Phenotypic Mutation 'Nd1' (pdf version)
AlleleNd1
Mutation Type missense
Chromosome11
Coordinate59,565,974 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Nlrp3
Gene Name NLR family, pyrin domain containing 3
Synonym(s) Cias1, cryopyrin, Pypaf1, NALP3, Mmig1
Chromosomal Location 59,541,568-59,566,955 bp (+)
MGI Phenotype Strain: 3686871
Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning.
Accession Number

NCBI RefSeq: NM_145827; MGI: 2653833

Mapped Yes 
Amino Acid Change Cysteine changed to Tryptophan
Institutional SourceBeutler Lab
Ref Sequences
C987W in Ensembl: ENSMUSP00000078440 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:PAAD_DAPIN 4 87 8.6e-24 PFAM
Pfam:NACHT 216 385 1.3e-46 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
(Using Ensembl: ENSMUSP00000078440)
Phenotypic Category immune system, NALP3 inflammasome signaling defect
Penetrance 100% 
Alleles Listed at MGI

All alleles(10) : Targeted, knock-out(3) Targeted, other(4) Chemically induced(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59565943 missense probably damaging 1.00
IGL00573:Nlrp3 APN 11 59565116 missense probably benign 0.20
IGL01025:Nlrp3 APN 11 59551887 missense probably benign 0.06
IGL01637:Nlrp3 APN 11 59549378 missense probably damaging 1.00
IGL02010:Nlrp3 APN 11 59549535 missense probably benign 0.00
IGL02116:Nlrp3 APN 11 59549184 missense probably damaging 1.00
IGL02334:Nlrp3 APN 11 59565083 missense probably benign 0.00
IGL02417:Nlrp3 APN 11 59566023 splice site 0.00
IGL02578:Nlrp3 APN 11 59548401 missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59565976 missense probably damaging 1.00
IGL02816:Nlrp3 APN 11 59555782 missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59549546 missense possibly damaging 0.65
IGL03334:Nlrp3 APN 11 59549016 missense probably damaging 1.00
Nd14 UTSW 11 59555875 missense
Nd3 UTSW 11 59565974 missense probably benign 0.33
Nd5 UTSW 11 59565879 missense probably benign 0.00
Nd6 UTSW 11 59549354 missense possibly damaging 0.59
Nd7 UTSW 11 59555875 missense probably damaging 0.99
Nd9 UTSW 11 59549354 missense possibly damaging 0.59
Park2 UTSW 11 59565128 nonsense probably null
Park3 UTSW 11 59565850 missense probably benign 0.02
Park4 UTSW 11 59549531 missense probably benign 0.19
Park5 UTSW 11 59548476 missense probably damaging 0.99
Park6 UTSW 11 59549036 missense probably damaging 1.00
Park7 UTSW 11 59548010 nonsense probably null
Park8 UTSW 11 59566199 missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59565128 nonsense probably null
R0362:Nlrp3 UTSW 11 59548797 missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59555924 splice donor site probably benign
R0649:Nlrp3 UTSW 11 59548542 missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59548256 missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59565850 missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59555768 missense possibly damaging 0.86
R1622:Nlrp3 UTSW 11 59548476 missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59543123 missense probably benign 0.01
R1715:Nlrp3 UTSW 11 59543351 missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59558402 missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59548916 missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59549036 missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59549136 missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59549661 missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59548010 nonsense probably null
R4540:Nlrp3 UTSW 11 59551899 missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59549222 missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59548301 missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59549238 missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59566199 missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59565084 missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59549063 missense probably damaging 1.00
R5869:Nlrp3 UTSW 11 59548134 missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59546852 missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59546791 missense probably benign
R5979:Nlrp3 UTSW 11 59548971 missense probably benign 0.06
Z1088:Nlrp3 UTSW 11 59551860 missense possibly damaging 0.67
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm, gDNA
MMRRC Submission 032646-UCD
Last Updated 03/02/2017 12:19 PM by Katherine Timer
Record Created 11/10/2009 12:00 AM
Record Posted 05/07/2010
Phenotypic Description
Figure 1.

