Phenotypic Mutation 'sanroque' (pdf version)
List |< first << previous [record 15 of 17] next >> last >|
Allelesanroque
Mutation Type missense
Chromosome1
Coordinate160,940,830 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Rc3h1
Gene Name RING CCCH (C3H) domains 1
Synonym(s) roquin, 5730557L09Rik
Chromosomal Location 160,906,418-160,974,978 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing RING-type and C3H1-type zinc finger motifs. The encoded protein recognizes and binds to a constitutive decay element (CDE) in the 3' UTR of mRNAs, leading to mRNA deadenylation and degradation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: A single recessive mutation on this gene resulted in severe autoimmune disease with phenotype resembling human systemic lupus erythematosus. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001024952; MGI: 2685397

Mapped Yes 
Amino Acid Change Methionine changed to Arginine
Institutional SourceAustralian Phenomics Network
Ref Sequences
M199R in Ensembl: ENSMUSP00000124871 (fasta)
Gene Model not available
PDB Structure
X-ray structure of the ROQ domain from murine Roquin-1 [X-RAY DIFFRACTION]
X-ray structure of the ROQ domain from murine Roquin-1 in complex with a 23-mer Tnf-CDE RNA [X-RAY DIFFRACTION]
Crystal structure of N-terminus of Roquin [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
RING 14 53 1.25e-5 SMART
low complexity region 201 212 N/A INTRINSIC
Pfam:zf-CCCH 414 440 1.1e-1 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 728 750 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
coiled coil region 954 983 N/A INTRINSIC
low complexity region 1003 1011 N/A INTRINSIC
low complexity region 1093 1107 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.40; Specificity: 0.98)
(Using Ensembl: ENSMUSP00000124871)
Phenotypic Category
Phenotypequestion? Literature verified References
autoimmunity
immune system
Penetrance 100% 
Alleles Listed at MGI

All alleles(13) : Targeted(7) Gene trapped(5) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Rc3h1 APN 1 160955981 critical splice donor site probably null
IGL02302:Rc3h1 APN 1 160938105 splice site probably benign
IGL03053:Rc3h1 APN 1 160955817 missense probably benign
IGL03275:Rc3h1 APN 1 160959555 critical splice donor site probably null
curlyfry UTSW 1 160959399 critical splice acceptor site probably null
R0528:Rc3h1 UTSW 1 160967658 missense probably damaging 1.00
R0609:Rc3h1 UTSW 1 160930135 missense probably damaging 1.00
R1620:Rc3h1 UTSW 1 160954973 missense probably benign 0.02
R1661:Rc3h1 UTSW 1 160959423 missense probably benign 0.29
R1665:Rc3h1 UTSW 1 160959423 missense probably benign 0.29
R2027:Rc3h1 UTSW 1 160954937 missense probably benign 0.03
R2145:Rc3h1 UTSW 1 160930257 missense probably damaging 1.00
R2207:Rc3h1 UTSW 1 160940025 missense probably damaging 0.97
R2227:Rc3h1 UTSW 1 160963542 missense probably benign 0.07
R2348:Rc3h1 UTSW 1 160950860 missense probably damaging 1.00
R2925:Rc3h1 UTSW 1 160954976 missense probably damaging 1.00
R3977:Rc3h1 UTSW 1 160959399 critical splice acceptor site probably null
R5071:Rc3h1 UTSW 1 160959477 missense possibly damaging 0.76
R5177:Rc3h1 UTSW 1 160951652 missense probably damaging 1.00
R5410:Rc3h1 UTSW 1 160964963 missense possibly damaging 0.47
R5421:Rc3h1 UTSW 1 160951830 critical splice donor site probably null
R5699:Rc3h1 UTSW 1 160930253 missense probably damaging 1.00
R5873:Rc3h1 UTSW 1 160959501 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock None
MMRRC Submission 011119-UCD
Repository

MMRRC: 011119-UCD; Australian PhenomeBank: 4

Last Updated 2016-05-13 3:09 PM by Peter Jurek
Record Created 2010-01-26 2:15 PM by Nora G. Smart
Record Posted 2010-02-01
Phenotypic Description

The sanroque phenotype was identified in a screen of ethylnitrosourea (ENU)-mutagenized G3 mice, which were tested for the production of antinuclear autoantibodies (ANAs) (1). Homozygous sanroque females developed a positive ANA test by 6-7 weeks of age, while males became positive by 8-16 weeks (Figure 1A). Further analysis of the autoimmune phenotype revealed the presence of high-affinity antibodies against double-stranded DNA (dsDNA), focal proliferative glomerulonephritis with deposition of IgG-containing immune complexes, necrotizing hepatitis, anemia, and autoimmune thrombocytopenia. All of these symptoms are characteristic of the autoimmune disease systemic lupus erythematosus (SLE; OMIM #152700). 

