Phenotypic Mutation 'queen' (pdf version)
Allelequeen
Mutation Type missense
Chromosome8
Coordinate117,581,707 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Plcg2
Gene Name phospholipase C, gamma 2
Synonym(s) Plcg-2, PLCgamma2
Chromosomal Location 117,498,291-117,635,140 bp (+)
MGI Phenotype Homozygotes for some null alleles show decreased B cell and impaired NK cell function. Other homozygous null alleles show aberrant separation of blood and lymphatic vessels.
Accession Number

NCBI RefSeq: NM_172285; MGI: 97616

Mapped Yes 
Amino Acid Change Isoleucine changed to Arginine
Institutional SourceBeutler Lab
Ref Sequences
I346R in Ensembl: ENSMUSP00000079991 (fasta)
Gene Model not available
PDB Structure
Crystal structure of the N-terminal SH2 domain of mouse phospholipase C-gamma 2 [X-RAY DIFFRACTION]
Solution structure of the SH3 domain from Phospholipase C, gamma 2 [SOLUTION NMR]
SMART Domains

DomainStartEndE-ValueType
PH 21 133 1.87e-4 SMART
Pfam:efhand_like 229 309 6.5e-4 PFAM
PLCXc 312 456 2.29e-96 SMART
low complexity region 461 476 N/A INTRINSIC
SH2 530 623 2.24e-30 SMART
SH2 644 726 1.16e-28 SMART
SH3 772 828 3.12e-18 SMART
PH 789 910 4.31e0 SMART
PLCYc 930 1044 1.18e-66 SMART
C2 1062 1167 1.41e-15 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.993 (Sensitivity: 0.69; Specificity: 0.97)
(Using Ensembl: ENSMUSP00000079991)
Phenotypic Category T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance 100% 
Alleles Listed at MGI

All alleles(19) : Targeted, knock-out(1) Targeted, other(5) Gene trapped(9) Spontaneous(1) Chemically induced(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Plcg2 APN 8 117556071 missense possibly damaging 0.89
IGL00911:Plcg2 APN 8 117586515 missense probably benign 0.17
IGL00952:Plcg2 APN 8 117607217 missense probably benign
IGL01115:Plcg2 APN 8 117557329 missense probably damaging 1.00
IGL01326:Plcg2 APN 8 117573999 unclassified 0.00
IGL01357:Plcg2 APN 8 117614161 unclassified 0.00
IGL01705:Plcg2 APN 8 117581662 missense probably damaging 1.00
IGL01755:Plcg2 APN 8 117621241 missense possibly damaging 0.48
IGL01828:Plcg2 APN 8 117590233 missense probably damaging 1.00
IGL02307:Plcg2 APN 8 117579896 unclassified probably null
IGL02345:Plcg2 APN 8 117585180 missense probably damaging 0.99
IGL02448:Plcg2 APN 8 117607221 missense probably benign
IGL02587:Plcg2 APN 8 117558113 missense possibly damaging 0.80
IGL02646:Plcg2 APN 8 117603883 missense possibly damaging 0.88
IGL03409:Plcg2 APN 8 117583495 missense probably damaging 0.96
Poseidon UTSW 8 117615238 missense probably damaging 1.00
Poseidon2 UTSW 8 117577874 missense possibly damaging 0.80
JAX1:Plcg2 UTSW 8 117612978 missense probably benign 0.01
R0172:Plcg2 UTSW 8 117579782 missense probably benign 0.00
R0194:Plcg2 UTSW 8 117573397 splice site probably benign
R0410:Plcg2 UTSW 8 117615373 missense probably damaging 0.98
R0462:Plcg2 UTSW 8 117585305 missense probably benign 0.06
R0494:Plcg2 UTSW 8 117556104 missense probably damaging 1.00
R0522:Plcg2 UTSW 8 117614288 splice site probably null
R0612:Plcg2 UTSW 8 117573365 missense probably benign 0.01
R1239:Plcg2 UTSW 8 117556044 missense probably benign
R1608:Plcg2 UTSW 8 117614235 missense possibly damaging 0.89
R1756:Plcg2 UTSW 8 117592708 missense probably benign 0.02
R2176:Plcg2 UTSW 8 117612994 missense probably damaging 1.00
R3500:Plcg2 UTSW 8 117612978 missense probably benign 0.01
R4043:Plcg2 UTSW 8 117612978 missense probably benign 0.01
R4654:Plcg2 UTSW 8 117504315 missense probably benign
R4883:Plcg2 UTSW 8 117607133 nonsense probably null
R4932:Plcg2 UTSW 8 117607083 missense probably benign 0.05
R5080:Plcg2 UTSW 8 117590003 missense probably benign 0.10
R5226:Plcg2 UTSW 8 117577874 missense possibly damaging 0.80
R5264:Plcg2 UTSW 8 117634793 missense possibly damaging 0.95
R5298:Plcg2 UTSW 8 117605249 missense probably benign
R5473:Plcg2 UTSW 8 117634401 missense probably benign
R5555:Plcg2 UTSW 8 117612995 nonsense probably null
R5557:Plcg2 UTSW 8 117586557 missense probably damaging 0.99
R5805:Plcg2 UTSW 8 117598495 unclassified probably null
R5826:Plcg2 UTSW 8 117610844 missense probably benign 0.19
R5871:Plcg2 UTSW 8 117504217 missense probably damaging 1.00
R5894:Plcg2 UTSW 8 117504349 missense probably damaging 0.99
R6142:Plcg2 UTSW 8 117585271 missense probably benign
X0027:Plcg2 UTSW 8 117555983 missense probably benign 0.03
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
MMRRC Submission 034330-MU
Last Updated 06/06/2017 10:14 AM by Katherine Timer
Record Created 11/10/2009 12:00 AM
Record Posted 11/08/2010
Phenotypic Description