The ND1 phenotype was initially identified among G3 mice homozygous for mutations induced by N-ethyl-N-nitrosourea (ENU) and tested in the NALP3 Inflammasome Screen (D3891, D3892 and D3893; Figure 1).  Peritoneal macrophages isolated from both ND1 homozygous and heterozygous mice secreted reduced amounts of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 1), with heterozygotes producing IL-1β at a level intermediate between that produced by wild type and homozygous macrophages.  ND1 mice produced normal levels of tumor necrosis factor (TNF)-α in response to LPS stimulation alone, suggesting that signaling from the Toll-like receptor 4 (TLR4), which senses LPS, was unimpaired. 

Nature of Mutation
The Nlrp3 gene was directly sequenced as a candidate gene and a T to G transversion was found at position 3187 of the Nlrp3 transcript in exon 9 of 10 total exons using Genbank record NM_145827. The mutation is located in the eighth coding exon.
 
3170 TGCGTGGTGACCCTCTGTGAGGTGCTGAAACAG
982  -C--V--V--T--L--C--E--V--L--K--Q-
 
The mutated nucleotide is indicated in red lettering, and causes a cysteine to tryptophan substitution at residue 987 of the NLRP3 protein.
Protein Prediction
The Nlrp3 gene encodes a 1033 amino acid protein that is a member of the nucleotide-binding and oligomerization domain (NOD)-like receptor (NLR) or CATERPILLER [for CARD, transcription enhancer, R(purine)-binding, pyrin, lots of leucine repeats] family (1). The structure of NLRs resembles that of a subset of plant disease-resistance (R) proteins that are involved in the hypersensitive response to virulent plant pathogens. Both NLRs and R proteins contain a C-terminal leucine-rich repeat (LRR) domain, a central oligomerization NACHT usually with a C-terminal extension known as the NACHT associated domain (NAD), and an N-terminal effector domain. The N-terminus of R proteins often contains a Toll/interleukin-1 receptor (TIR) domain, while NLRP3 contains a pyrin domain (PYD) at this location. Other N-terminal NLR domains include the caspase-recruitment domain (CARD) and the baculovirus inhibitor of apoptosis protein repeat (BIR) (2;3). NLRP3 (NLR family, pyrin domain containing protein 3) is also known as NALP3, PYPAF1 and cryopyrin (1;4). Human and mouse NLRP3 are highly conserved with 82.7% amino acid identity (5;6)
 

Figure 2. Domain structure of NLRP3. Shown are the pyrin domain (PYD), NACHT domain, NACHT associated domain (NAD), and leucine-rich repeat (LRR) domain. Together, the NACHT and NAD domains are known as the nucleotide-binding domain (NBD). The amino acid altered by the ND1 mutation is shown. Click on the image to view other mutations found in NLRP3. Click on each mututation for more specific information.

The NLRP3 PYD occurs at amino acids 1-91. This domain bears similarity to death domains (DDs), death effector domains (DEDs), and CARDs that are found in many proteins involved in apoptosis and inflammation. All of these domains function in protein-protein interactions and contain an antiparallel six-helical bundle with Greek-key topology and internal pseudo-twofold symmetry. A core of hydrophobic residues forms the core of the pyrin domain fold (7). Pyrin domains are capable of interacting specifically with PYDs found in other proteins, and the PYD of NLRP3 binds to the PYD of apoptosis-associated speck like protein (ASC) (8;9) (see Background).
 