 

In addition to autoimmunity, sanroque homozygous animals exhibit lymphadenopathy and splenomegaly caused by the formation of excessive numbers of follicular helper T (TFH) cells and germinal centers (GCs) (Figure 1B,C). These animals also produce excessive amounts of interleukin (IL)-21, and express high levels of ICOS (inducible costimulator) on CD4+ T cells (Figure 1D). Both IL-21 and ICOS are highly expressed by TFH cells (see Background). Large numbers of activated T cells accumulate in sanroque animals with age. Heterozygous sanroque animals have slightly elevated ICOS levels and moderate asymmetrical lymphadenopathy with ANAs developing after 20 weeks of age.

Nature of Mutation
The sanroque mutation was mapped to Chromosome 1, and corresponds to a T to G transversion at position 976 of the Rc3h1 transcript, in exon 5 of 20 total exons.
 
960 TTCCTTGGACCAGCGATGCAGGAGGAAGCTCTG
194 -F--L--G--P--A--M--Q--E--E--A--L-
 
The mutated nucleotide is indicated in red lettering, and results in a methionine to arginine substitution at amino acid 199 of the RC3H1 protein.
Protein Prediction

Figure 2. Roquin functional domains. The location of the sanroque mutation is indicated.  CC, Coiled-coil; RING1, E3 ubiquitin ligase zinc finger domain; ROQ, novel ROQ domain; CCCH, RNA-binding zinc finger.

 

RC3H1 or Roquin is predicted to be a 1,130-residue intracellular protein that is highly conserved across its full length from mammals to invertebrates. The protein contains several domains (Figure 2); an N-terminal RING-1 zinc finger at residues 14-53, a highly conserved novel protein domain (ROQ domain) at amino acids 131-360, a CCCH-type zinc finger domain at residues 419-438, followed by a proline-rich region, and finally a coiled-coil domain at amino acids 954-981 (1).

 

The RING-1 zinc finger present in Roquin conforms to the consensus for the E3 ubiquitin ligase family of proteins. The RING finger is a specialized type of zinc finger of 40 to 60 residues that binds two atoms of zinc, and is usually involved in mediating protein-protein interactions. In E3 uibquitin ligases, they bind to E2 ubiquitin-conjugating enzymes to mediate the ubiquitination of target proteins (2). There are two different variants, the C3HC4-type (or RING-1) and a C3H2C3-type (or RING-2). RING-1 motifs are defined as C-X2-C-X9-39-C-X1-3-H-X2-3-C-X2-C-X4-48-C-X2-D/C, where X is any amino acid (2;3). The 3D structure of the zinc ligation system is unique to the RING domain and is referred to as the 'cross-brace' motif. The RING-1 finger domain comprises eight potential metal ligands, with each zinc atom ligated tetrahedrally by either four cysteines or three cysteines and a histidine. The first pair of ligands (Cys1 and Cys2) share a zinc with the third pair (Cys4 and Cys5), and the second pair of ligands (Cys3 and His1) share a zinc with Cys6 and Cys7/Asp1 (3).

 

The C-X8-C-X5-C-X3-H type (CCCH-type) zinc finger in Roquin is similar to the RNA-binding zinc finger domains found in several proteins. Proteins containing this domain interact with AU-rich elements (AREs) in the 3’-untranslated regions (UTRs) of mRNAs, AAUAAA elements in pre-mRNAs, or C-rich mRNAs to regulate mRNA processing, stability and translation (4-8).

 

Domain deletion mutants of Roquin have determined that it is a complete ROQ domain that mediates the induction and localization of Roquin to stress granules (9).  Furthermore, this domain is necessary for the repression of Icos mRNA by Roquin (via an interaction with its 3’ UTR) in T cells (9).  The sanroque mutation appears to strengthen the binding of Roquin to mRNAs.  Athanasopoulous et al. propose that changes in Roquin binding to mRNAs could prevent their transfer to P-bodies or that the mutation could impair binding to another protein by changing the structure of the ROQ domain (9).  These changes would impair the binding of Roquin to target mRNA.

 

The sanroque mutation alters a conserved methionine residue located in a predicted α-helix in the highly conserved novel ROQ domain (Figure 2). The mutation does not destabilize the protein (1).