The queen mutation was discovered while screening N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice for aberrant T-dependent and T-independent B cell responses.  The index mouse (D4125) mounted no detectable T-independent immunoglobin M (IgM) response to haptenated ficoll five days after immunization, but mounted a normal T-dependent IgG response to model antigens encoded by a recombinant suicide vector based on the Semliki Forest Virus (rSFV) fourteen days after immunization (Figure 1).  Flow cytometry of blood from this mouse revealed normal frequencies of transitional and mature follicular B cells and CD4+ T cells. 

Nature of Mutation
The Plcg2 gene was directly sequenced as a candidate gene and a T to A transversion was found at position 1232 of the Plcg2 transcript in exon 12 of 33 total exons using Genbank record NM_172285
.
1216 TCCACGGAAGCGTATATCCGCTGTCTGCGCGCT
341  -S--T--E--A--Y--I--R--C--L--R--A-
 
The mutated nucleotide is indicated in red lettering, and causes an isoleucine to arginine substitution at residue 346 of the phospholipase C gamma 2 (PLC-γ2) protein.
Protein Prediction

Figure 3. Domain structure of PLC-γ2. PLC isozymes contain a conserved domain structure consisting of the catalytic X and Y domains located between EF-hand motifs and a calcium-binding C2 domain. There is a pleckstrin homology (PH) domain at the N-terminus. PLC-γ2 contains an additional PH domain split by two tandem Src homology 2 (SH2) domains and an SH3 domain. The Queen mutation causes an isoleucine to arginine substitution at residue 346 of the PLC-γ2 protein.

The Plcg2 gene encodes a 1265 amino acid protein that is a member of the phosphoinositide-specific phospholipase C (PLC) family (Figure 3).  PLC enzymes act as effector molecules in the signal transduction process by hydrolyzing phosphatidylinositol 4,5 bisphosphate (PIP2) to generate two second messengers, diacylglycerol (DAG) and inositol 1,4,5-triphosphate (IP3). Thirteen mammalian PLC isozymes have been identified belonging to six different subtypes: PLC-β, -γ, -δ, -ε, -ζ, and –η. Each isozyme typically has more than one alternative splicing variant, but only one PLC-γ2 variant has been reported in the mouse. PLC isozymes contain a conserved domain structure consisting of the catalytic X and Y domains located between EF-hand motifs and a calcium-binding C2 domain. Most PLC proteins also contain a pleckstrin homology (PH) domain at their N-terminus. Additional domains are present in some PLC isozymes including the γ subtypes (PLC-γ1 and -γ2), which contain an additional PH domain split by two tandem Src homology 2 (SH2) domains and an SH3 domain (1).