The NACHT domain is a 300 to 400 residue predicted nucleotide triphosphatase (NTPase) domain, which is found in animal, fungal and bacterial proteins. The name NACHT is derived from the four plant and animal proteins which initially defined the unique features of this domain: the neuronal apoptosis inhibitory protein (NAIP), MHC class II transcription activator (CIITA), incompatibility locus protein from Podospora anserina (HET-E), and telomerase-associated protein (TP1). In NLR proteins, the NACHT and NAD, also known as the NBD (nucleotide-binding domain), consists of twelve distinct conserved motifs, including the ATP/GTPase specific P-loop (Walker A motif), and the magnesium (Mg2+)-binding site (Walker B motif) (10;11). The Walker A motif contains the sequence GKS/T corresponding to amino acids 227-229 in mouse NLRP3 with the lysine coordinating the γ-phosphate of NTPs (6;12). The unique features of the NACHT domain include the prevalence of small residues (glycine, alanine or serine) directly C-terminal of the Mg2+-coordinating aspartate in the Walker B motif, in place of a second acidic residue prevalent in other NTPases. A second acidic residue is typically found in the NACHT-containing proteins two positions downstream. Distal to the Walker A and B motifs, these domains also a conserved pattern of polar, aromatic and hydrophobic residues that is not seen in any other NTPase family (10). Modeling studies of the NLRP3 NACHT domain suggests that it consists of a five-stranded β-sheet surrounded by α-helices with the Walker A, Walker B, and a sensor motif containing a conserved polar residue found at the end of the parallel strands forming the nucleotide-binding site. The NAD extension of the NLRP3 NACHT domain consists of three helical subdomains (13;14). The NACHT domain of NLRP3 specifically displays ATPase activity, and mutation of Walker A and B motifs reduces ATP binding, as well as NLRP3 protein function including caspase-1 activation, IL-1β production, cell death, macromolecular complex formation, self-association, and association with ASC (see Background). Disruption of nucleotide binding also abolishes the constitutive activation of disease-associated mutants (12). The mouse NLRP3 NBD comprises amino acids 216-532.  
 
LRR-containing domains generally consist of 2-45 motifs of 20-30 amino acids in length, which are predicted to fold into an arc or horseshoe shape (15). LRRs occur in proteins ranging from viruses to eukaryotes, and appear to provide a structural framework for the formation of protein-protein interactions. Proteins containing LRRs include tyrosine kinase receptors, cell-adhesion molecules, virulence factors, and extracellular matrix-binding glycoproteins, and are involved in a variety of biological processes, including signal transduction, cell adhesion, DNA repair, recombination, transcription, RNA processing, disease resistance, apoptosis, and the immune response where they are suggested to bind to and sense molecules that trigger inflammation (2). Sequence analyses of LRR proteins suggests the existence of several different subfamilies of LRRs (16), but all major classes of LRRs have curved horseshoe structures with a parallel β-sheet on the concave side and mostly helical elements on the convex side. Eleven-residue segments of the LRRs (LxxLxLxxN/CxL), corresponding to the β-strand and adjacent loop regions, are conserved in LRR proteins, whereas the remaining parts of the repeats may be very different. Despite the differences, each of the variable parts contains two half-turns at both ends and a "linear" segment, usually formed by a helix, in the middle. The concave face and the adjacent loops are the most common protein interaction surfaces on LRR proteins. 3D structures of some LRR proteins-ligand complexes show that the concave surface of LRR domain is ideal for interaction with α-helical structures. Molecular modeling suggests that the conserved pattern LxxLxL, which is shorter than the previously proposed LxxLxLxxN/CxL, is sufficient to impart the characteristic horseshoe curvature to proteins with 20- to 30-residue repeats (15;17). The LRR-containing domain of NLRP3 is thought to bind to the NBD domain preventing oligomerization and protein activation (2), but has also been shown to associate with thioredoxin-interacting protein (TXNIP) (18).
 
It is not clear how many LRRs NLRP3 contains as anywhere from seven to twelve have been reported for mouse and human proteins (4-6;9). Both human and mouse NLRP3 undergo extensive alternative splicing of coding exons 4-9, resulting in mRNAs of varying sizes detected in peripheral blood leukocyte cDNA (5;6)
 
The ND1 mutation results in a cysteine to tryptophan change in coding exon 8. Depending on the prediction program used, this residue may occur in the second to last LRR, the final LRR, or falls just outside the LRR domain.
Expression/Localization
In mice, Nlrp3 mRNA is detectable using RT-PCR analysis in all tissues examined, except the thymus (19). Particularly high levels were reported in the eye and skin, as well as peripheral blood leukocytes (6;9)Nlrp3 mRNA is expressed in a variety of resting immune cells, including macrophages, dendritic cells, and neutrophils, and is seen at low levels in B cells and T cells (6;19;20). The expression of Nlrp3 mRNA was upregulated in a subset of helper T cells (Th2), while expression in macrophages is increased by LPS stimulation (19). In murine lungs infected with influenza virus, Nlrp3 mRNA is also detectable in mouse airway epithelial cells (20), and NLRP3 protein is detectable in pancreatic islet cells (18).
 