 

Expression/Localization

Rc3h1 mRNA transcripts are found ubiquitously in the mouse (Figure 3A; (1)). Similar expression levels are found across a wide range of human cell types and tissues according to the GNF SymAtlas

 

The Roquin protein localizes to cytoplasmic stress granules (Figure 3B), which are sites for regulating mRNA translation and decay (1;10).

 

Background

During normal immune responses, antigen-experienced T cells help antigen-specific B cells to make antibodies. T cell help to B cells allows the production of high-affinity memory B cells and long-lived plasma cells that are specific for foreign antigens, and occurs in secondary lymphoid organs (SLOs), such as the lymph nodes, spleen, and Peyer’s Patches (PPs). In these tissues, immunization results in the appearance of germinal centers (GCs) within B cell follicles that are sites of intense B cell proliferation, selection, maturation and death during antibody responses. SLOs provide the ideal microenvironment for T cells and B cells to interact with each other and with other cell types such as dendritic cells (DCs) and follicular dendritic cells (FDCs). CD4+ T cells are essential for this process. Although several subsets of CD4+ T cells may contribute to antibody responses, it is now known that TFH are the most critical cell type [reviewed by (11;12)] (Figure 4). TFH cells are antigen-experienced T cells that localize to B cell follicles by expressing the chemokine receptor CXCR5, which recognizes CXCL13 produced by follicular stromal cells (13). B cells interact with TFH through the pairing of T cell and B cell surface ligands and receptors such as CD40 with its ligand, CD28 with B7 ligands, and ICOS with ICOS ligand (ICOSL). This interaction results in the secretion by TFH cells of cytokines particularly IL-10 and IL-21, which are known to promote B cell survival, proliferation, and antibody production (14;15). IL-21 is also critical for the formation of TFH cells after immunization (16;17). Other molecules that are highly expressed by TFH cells and needed for their differentiation, are the intracellular adaptor protein SAP (SLAM-associating protein), SAP-associating transmembrane receptors CD84 and CD229 (Ly9), the protein tyrosine kinase FynT, and the GC-restricted transcription factor Bcl-6 (12;18-20)

 

Autoimmune diseases, such as SLE or type I diabetes (OMIM %222100), result from failures of the immune system to repress self-reactive T cell responses and the formation of autoantibodies. SLE has highly variable clinical manifestations but is typically characterized by the formation of autoantibodies against cell nuclear components including dsDNA, ribonucleic proteins, and histones. Although extrafollicular autoantibody development can occur (18), one mechanism for the formation of these ANAs may be the aberrant selection of B cells producing self-reactive antibodies within GCs during T-dependent B cell responses (19). Exclusion of self-reactive B cells from GCs is defective in SLE patients (20), and GCs form in the absence of immunization in several mouse models of lupus (21). Furthermore, these mice often exhibit increased numbers of TFH cells, suggesting that dysregulation of the GC response by excessive formation of TFH cells can induce autoimmunity (1;14;22)

 

In T cells, T cell receptor (TCR) engagement by major histocompatibility (MHC) complexes on antigen presenting cells (APCs) only triggers T cell activation when a second costimulatory receptor on the T cell, CD28, is simultaneously activated by B7 proteins induced on APCs upon exposure to microbes (21). ICOS is a CD28-like costimulatory molecule that is critical for TFH function, although it also plays a general role in T cell differentiation, cytokine secretion, and survival (22;23). Unlike CD28, which is constitutively expressed, ICOS expression is upregulated following T cell activation, and is influenced by both TCR and CD28 signaling. ICOS-L, on the other hand, is constitutively expressed on APCs, making tight regulation of ICOS expression necessary in order to avoid unnecessary T cell activity and the development of autoimmune diseases [reviewed by (24)]. Both ICOS and CD28 can stimulate the same signaling pathways and may have some overlapping functions (24;25). However, CD28 is able to produce IL-2, which is important for cytotoxic T and regulatory T cell function (26), while ICOS is a much stronger inducer of IL-10 and is critical for T cell-dependent B cell responses (24;27).

 

ICOS and ICOSL-deficient mice display abnormalities in baseline serum levels of class-switched antibodies and GC formation (28-32), although they are able to mount appropriate immune responses to T-independent antigens (28;32). Furthermore, Icos-/- animals have reduced numbers of TFH cells (33). These phenotypes demonstrate the importance of ICOS signaling in TFH formation and T cell-dependent antibody responses. Humoral immunodeficiency is also found in mice deficient for the IL-21 receptor (34), while Il-21-/-animals exhibit defects in TFH formation and optimal GC responses (13;15). Mice deficient for CD40 or CD40L, CXCR5, and SAP all exhibit hypogammaglobulinemia, impaired ability to form GCs and a reduction in TFH numbers (29;35;36). Conversely, overexpression of IL-21 or an ICOS-L Fc fusion protein results in excessive GC B cells and antibody production (24;37), paralleling the phenotypes found in sanroque mice (1). Despite these similarities, IL-21 deficiency in homozygous sanroque animals does not alleviate their autoimmune phenotypes or excessive TFH numbers (14). It is also surprising that overexpression of ICOS in T cells of ICOS transgenic mice leads to an immunodeficient phenotype closely resembling ICOS deficient animals (38). The constant and unregulated expression of ICOS may result in ICOSL down-regulation, resulting in loss of ICOS signaling.    