 

Crystallographic analysis of rat PLC-δ1 (alone and in complex with various substrates) and the PLC-δ1 PH domain in complex with IP3 has elucidated the general structure of PLC isozymes (PDB 2ISD; 1DJW; 1DJI; 1DJX; 1DJY; 1DJZ; 1MAI) and provided a model of PLC isozyme function (Figure 4) (2-4).(2-4).  The N-terminal PH domain (residues 1-131) acts as a membrane anchor by binding to membrane phospholipids (5;6), although the PH domains of PLC-β isozymes bind specifically to the heterotrimeric G protein subunit, Gβγ (7).   Similar to other PH domains, the PLC-δ1 PH domain forms a β sandwich (β1- β7) closed off at one end by a C-terminal α helix, as well as two additional short α helices at the N-terminus and in the β5/β6 loop.  Most interactions with IP3 occur between basic residues in the β1/ β2 and β3/ β4 loops at the positively charged face of the PH domain and the 4- and 5-phosphate groups of IP3(4).  The N-terminal PH domain of the PLC-γ proteins preferentially binds to phosphatidylinositol 3,4,5 trisphosphate (PIP3) rather than IP3 (6).  Mutation of the PLC-γ1 β3/ β4 PH loop abolishes this interaction (8).

 

The EF-hand domain consists of four consecutive EF-hand motifs with a characteristic helix-turn-helix topology.  These motifs typically bind calcium ions, but their deletion in PLC-δ1 decreased activity in a calcium-independent manner (9) and EF-hands 3 and 4 do not contain typical calcium-binding residues.  In PLC-δ1, a pair of EF-hand motifs each forms a lobe (2).  The second lobe consisting of EF-hand 3 and 4 appears to serve a critical structural role (2;9).  The EF-hand domain does not contact the catalytic domain, but does form an interface with the C-terminal C2 domain (2), which acts as a calcium-dependent lipid membrane-binding module.  The PLC-δ1 C2 domain not only contacts the EF-hand domain, but also forms extensive contacts with the catalytic domain.  The C2 domain (residues 1048-1152) forms an eight-stranded antiparallel β-sandwich and possesses three to four calcium-binding sites. Residues that participate in metal binding, most of which are negatively charged, are contained in three loops at one end of the C2 domain (10).  Calcium-binding causes a conformational change that allows the C2 domain to bind to a phospholipid headgroup (11), and forces the proper orientation of the catalytic domain on the membrane (2;3)

 

The X- and Y-box domains of PLC-γ2 are located at amino acids 312-456 and 930-1044, respectively, and are generally highly conserved with the same regions in other PLC family members.  The PLC-γ X- and Y-boxes fold together to form the catalytic region after the enzyme is tyrosine phosphorylated.  Crystallographic analysis of rat PLC-δ1 shows that the X and Y domains are composed of alternating α-helices and β-strands, and together form an incomplete triose phosphate isomerase (TIM) α/β-barrel.  The X domain contributes a typical TIM βaβaβaβ structure, while the Y domain lacks a helix between β5 and β6 (2).  The X- and Y-boxes are joined by a flexible linker.  Mutagenesis data suggest that two histidine residues (His 327 and His 372) are critical for catalytic function (12;13).  These two residues project their side-chains into the active site located at the C-terminal end of the TIM α/β-barrel (2).  Phosphoinositide hydrolysis occurs in several steps (3).  A cyclic phosphodiester intermediate is formed by nucleophilic attack of the axial 2-hydroxyl group of PIP2 (14), and then undergoes hydrolysis to form acyclic IP3.  A calcium ion bound to Asn 328, Glu 357 and Glu 406 lowers the pKa of this reaction (3).  Other important active site residues include Lys 454, Lys 456, Ser 957 and Arg 984.  These amino acids are implicated in interactions with 4- or 5-phosphate of the substrate headgroup (2;15), and the positive charge at Arg 984 is required for preferential hydrolysis of PIP2 over PI (16).  The structure of the PLC-δ1 catalytic domain also revealed a cluster of hydrophobic and negatively charged residues at the rim of the active site opening.  These residues likely prevent extensive membrane contacts and may be involved in negative regulation of PLC activity (15)

 