Unlike in mice, Northern blot analysis of human tissues found NLRP3 mRNA restricted to peripheral blood leukocytes (5). Human NLRP3 mRNA is also increased by TLR agonists (21). Both mouse and human osteoblasts express NLRP3 mRNA (22). In human immune cells, NLRP3 protein is detected in granulocytes, dendritic cells, B and T lymphocytes, and very weakly in monocytes. In other tissues, NLRP3 expression is mainly restricted to non-keratinizing epithelia in the oropharynx, esophagus, and ectodermic, and is found in the urothelial layer in the bladder. NLRP3 is predominantly cytoplasmic (23).
Background
Certain members of the NLR family, including IPAF (ICE protease-activating factor), NLRP1b, and NLRP3, are able to oligomerize through their NBD domains and assemble into large caspase-1-activating multiprotein complexes termed inflammasomes upon the detection of pathogenic or other danger signals in the cytoplasm. Initially, NLRP3 was shown to assemble a 700kDa, caspase-1 activating complex under certain in vitro conditions (24). Caspase-1 is a cysteine protease that is present under resting conditions in an inactive precursor form with an N-terminal CARD-containing prodomain capable of mediating homotypic interactions. The CARD domain of procaspase-1 recruits the protease to the inflammasome where it undergoes autoproteolytic maturation into its active form. Activated caspase-1 is able to cleave a variety of substrates, most notably the proinflammatory cytokines IL-1β, IL-18 and IL-33 to generate biologically active proteins. In turn, these cytokines mediate a wide variety of biological effects associated with infection, inflammation, and autoimmune processes in by activating key processes such as the nuclear factor κB (NF-κB; see the record for panr2) and mitogen-activated protein kinase (MAPK) pathways The adaptor protein ASC plays an important role in inflammasome assembly by binding to the NLRP3 PYD through its own PYD, and then recruiting procaspase-1 to the complex through its CARD domain [reviewed by (25)]. Another CARD-containing adaptor protein, human CARDINAL, has been shown to be part of a reconstituted human NLRP3 inflammasome, but the functional role for this protein is unclear as no murine homolog for CARDINAL has been identified (26). The association of NLRP3 with a molecular chaperone complex consisting of HSP90 and the ubiquitin ligase–associated protein SGT may also be important for the assembly of the NLRP3 inflammasome (27).
 
Figure 3. NLRP3 inflammasome pathway. NLRP3 is present in the cytosol in an inactive conformation state due to its association with the SGT1/HSP90 chaperone complex. The NLRP3 inflammasome is activated by a wide variety of agents. Several activators have been shown to generate pore formation by a pannexin hemichannel that may allow extracellular molecules access to the cytoplasm and contact with NLRP3. Extracellular ATP mediates inflammasome activation through the P2X7 ATP-gated ion channel, triggering rapid K+ efflux from the cell (decreased potassium (K+) concentration may favor inflammasome assembly). Rupture of lysosomes containing certain particulates releases Cathepsin B into the cytoplasm, activating the inflammasome. NLRP3 activators may also trigger inflammasome assembly by generating reactive oxygen species (ROS), often produced under situations of cellular stress. The inactive state of caspase-1 contains a CARD-containing prodomain. Oligomerization of NLRP3 and the recruitment of caspase-1, ASC, and CARDINAL leads to the autoproteolytic maturation of caspase-1. Caspase-1 is capable of cleaving pro-1L-1β, pro-IL-18, and pro-IL-33. These mature cytokines mediate a variety of biological effects by activating key processes such as the nuclear factor κB and mitogen-activated protein kinase (MAPK) pathways.   
Unlike the IPAF and NLRP1b inflammasomes that assemble in response to a relatively few known stimuli (25), the NLRP3 inflammasome has now been shown to be activated in response to diverse agents that include pathogens, DNA, single-stranded (ss) RNA, double-stranded (ds) RNA, bacterial toxins, environmental irritants as well as endogenous danger signals [reviewed by (3;28)] (Table 1). The diversity of these molecules suggests that many of them are likely to activate the NLRP3 inflammasome indirectly through convergent mechanisms, and many NLRP3 activators generate several common cellular events. One of these is a decrease in cytoplasmic potassium (K+) concentration (29;30). The mechanism behind this effect is not known, but low K+ may favor inflammasome assembly. In addition, several activators have been shown to generate pore formation by a pannexin hemichannel that may allow extracellular molecules access to the cytoplasm and contact with NLRP3 [reviewed by (3)]. Extracellular ATP released at sites of cellular injury or necrosis, mediates inflammasome activation through the P2X7 ATP-gated ion channel, triggering rapid K+ efflux from the cell and recruitment and pore formation by Pannexin 1 (31). Similarly, pore formation by various toxins may allow the entry of NLRP3 activators into the cell and K+ efflux (29). However, many NLRP3 activators are far too large to enter the cell in this manner. Multiple studies suggest that phagocytosis of particulates like MSU, silica, asbestos and alum is necessary for their activation of the NLRP3 inflammasome (32-36). Inefficient clearance of the activating particle then leads to phagosomal destabilization, lysosomal rupture and release of the lysosomal protein cathepsin B into the cytoplasm, triggering inflammasome activation by an unknown mechanism. However, it is unclear whether cathepsin B release is strictly necessary for NLRP3 activation (3). Finally, NLRP3 activators may also trigger inflammasome assembly via the generation of reactive oxygen species (ROS), which are often produced under situations of cellular stress. All NLRP3 activators that have been examined produce short-lived ROS, and treatment with various ROS scavengers can block NLRP3 activation (30;34). NLRP3 binding to TXNIP (see Protein Prediction) occurs in a ROS-dependent manner, and links inflammasome activity to the pathogenesis of type 2 diabetes mellitus (18;28)
 