 

ICOS-deficient mice are resistant to experimentally induced models of the autoimmune diseases rheumatoid arthritis (OMIM #180300) and the neuromuscular disorder myasthenia gravis (OMIM #254200) (28;39), while increased ICOS expression in activated T cells of non-obese diabetic (NOD) mice was essential for the development of disease in these animals (31). Similarly, ICOS blockade attenuates the development of multiple autoimmune diseases in mice (24). Conversely, ICOS-deficient mice are susceptible to experimental autoimmune encephalitis (EAE), a mouse model of multiple sclerosis (OMIM #126200) (30), and some ICOS positive T cells may possess a regulatory function (29).

 

In humans, ICOS deficiency causes a form of common variable immunodeficiency (CVID; #240500), a heterogeneous group of disorders characterized by hypogammaglobulinemia, antibody deficiency, and recurrent bacterial infections (24;32). ICOS-deficient patients displayed a severe reduction in CXCR5+ CD4+ T cells, which are likely to be TFH cells, as well as disturbed GC formation (33). CD40 and CD40L-deficient patients also show defects in GC formation and antibody class-switching resulting in hyper-IgM immunodeficiency (OMIM #308230, #606843(34), and  CD40L-deficient patients exhibited severe reductions in CXCR5+ CD4+ T cells. In addition, many autoimmune diseases show genetic linkage to the region containing the ICOS, CD28 and the related CTLA4 genes (24). Polymorphisms in the ICOS promoter region are associated with allergic sensitization (35) and celiac disease (OMIM #212750), with lower ICOS expression correlating with disease-associated markers (36). ICOS expression is increased on T cells in patients with SLE (37) and rheumatoid arthritis (38).

Putative Mechanism

Roquin has a RING finger zinc domain typical of the E3 ubiquitin ligase family. RING finger proteins covalently attach ubiquitin to a lysine on target proteins via an isopeptide bond (2). It is possible that Roquin may function as an E3 ubiquitin ligase, but its targets remain unknown. Instead, the major cause of autoimmunity in sanroque animals appears to be due to the accumulation of TFH cells caused by increased expression of ICOS. Roquin is critical for negatively regulating ICOS expression and appears to do so post-transcriptionally by mediating Icos mRNA degradation (16) (Figure 4). Overexpression or ectopic expression of wild-type Roquin, resulted in decreased levels of Icos mRNA and protein, while overexpression of the mutant protein reduced the repression of Icos mRNA (1;16)Icos mRNA contains a long 3’ UTR with six highly conserved segments. A 47-bp region of the UTR was found to be critical for Roquin-mediated repression of ICOS expression, and is complementary to T-cell-expressed microRNAs (miRNAs) including miR-101 (16). MiRNAs are a class of small non-coding RNAs of 20-22 nucleotides that base-pair with sites within the 3’ UTRs of target mRNAs and mediate post-transcriptional repression of gene expression either by inhibiting translation, or causing degradation. MiR-101 was found to be important in Roquin-mediated repression of Icos mRNA expression, and is differentially expressed in human naïve (high levels), memory (intermediate levels) and TFH (low levels) CD4+ cells, inversely correlating to ICOS expression in these T cell subsets (16)

 

A study examining the role of Roquin in T-lymphocyte-mediated immune responses found that AKT and JNK phosphorylation are required to modulate Roquin upon TCR engagement (40).   In this study, overexpression of Roquin in vitro (termed EL-4 cells) led to a decrease in ICOS expression and a significant increase in CD28.  Following stimulation with anti-CD3/CD28, mRNA levels of IL-2 and TNF-α in the EL-4 cells increased (40).  Following stimulation, the levels of phospho-AKT and phospho-JNK were increased in the EL-4 cells; phospho-ERK did not change. Treatment of the EL-4 cells with AKT and JNK inhibitors resulted in a reduction in the levels of IL-2 compared to comparably treated control cells expressing normal levels of Roquin.  This group also generated a transgenic mouse model that specifically overexpressed Roquin in T-cells (40).  Similar to the in vitro results, the levels of ICOS decreased and CD28 increased in CD4+ T cells upon anti-CD3/CD28 treatment in the transgenic animals.  Further characterization of the transgenic mice found that IL-2 was highly expressed in CD4+ T cells; TNF-α levels increased upon stimulation with anti-CD3/CD28 in the transgenic animals. 