The split PH (residues 468-513 and 849-914), SH2 (residues 532-635 and 646-735) and SH3 (residues 769-829) domains are located in the linker region between the X- and Y-boxes.  This region is important in activating PLC-γ isozymes downstream of receptors with intrinsic or associated tyrosine kinase activity including various receptor tyrosine kinases (RTKs) such as the epidermal growth factor receptor (EGFR; see the record for Velvet) and platelet-derived growth factor receptor (PDGFR), as well as nonreceptor tyrosine kinases such as the B cell receptor (BCR), T cell receptor (TCR), erythropoietin (EPO) receptor, immunoglobulin and adhesion receptors (1).  The SH2 domains of PLC-γ recognize phosphotyrosine sequences present in these receptors, as well as in adaptor proteins or elements of the cytoskeleton such as F-actin (17), while the SH3 domain allows binding with proteins containing proline-rich regions and may also target PLC-γ isozymes to the cytoskeleton (18).  Molecules such as the BCR adaptor protein B cell linker (BLNK) (see the record for busy) (19) and the kinases c-Src and Pyk2 (20;21) have been shown to bind to the SH2 domains of PLC-γ2, and mutation of residues Arg 564 and Arg 672 in the PLC-γ2 SH2 motifs is important for protein function (20).  PLC-γ SH2 domains are also implicated in PIP3 binding along with the N-terminal PH domain (22;23).  The associations made by the PLC-γ SH2 and SH3 domains are critical for both the membrane recruitment and subsequent tyrosine phosphorylation of PLC-γ either by RTKs or associated kinases present in multimolecular signaling complexes, as well as the recruitment of additional molecules to these signaling complexes.  The PLC-γ1 SH3 domain is composed of eight anti-parallel β strands consisting of two successive "Greek key" motifs, which form a barrel-like structure. Conserved aliphatic and aromatic residues form a hydrophobic pocket on the surface, which may bind target proteins (24).  The PLC-γ2 SH3 domain is similar, but has only seven β strands (Figure 5) (PDB 2EQI).  Structures of the PLC- γ2 SH2 domains are also available and consist of a β sheet flanked by α helices (PDB 2DX0; 2EOB).   

 

PLC-γ2, but not PLC-γ1, is also activated by Racs, which are members of the Rho family of Ras-related small G proteins that regulate actin dynamics (25).  Rac binds to the split PH domain of PLC-γ2 (26), which is able to fold into a canonical PH conformation.  The SH2/SH3 insertion between the β3 and β4 strands does not change the structure of the split PH domain.  The interaction with Rac is predominantly hydrophobic and involves residues from the β5 strand and the α helix including Lys 862, Phe 872, Val 893, Leu 896, Phe 897, Phe 900, Gln 901 and Arg 904 (27) (Figure 6) (PDB 2W2W).  The C-terminal portion of the PLC-γ1split PH domain has also been implicated in directly binding to the TRPC3 calcium channel (28), which may explain the ability of both PLC-γ isozymes to regulate agonist-induced calcium entry independent of lipase activity (29).  However, another study suggests that the PLC-γ1 split PH domain does not directly interact with TRPC3 (30).

 

Upon ligand-induced activation of a variety of growth factor receptors and immune system receptors, PLC-γ isozymes are phosphorylated on specific tyrosine residues (Tyr 753 and Tyr 759 for PLC-γ2) by kinases such as spleen tyrosine kinase (Syk) and Bruton’s tyrosine kinase (Btk), increasing their phospholipase activity (31;32).  Phosphorylation of the second PLC-γ1 tyrosine results in intra-molecular binding to the C-terminal SH2 domain, likely inducing a conformation change required for activation (33).  The tyrosine phosphatase SHP-1 (see the record for spin) inhibits PLC-γ activation. 

 

The queen mutation alters an amino acid located in the X-box catalytic region of the protein. The effect of the mutation on protein expression and localization has not been determined.  

Expression/Localization

PLC isozymes are usually expressed in a tissue and organ specific manner.  Unlike Plcg1 mRNA, which is widely detected in various tissues, Plcg2 mRNA and protein is primarily found in cells of the hematopoietic lineage and in the lymph nodes including high mRNA levels in B cells (34-36). Plcg2 mRNA and is also expressed in limited areas of the anterior pituitary and cerebellar Purkinje and granule cells (37;38), and in endothelial cell subsets (39).  PLC-γ2 protein has been reported in cells of the monocyte/macrophage lineage including osteoclasts (20;40), and in cells of the gerbil cochlea (41).

 

Generally, PLC-γ isoforms are cytoplasmic, but are recruited to the membrane upon receptor activation.  In B cells, PLC-γ2 is translocated to the membrane upon engagement of the BCR with antigen, and colocalizes at membrane BCR-containing microclusters (42).  PLC-γ isozymes are also localized to the cell cytoskeleton in various immune cell types and governed by direct interactions with F-actin (17;18;20).  Regulation of both membrane and cytoskeletal PLC-γ2 localization depends in part on phosphatidylinositol 3-kinase (PI3K) activity, which produces PIP3 (43;44). The Src homology 2 (SH2) domain-containing inositol polyphosphate 5-phosphatase (SHIP-1; see the record for styx) also regulates PLC-γ2 localization by degrading PIP3 resulting in release of PLC-γ2 from the membrane.