Table 1. NLRP3 inflammasome activators
 
Activator Class
Activator
Disease Associations
Proposed signaling pathway
Refs
 
 
 
 
 
 
 
Whole microbes
Sendai virus
Infection
?
(37)
Influenza virus
Infection
ROS and lysosomal rupture
(20;37;38)
Adenovirus
Infection
ROS
(39)
Candida albicans
Infection
ROS
Saccaromyces cerevisiae
Infection
ROS
(40)
Staphylococcus aureus
Infection
ROS
(43)
Listeria monocytogenes
Infection
ROS
(29;44)
Shigella flexneri
Infection
Lysosomal rupture
(45)
 
  
 
Microbe-associated molecules
Bacterial pore-forming toxins (aerolysin,maitotoxin nigericin, listeriolysin, Mycobacterium tuberculosis protein ESAT-6)
Infection
ROS and pannexin channel formation
Hemozoin
Cerebral malaria
ROS
(49)
 
 
  

 

 
Endogenous signals
Extracellular ATP
Injury or necrotic cell death
ROS and pannexin channel formation
(30;31;50)
Hyaluronan
Injury
Lysosomal rupture
(51)
Glucose
Metabolic syndrome
ROS
(18)
Monosodium urate (MSU)
Gout
ROS
(30;32)
Calcium pyrophosphate dehydrate (CPPD)
Pseudogout
ROS
(30;32)
Amyloid-β
Alzheimer’s disease
Lysosomal rupture
(36)
 
 
 
 
 
 
  
Environmental irritants
Skin irritants
Contact hypersensitivity
ROS
(19;52)
UV light
Sunburn
ROS
(53)
Imidazoquinoline compounds
Antiviral
treatment
ROS
(37)
Silica
Silicosis
ROS and lysosomal rupture
Asbestos
 
Asbestosis
ROS and lysosomal rupture
(34)
Adjuvants (alum, QuilA, chitosan)
Vaccines
ROS and lysosomal rupture
(35;54;55)
 
 
Most studies have focused on the role of NLRP3 in immune cells due to the importance of the inflammasome in the innate immune system. However, other cell types and tissues also appear to initiate inflammation by activating NLRP3, including skin keratinocytes (19;52;53), and insulin-producing pancreatic β-cells (18). Interestingly, various immune cells differentially regulate the synthesis, processing and release of IL-1β. Macrophages first require an inflammatory stimulus (TLR ligand) to induce large intracellular stores of pro-IL-1β, followed by a second stimulus, such as extracellular ATP or bacterial toxins, resulting in activation of the NLRP3 inflammasome and release of active, mature IL-1β (19;56). Monocytes, however, only require stimulation with TLR ligands since they possess a constitutively activated caspase-1 (56). Effector and memory CD4+ T cells can suppress potentially damaging inflammation caused by inflammasome activity (57).
 