 

In another study, the ablation of Roquin expression led to perinatal lethality by 6 hours after birth (41).  The knockout mice had curly tails, malformations of the caudal spinal column, and impaired lung function (41).  Conditional knockout of Roquin in T cells lead to an upregulation of ICOS; T cell development was not affected (41).  The conditional knockout mice had increased eosinophil and macrophage numbers.  In contrast to the sanroque animals, the conditional knockouts did not have increased follicular T helper cell differentiation or spontaneous germinal center formation (41).  In accounting for the differences observed between their conditional knockout model and the sanroque phenotype, Bertossi et al. propose that the loss of Roquin in other hematopoietic cells could synergize with its absence in T cells to induce autoimmunity (41).  In order to study this, Bertossi et al. generated a mouse model deficient in Roquin throughout the entire hematopoietic system.  In these animals, ICOS upregulation on CD4+ and CD8+ T cells was increased compared to the T-cell specific knockout, indicating that it is the changes in Roquin expression in non-T cell hematopoietic cells that alters the expression of ICOS (41).

 

The sanroque mutation alters a conserved methionine residue located in a predicted α-helix in the highly conserved novel ROQ domain. Replacement of this methionine by a charged arginine is likely to disrupt the local helical structure, but the protein is normally expressed and localized (1). The sanroque mutation is likely to be hypomorphic, as the altered protein is still able to mediate repression of target mRNAs, albeit at reduced levels (19). Several gene traps for the Rc3h1 gene have been made, but the phenotypes of knockout mice remain unreported.

 

Primers Primers cannot be located by automatic search.
Genotyping
Sanroque genotyping is performed by amplifying the region containing the mutation using PCR using three primers in the same reaction in order to amplify a 215 base pair mutant band and a 194 base pair wild type band.  Primer and PCR details are available from MMRRC.
 
References
  1. Vinuesa, C. G., Cook, M. C., Angelucci, C., Athanasopoulos, V., Rui, L., Hill, K. M., Yu, D., Domaschenz, H., Whittle, B., Lambe, T., Roberts, I. S., Copley, R. R., Bell, J. I., Cornall, R. J., and Goodnow, C. C. (2005) A RING-Type Ubiquitin Ligase Family Member Required to Repress Follicular Helper T Cells and Autoimmunity. Nature. 435, 452-458.
  5. Caput, D., Beutler, B., Hartog, K., Brown-Shimer, S., and Cerami, A. (1986) Identification of a Common Nucleotide Sequence in the 3'-Untranslated Region of mRNA Molecules Specifying Inflammatory Mediators. Proc. Natl. Acad. Sci. ,USA. 83, 1670-1674.
  6. Han, J., Brown, T., and Beutler, B. (1990) Endotoxin-Responsive Sequences Control cachectin/TNF Biosynthesis at the Translational Level. J. Exp. Med.. 171, 465-475.
  7. Kruys, V., Beutler, B., and Huez, G. (1993) Translational Control Mediated by UA-Rich Sequences. Enzyme. 44, 193-202.
  21. Prilliman, K. R., Lemmens, E. E., Palioungas, G., Wolfe, T. G., Allison, J. P., Sharpe, A. H., and Schoenberger, S. P. (2002) Cutting Edge: A Crucial Role for B7-CD28 in Transmitting T Help from APC to CTL. J. Immunol.. 169, 4094-4097.
Science Writers Nora G. Smart, Anne Murray
Illustrators Nora G. Smart
AuthorsCarola G. Vinuesa, Matthew C. Cook, Constanza Angelucci, Vicki Athanasopoulos, Lixin Rui, Kim M. Hill, Di Yu, Heather Domaschenz, Belinda Whittle, Teresa Lambe, Ian S. Roberts, Richard R. Copley, John I. Bell, Richard J. Cornall and Christopher C. Goodnow.
List |< first << previous [record 15 of 17] next >> last >|
Edit History
2011-01-11 3:16 PM (current)
2011-01-04 2:54 PM
2010-12-30 3:49 PM
2010-12-23 3:42 PM
2010-06-03 3:05 PM
2010-06-03 3:03 PM
2010-06-03 3:03 PM
2010-04-08 5:01 PM
2010-04-08 5:01 PM
2010-02-04 1:32 PM