Background

The hydrolysis of PIP2 by PLC enzymes to produce DAG and IP3 is a critical step in the signal transduction process of many pathways.  DAG is responsible for activating protein kinase C and possibly the TRP calcium influx channels, while IP3 modulates calcium responses within the cell by binding to receptors on the intracellular membrane to allow the mobilization of intracellular calcium (45).  Due to its wide expression pattern, PLC-γ1 regulates a multitude of cellular functions in many tissues and Plcg1 knockout mice die early during embryogenesis (46).  By contrast, Plcg2 knockout mice are viable with phenotypes that are mainly restricted to the hematopoietic system.  Plcg2 -/- mice display internal bleeding, osteopetrosis, impaired lymph node organogenesis and defects in the functioning of B cells, platelets, neutrophils, mast cells, dendritic cells (DCs), macrophages and natural killer (NK) cells (47-53).  A nonsense mutation in Plcg2, resulting in a truncation in the N-terminal PH domain, causes aberrant separation of blood and lymphatic vessels (39).  In addition, two ENU-generated Plcg2 point mutations located in the catalytic and split PH domains have been linked to inflammatory and autoimmune responses through PLC-γ2 hyperactivation in cells of both the innate and acquired immune system (54;55).

 

Figure 7. Pre-BCR and BCR signaling. Pre-BCR engagement results in the activation of SYK (spleen tyrosine kinase), which together with Src-family  kinases (LYN, FYN, BLK), phosphorylates many substrates and triggering signaling pathways that are involved in both proliferation and differentiation of pre-B cells. These include activation of phosphoinositide 3 kinase (PI3K) by phosphorylating the coreceptor CD19 and/or the adaptor protein B-cell PI3K adaptor (BCAP). PI3K activation results in the generation of phosphatidylinosital-3,4,5-triphosphate (PIP3), which recruits plekstrin-homology domain signaling molecules to the membrane including the serine threonine protein kinase B (PKB) and its activating kinase 3- phosphoinositide-dependent protein kinase 1 (PDK1). Signaling through this pathway pathway suppresses recombination-activating gene 1 (RAG1) and RAG2 expression, blocks Igk (the k chain of the immunoglobin light chain) gene recombination and induces cell proliferation. SYK also phosphorylates SH2-domain containing leukocyte protein of SLP65, resulting in the organization of a molecular complex that includes Bruton’s tyrosine kinase (BTK) and phospholipase Cg2 (PLCg2). This complex controls downregulation of l-5, a component of the surrogate light chain (SLC), and upregulates the expression of RAG proteins and the interferon-regulatory factor 4 (IRF4). IRF4 positively regulates Igk recombination. SLP65 also modulates PKB activity either directly or by altering the activity of SYK, CD19, or PI3K. Alternatively, SLP65 may regulate PKB activity by activating lipid phosphatases such as SH2-domain containing inositol-5 phosphate (SHIP) and altering PIP3 levels. Multiple downstream signaling pathways are activated by BCR stimulation and lead to a multitude of cellular responses. Following aggregation and localization of BCR molecules, the tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn) and by SYK. These phosphotyrosines then act as docking sites for the SH2 domains of SYK, resulting in SYK phosphorylation and activation. SYK phosphorylates a number of downstream targets including BLNK, PLC-g2 and protein kinase C β (PKCβ). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of 3′-phosphorylated phosphoinositides. One of these lipids, phosphatidylinositol-3,4,5-triphosphate (PIP3), binds selectively to the pleckstrin homology (PH) domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-g2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). Soluble IP3 and membrane-bound DAG initiate downstream signal transduction pathways involving calcium (Ca2+) mobilization and PKC, respectively. The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1 or CARD11), which are involved in NF-κB activation along with PKCβ. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information. This image is interactive. Click to view additional mutations.