A total of 93 disease-associated mutations have been found in humans in the NLRP3 gene according to the Infevers database, an online database for autoinflammatory mutations (58-60). These mutations cause a range of phenotypes that encompass three autoinflammatory disorders: Muckle-Wells syndrome (MWS; #191900), familial cold autoinflammatory syndrome (FCAS1; OMIM #120100), and chronic infantile neurologic cutaneous and articular syndrome (CINCA; OMIM #607115), also known as NOMID for neonatal onset multisystem inflammatory disease (5;61;62). Collectively, these diseases are known as cryopyrin associated periodic syndrome (CAPS). CINCA syndrome is a severe chronic inflammatory disease of early onset, characterized by cutaneous symptoms, central nervous system involvement, and arthropathy (62). Familial cold autoinflammatory syndrome is characterized clinically by recurrent attacks of a maculopapular rash associated with arthralgias, myalgias, fever and chills, and swelling of the extremities after exposure to cold.  Muckle-Wells syndrome (MWS) is characterized by episodic skin rash, arthralgias, and fever associated with late-onset sensorineural deafness and renal amyloidosis (61). The vast majority of NLRP3 mutations causing these diseases are missense mutations, and most of them are found in the central coding exon 3 encoding the NBD and surrounding sequence with clustering occurring on one side of domain along the nucleotide-binding cleft in loops next to the parallel β-strands forming the NACHT domain (13;14). This region is predicted to be involved in intermolecular contacts. Human NLRP3 mutations result in enhanced inflammasome sensitivity and activity leading to elevated levels of IL-1β, and these diseases are often treated by IL-1β inhibitors (63;64). Recently, polymorphisms in regulatory elements that cause decreased NLRP3 expression and IL-1β production were linked with increased susceptibility to Crohn’s disease (OMIM #266600(65).  
 
Macrophages from Nlrp3 knockout mice display deficient responses to stimuli that normally activates the NLRP3 inflammasome, and display decreased secretion of IL-1β and IL-18 (19;29;32;37). Accordingly, NLRP3-deficient animals are more susceptible to various pathogenic organisms including influenza (20;38), adenovirus (39), and C. albicans (41;42). Mice carrying mutations corresponding to activating human NLRP3 variants have also been generated (66;67). These animals display spontaneous autoinflammatory disease, although the symptoms appear more severe than in humans, ranging from severe skin inflammation with neutrophilic infiltration associated with poor health (67) to widespread inflammation of many organs and death before weaning (66). Genetic background may contribute to disease severity. Examination of inflammasome activity in these animals showed a hypersensitive response and increased production of proinflammatory cytokines in response to NLRP3 stimuli. Most of the amino acids where human disease-causing mutations occur are conserved in the mouse (6)
Putative Mechanism
None of the activating human NLRP3 mutations occur in coding exon 8 where the ND1 mutation occurs, and the ND1 mutation in mice is likely to be an inactivating rather than an activating mutation of Nlrp3. ND1 mice have not been tested in vivo for immunodeficient or autoimmune phenotypes, but macrophages from these animals are not responsive to NLRP3 activators, suggesting that the NLRP3 protein in these animals, if expressed, is inactive or has reduced activity. There are no known inactivating mutations in NLRP3 in humans, although mutations in the regulatory regions of the NLRP3 gene are associated with reduced NLRP3 expression and Crohn’s disease (65). The vast majority of the activating mutations that cause autoinflammatory disorders reside in exon 3, which encodes the NBD and surrounding sequences. These data strongly suggest that mutation of the NBD, perhaps rendering the protein permanently able to bind to and hydrolyze ATP or unable to bind to the inhibitory LRRs that prevent self-oligomerization, is the basis behind constitutive activation of the protein. Only three mutations have been identified in humans occurring outside of exon 3 that cause disease. Two of these occur in exon 4 and one occurs in exon 6. Both of these exons are predicted to encode LRRs. As the LRRs are thought to bind to the NBD and inhibit inflammasome formation, it is likely that these mutations lead to defective inhibition by the LRRs of the NBD and increased inflammasome activity.
 
