggggtct caggacccca ctaacatcat gttccacatt tcaggcaaca gcaaatttga aacagtaacc ttccttgctg aaatgcaatc catagaattc ttttgacgct ctgggcttga cttttcttct catcgttctt aggcttgggc attgtttaaa ggcaagttcc gagaagggat cgacaagcca gatcctccta cttggaagac aagattacga tgtgctctga acaagagcaa tgactttgag gaattggtcg agaggagcca gctggatatc tctgacccat acaaggtgta caggattgtt ccagagggag ccaaaaaagg taaggggttt tcccagccca ggtggcagga taaaggcatt atggcactca gagagccctt cttcctagag acagtcacgt cctacctctg ctgtaggtta agcccagatg tccttttgcc catgtcctct ctgttataag tgacaaccct gtggtgttag tataggatga cctggcagac tttaagcccc atgggtgtgt gggttatgca cttgaaggca ttattttcag ttactccatt caattaggat ctggatcaaa tttccaaaca aaatctggaa aatccattaa atgtttactt acctaatatc ctctagtaag cattttcaag aggagaaagc acatcccaca ccccatacat attcacactt cttgtaataa aactgctaga gtttctggtt taacatggcc tgctaggg Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Nora G. Smart | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Carrie N. Arnold, Elaine Pirie, and Bruce Beutler |