The role of PLC-γ2 has perhaps been best studied in B cells. Plcg2 -/- mice display decreased mature B cells, a block in pro-B cell differentiation, B-1 B cell deficiency, and an absence of T cell-independent antibody production (47;48).  These phenotypes can be attributed to a defect in BCR and pre-BCR signaling (Figure 7).  The BCR is a multi-subunit complex that is composed of a membrane-bound Ig molecule that binds foreign particles, and the signal transducing Igα (CD79a)/Igβ (CD79b) heterodimer.  Multiple downstream signaling pathways are activated by BCR stimulation and lead to a multitude of cellular responses including cell proliferation, differentiation, apoptosis, and antibody production [reviewed by (56;57)].  Following aggregation and localization of BCR molecules into membrane rafts, the immunoreceptortyrosine-based activation motifs (ITAMs) located on the cytoplasmic tails of Igα and Igβ become phosphorylated by the Src family kinases Lyn and Fyn, resulting in recruitment and phosphorylation of Syk (57;58).  Syk phosphorylates a number of targets including BLNK, PLC-γ2 and PKCβ (see the record for Untied).  BCR stimulation also activates the p85/p110 form of PI3K resulting in the generation of PIP3, which recruits both PLC-γ2 and Btk to the membrane.  Additional docking sites for Btk and PLC-γ2 are provided by phosphorylated BLNK, resulting in continued phosphorylation and activation of PLC-γ2 by Btk (59).  Btk can also regulate PLC-γ2 independently of kinase function by recruiting phosphotidylinositol-4-phosphate 5 kinase (PIP5K) to the membrane, thus generating more PIP2 and sustaining DAG and IP3 production by PLC-γ2 (60).  The recruitment of the guanine nucleotide exchange factors Vav1-3, Nck (non-catalytic region of tyrosine kinase adaptor protein) and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK) [reviewed by (61)].  Other adaptor proteins, Swiprosin-1/EFhd2 (Swip-1) and B cell adaptor for PI3K (BCAP), are also important in stabilizing the interactions of molecules within the BCR signalosome (62;63).Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB (see the records for xander and panr2) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies [reviewed by (64)].  Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1 or paracaspase), and caspase recruitment domain family, member 11 (CARMA1 or CARD11; see the record for king), which are involved in NF-κB activation along with PKCβ (65-71).     

 

The development of B cells in the bone marrow is characterized by the differential expression of marker proteins such as CD45 (B220) (see the record for belittle) and CD43,and sequential recombination of immunoglobulin gene loci [reviewed in (56)].  In addition, the development of early B lymphopoiesis is regulated by a network of key transcription factors that include PU.1 (an ets-family member), Ikaros, Bcl11a (a zinc finger transcription factor), E2A (a helix-loop- helix protein), EBF (early B cell factor) and the paired box protein, Pax5 (72).  B cell development begins when lymphoid progenitor cells or prepro-B cells receive signals, such as interleukin 7 (IL-7), from bone marrow stromal cells.  During the pro-B stage, these cells rearrange their immunoglobulin heavy (IgH) chains in a process known as VDJ recombination mediated by the RAG1 (recombination activating gene 1)-RAG2 complex (see the record for maladaptive).  The diversity (D) and joining (J) gene segments are first recombined together, followed by the variable (V) segment.  Although B lineage cells can undergo VDJ rearrangement at both IgH loci, only one of the IgH alleles is expressed by the B cell, a process known as allelic exclusion.  Successful VDJ recombination gives rise to the Igμ chain, two of which combine with the surrogate light chains (SLCs), λ-5 and Vpre5, and the signaling subunits Igα and Igβ to complete the pre-BCR complex.  Large pre-B cells expressing the pre-BCR are competent for pre-BCR signaling, which initiates proliferation, further differentiation, and eventually downregulates expression of the pre-BCR.  Subsequently, rearrangement of the immunologlobin light (IgL) chain by the RAG1-RAG2 complex occurs to form the BCR (or surface IgM) characteristic of immature B cells.  Receptor editing through successive rearrangements of Ig genes at this stage is a major mechanism for negatively selecting self-reactive B cells. Transition of the cells into fully mature B cells requires BCR signaling and is associated with migration from the bone marrow to the spleen and lymph nodes (56).

 

Blocks in B cell development are observed in several mouse mutant models, including animals that are deficient for factors necessary for VDJ recombination, components of the pre-BCR complex, and the pre-BCR signal transduction machinery.  Mutations in Pax5, Rag1, Rag2, Igμ, Igα, and Igβ lead to an absolute block in B cell development during the pro-B stage (56;72-74), while the absence of various SLC and pre-BCR signal transduction components like Btk, Syk, BLNK, BCAP, Vav1/Vav2/Vav3, the p85 subunit of PI3K, PKCβ, Bcl10, CARMA1, MALT10and PLC-γ2, result in an incomplete block in B cell development, generally leading to a milder defect in conventional peripheral B cell development with a more severe loss of peritoneal B-1 B cells (75).  B cells from PLC-γ2 deficient mice display reduced IgL rearrangement and impairment of receptor editing, but maintain allelic exclusion (76;77).  These effects may occur through impaired BCR-induced expression of IRF-4 (see the record for honey) and IRF-8 (see the record for Gemini), the two transcription factors critical for IgL rearrangements (76)Plcg2 -/- B cells also express reduced levels of the pro-survival protein Bcl-2.   Introduction of a Bcl2 transgene restored B cell numbers in Plcg2 -/- animals suggesting that PLC-γ2 performs a critical role in B cell development by regulating survival (78)