The ND1 mutation occurs at amino acid 987 near the C-terminus of the protein. It is unclear whether this residue is located within the LRR domain or not, but may affect the function of the LRR domain. In addition to inhibiting the NBD, the LRRs of NLRP3 may be involved in sensing activating stimuli. The association of the NLRP3 LRR domain with TXNIP, resulting in inflammasome activation, supports this hypothesis (18). Thus, mutation of the LRRs could result in decreased protein activity instead of increased protein activity depending on the residues affected. The mutation of residues important for self-binding may lead to constitutive protein activation, while mutating residues that are important in binding to other molecules may lead to decreased protein function. Alternatively, mutations in these regions could disrupt the characteristic structure of the LRR repeats, indirectly affecting protein-protein interactions. The semidominant nature of the ND1 mutation is likely due to the aberrant protein product oligomerizing with wild type protein and rendering the entire inflammasome unresponsive to stimuli.
 
Primers Primers cannot be located by automatic search.
Genotyping
ND1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 
 
Primers
ND1(F): 5’- ACAGCTTAAAGGCTAAGCCCCTGC -3’
ND1(R): 5’- TTCCACGCCTACCAGGAAATCTCG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for sequencing
ND1 _seq(F): 5'- GGTTGGCTTCGAACTCAGAAATC -3'
ND1 _seq(R): 5’- CTAAGGCACGTTTTGTTTCACG -3’
 
The following sequence of 921 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 11, bases 59,378,853 to 59,379,774) is amplified:
 
                                                                                acagc ttaaaggcta
agcccctgcc accacagtcc tgccaactgc aaacattcat ttggtccatt gatactttgt
ggaaatctga ggggaacata atgtttagaa aaagtcaatt gacaaatttc tgttactatt
ttggtctgtt caacccagta ccttgggaaa agaaacttcc atctaaagag gggagaaaag
aaaccatatc atatgaagca gcttcacgct ggtcagtctg tggtttgttg ttgttgttgt
tttcaagaca gggtttatct gtgtagccct ggcttgcctg gaactcactc tgtagaccag
gttggcttcg aactcagaaa tccgcctgct tctgcctccc aagtgctggg attaaaggtg
tgcaccacca ctgcccagcc caatctgcgc tttttatgca aatgaaactg caggtttgga
gacccggaag tatggatggt caaggctatt ttctttatat cacccttctc ttctcaaaga
ttagacaact gcagcctcac ctcacacagc tgctggaatc tctccacaat tctgacccac
aaccacagcc ttcggaagct gaacctgggc aacaatgatc ttggcgatct gtgcgtggtg
accctctgtg aggtgctgaa acagcagggc tgcctcctgc agagcctaca gtgagtgtgg
tttgcctaga gcttctcatg gggtaggcga gcggggtgct gaggggaggg tgaccacggg
acaaaagtca gagtttctct ggattaattt gcagttttct gaagagtcca actcaaagct
tcttttctgt gttcacaggt tgggtgaaat gtacttaaat cgtgaaacaa aacgtgcctt
agaagcgctc caggaagaaa agcctgagct gactatagtc ttcgagattt cctggtaggc
gtggaa
       
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
References
67. Meng, G., Zhang, F., Fuss, I., Kitani, A., and Strober, W. (2009) A Mutation in the Nlrp3 Gene Causing Inflammasome Hyperactivation Potentiates Th17 Cell-Dominant Immune Responses. Immunity. 30, 860-874.
Science Writers Nora G. Smart
Illustrators Diantha La Vine, Katherine Timer
AuthorsHua Huang, Bruce Beutler
Edit History
05/24/2011 11:02 AM (current)
05/24/2011 10:56 AM
05/24/2011 10:43 AM
04/24/2011 11:59 AM
03/15/2011 12:02 PM
11/08/2010 11:25 AM
10/27/2010 2:49 PM
10/19/2010 11:35 AM
07/08/2010 9:28 AM
07/08/2010 9:27 AM
07/01/2010 3:23 PM
06/25/2010 11:05 AM
06/25/2010 11:00 AM
05/07/2010 2:02 PM
03/16/2010 1:24 PM
03/16/2010 7:56 AM