 

Much of the signaling pathway involved in regulating PLC-γ2 in B cells is also present in other immune cell types although some of the adaptor proteins and tyrosine kinases utilized differ.  In T cells, the predominant PLC isozyme is PLC-γ1 and the absence of PLC-γ2 has no effect on T cell differentiation or function.  However, as described above, PLC-γ2 is important for the function and maturation of many other immune cells, as well as osteoclasts.  PLC-γ1 has non-overlapping functions in some of these cell types (1;79).  Signaling through ITAM-bearing receptors in these cells initiate TCR and BCR-like signal transduction cascades involving Src and Syk family kinases along with PLC-γ2 thus regulating calcium influx, and activating MAP kinase cascades, NF-AT, NF-κB and AP-1.  Disruption of this signaling pathway in Plcg2 -/- mice and cells results in several phenotypes: blockade of receptor activator of NF-kappaB ligand (RANKL)-mediated osteoclast differentiation and lymph node organogenesis (49;51); impaired capacity of antigen presentation, cytokine secretion, and induction of T helper cell subsets in response to β-glucan in DCs (52;53); and defective Fc receptor-mediated responses in mast cells, macrophages, neutrophils and NK cells.  Fc receptors recognize the Fc portion of various Ig molecules and defective Fc receptor signaling in Plcg2 -/- mice impairs NK cell maturation and cytolytic capacity resulting in susceptibility to viral infections (80;81), and defective platelet, neutrophil and mast cell activation (40;47;82;83).   In addition, cells such as platelets, neutrophils and osteoclasts, require PLC-γ2 for integrin-mediated signals directly or via the PKC pathway, thus mediating cytoskeletal reorganizations critical for platelet spreading, neutrophil migration and activation, and osteoclast adhesion, migration and bone resorption (20;82;84).  Due to their defects in osteoclasts, neutrophils, and DCs, Plcg2 -/- mice are protected from induced models of arthritis (84-86).  These animals are also protected from IgE-induced skin inflammation, because of defective mast cell function (40).

 

Calcium mobilization via PLC activation can also be activated by Toll-like receptor (TLR) signaling (87;88).  TLRs play an essential role in the immune response by recognizing conserved molecular motifs found in many different pathogens, and signal through various adaptor proteins including myeloid differentiation (MyD) 88 (see pococurante and lackadaisical), TIRAP for toll-interleukin 1 receptor domain containing adaptor protein (also called MAL for MyD88 adaptor-like) (see torpid), TRIF for Toll-interleukin 1 receptor (TIR) domain-containing adaptor inducing IFN-β (also known as TICAM-1 for TIR domain-containing adaptor molecule-1) (see Lps2), and TRAM for TRIF related adaptor molecule (also called TICAM-2) (see Tram KO).  Similar to ITAM-containing immune receptor signaling, The TLR signaling pathway culminates in MAPK and NF-κB activation resulting in the production of proinflammatory cytokines (89).  Macrophages and DCs from PLC-γ2 deficient animals display abnormal calcium mobilization and reduced production of proinflammatory cytokines in response to peptidoglycan (PGN), a Gram-positive bacterial cell wall component recognized by TLR2 (see the record for languid), and lipopoysaccharide (LPS), a Gram-negative bacterial component recognized by TLR4 (see the record for lps3) (50).

 

There are no known mutations in the human PLCG2 gene.  However, loss of PLC-γ2 signaling in B cells underlies the immunodeficiency syndrome X-linked agammaglobulinaemia (OMIM #300755), which results from mutations in BTK (90)

Putative Mechanism

B cell responses are classified as T-dependent (T-D) or T-independent (T-I) based on their requirement for T cell help in antibody production. T cell-dependent antigens are processed and presented to helper T cells via the MHC class II molecules, and induce a long-lasting immune response that includes the formation of memory B and T cells, and the production of high-affinity antibodies of multiple isotypes.T-I antigens are divided into type I and type II.  The former are mitogenic stimuli such as lipopolysaccharide (LPS), CpG DNA, or poly-IC (a double-stranded RNA mimetic) that elicit polyclonal B cell activation via Toll-like receptors (TLRs), while the latter are polysaccharides that cannot be processed and presented by MHC molecules.  These antigens are often expressed on the surface of pathogens in an organized, highly repetitive form that can activate specific B cells by cross-linking of antigen receptors.  The formation of antigen receptor clusters can recruit and activate multiple Btk molecules, resulting in long-term mobilization of intracellular ionized Ca2+, gene transcription and B cell activation and proliferation. T-I type II antigens elicit robust antigen-specific primary and memory responses. The T-D B cell response is mediated by conventional B-2 cells, while T-I B cell responses are mediated by B-1 and marginal zone B cells [reviewed by (91;92)]. 

 

As described above, Plcg2 knockout animals display abnormal T-I responses with severely reduced levels of serum IgM and IgG3, but relatively normal T-D responses (47;48). These results are likely due to the B-1 cell deficiency reported in these animals, while the persistence of some peripheral B-2 cells allows the development of a T-D response.  These findings are consistent with the phenotypes observed in queen mice, and mirror those found in mice with deficiencies in other BCR signaling molecules. 

 

The queen mutation alters an amino acid located in the X-box catalytic region of the protein.  The X domain is generally highly conserved amongst PLC isozymes, but Ile 346 is not always conserved and has not been previously implicated as one of the critical catalytic residues.  Nevertheless, Ile 346 is located near important catalytic residues and the phenotype of queen mice suggests that this residue must have some role in the function of PLC-γ2.  However, the normal peripheral B cell development seen in queen mice as opposed to the reduced numbers of peripheral B cells in Plcg2 null alleles suggests that the queen mutation may be hypomorphic. The numbers of B-1 cells in queen animals have not been examined. 

Primers Primers cannot be located by automatic search.
Genotyping
Queen genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 
 
Primers
Queen(F): 5’- TTTCTGCTGATACCCAGAGCCCAG -3’
Queen(R): 5’- TGCACCAGCCAATCTATTGCCC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for sequencing
Queen_seq(F): 5'- GGTCTCCAAAAGGTCCATACTGTC -3'
Queen_seq(R): 5'- AAGCACTGAGCAATCGTAGC -3'
 
The following sequence of 717 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 8, bases 120,105,246 to 120,105,961) is amplified:
 
	ttctgctgat acccagagcc cagtgggcag ctccaggggt cattagcgcg ggttctgctt
        cgtcttcact cctgacaccc tcagctcagg tctccaaaag gtccatactg tcttcattgc
        attcagattg cttaggtagc tatcgtgcac atcttattgg tggttctgga cccaagacct
        caggatggcg tgcgtgtggc ccagacctta gcctgggtgt ttctccatca gaagatcttg
        ggctcagacg gtctccaagc atgaactgtg tacaggattg cctctctgac tcgggtcatt
        ctgtccctca ggtacctcac tggggaccag ctgcgtagtg agtcctccac ggaagcgtat
        atccgctgtc tgcgcgctgg ttgccgctgc attgagcgtg agttttccgt cttagccaag
        atgatgcaat aagcaaagct acgattgctc agtgcttgct tgttgctttt attttatttt
        acgtgtgtgt gtgtgtgtgt gtgtgtgtgt gtatgagaca gagagggaga gggagaggga
        gagggaaaga gagagagact tcagttttgg tgggagatgg ggagggagac aggctgagaa
        gtccccatgc agagcaactc taggcaggga actgaggtga ctaaggattt tttcctaaaa
        gataactgtc cccaagcaaa agtgacatct ggttgggcaa tagattggct ggtgca       
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine, Katherine Timer
AuthorsCarrie N. Arnold, Elaine Pirie, and Bruce Beutler
Edit History
08/08/2011 9:21 PM (current)
08/05/2011 2:39 PM
05/09/2011 1:59 PM
01/07/2011 8:03 AM
12/08/2010 3:40 PM
12/02/2010 9:05 AM
11/30/2010 10:36 AM
11/10/2010 1:25 PM
11/10/2010 10:39 AM
11/10/2010 10:17 AM
11/10/2010 10:17 AM
11/10/2010 9:21 AM
11/10/2010 9:19 AM
11/08/2010 3:51 PM
11/08/2010 3:51 PM
11/08/2010 3:47 PM