Phenotypic Mutation 'rose'

• Allele: rose
• Mutation Type: missense
• Chromosome: 17
• Coordinate: 34,413,914 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Tap1
• Gene Name: transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
• Synonym(s): TAP, Ham1, RING4, MTP1, Tap-1, Ham-1, Abcb2, PSF-1
• Chromosomal Location: 34,406,530-34,416,199 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This protein forms a heterodimer with Tap2 that transports short peptides from the cytosol into the endoplasmic reticulum lumen. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009] ; PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are deficient in antigen presentation, surface class I antigens, and CD4-8+ T cells. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Valine
• Institutional Source: Australian Phenomics Network
• Gene Model: not available
• AlphaFold: P21958
• SMART Domains: Protein: ENSMUSP00000039264; Gene: ENSMUSG00000037321; AA Change: D615V

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	37	59	N/A	INTRINSIC
transmembrane domain	66	88	N/A	INTRINSIC
transmembrane domain	116	138	N/A	INTRINSIC
Pfam:ABC_membrane	163	420	9.1e-55	PFAM
AAA	478	666	2.21e-18	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000041633)
• SMART Domains: Protein: ENSMUSP00000128401; Gene: ENSMUSG00000037321; AA Change: D643V

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	37	59	N/A	INTRINSIC
transmembrane domain	66	88	N/A	INTRINSIC
transmembrane domain	116	138	N/A	INTRINSIC
Pfam:ABC_membrane	163	434	5.8e-70	PFAM
AAA	506	694	2.21e-18	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000170086)
• SMART Domains: Protein: ENSMUSP00000130189; Gene: ENSMUSG00000037321

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	1	114	1.5e-24	PFAM
Pfam:ABC_tran	167	196	1e-7	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: None
• Last Updated: 2017-09-11 10:33 PM by Diantha La Vine
• Record Created: 2010-02-03 8:44 AM by Eva Marie Y. Moresco
• Record Posted: 2010-02-03
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Eva Marie Y. Moresco, Diantha La Vine
• Authors: Angelo Theodoratos, Belinda Whittle, Anselm Enders, David C. Tscharke, Carla M. Roots, Christopher C. Goodnow, Aude M. Fahrer

Accession Number

NCBI RefSeq: NM_013683; MGI: 98483

Alleles Listed at MGI

All alleles(2) : Targeted, knock-out(2)

Repository

Australian PhenomeBank: 3689

Phenotypic Description

The rose phenotype was identified in a flow cytometry-based screen of blood from ENU-mutagenized G3 mice (Figure 1) (1). Homozygous rose mice lack CD8⁺ T cells, and express low levels of MHC class I molecules.

Nature of Mutation

The rose mutation was mapped to Chromosome 17, and corresponds to an A to T transversion at position 2252 of the mRNA for Tap1. The mutation occurs in exon 10 of 11 total exons.

2236 CTCCTGCTTATCTTGGATGATGCCACCAGTGCC
638  -L--L--L--I--L--D--D--A--T--S--A-

The mutated nucleotide is indicated in red lettering, and results in an aspartic acid to valine substitution at amino acid 643 of the TAP1 protein.

Protein Prediction

Figure 2. Predicted membrane topography of TAP. Both TAP1 and TAP2 contain a 6-helix core transmembrane domain (TMD) and a cytosolic nucleotide binding domain (NBD). Tapasin binding N-terminal accessory domains consist of 4 and 3 transmembrane helices for TAP1 and TAP2, respectively. The Walker A (A), Walker B (B), and signature/C-loop motif (C) sequences, involved in ATP binding and/or hydrolysis, are color coded to indicate to which ATPase site they belong (green=consensus site; orange=degenerate site). The location of the rose mutation is indicated.

The transporter associated with antigen processing (TAP) pumps cytosolic peptides into the endoplasmic reticulum (ER) lumen for loading onto class I major histocompatibility (MHC) molecules and presentation to T lymphocytes. TAP is a member of the ATP-binding cassette (ABC) transporter family, ubiquitous proteins that shuttle a variety of substrates, including ions (see record for mayday), sugars, amino acids, peptides, vitamins, lipids, antibiotics, and drugs, across cellular membranes (2;3). ABC transporters function either as importers, present only in prokaryotes, or exporters, present in all kingdoms of life. Regardless of the direction of transport, all ABC transporters possess a modular architecture, the core of which consists of two hydrophobic transmembrane domains (TMDs) and two cytosolic nucleotide-binding domains (NBDs; also called ABCs) (4). These four domains may be contributed by one, two, three, or four distinct polypeptides; the most common arrangement for exporters (e.g. TAP) is a homo- or heterodimeric complex composed of two “half-transporters” each containing one TMD fused to one NBD. Outside of this “translocator unit,” accessory domains or proteins exist to provide regulatory or other functionalities to the transporters (4). Whereas the sequence and structural motifs of NBDs are highly conserved among members of the ABC transporter family, the sequence and structure of TMDs exhibit substantial variation that reflects the diversity of translocated substrates. 

 

TAP is a heterodimer of the homologous TAP1 and TAP2 proteins, each of which contains a six-helix TMD and a C-terminal NBD (Figure 2) (5;6). TAP1 and TAP2 also contain N-terminal accessory domains, non-essential for peptide transport, that bind to tapasin, the specialized chaperone that bridges TAP and class I MHC molecules in the peptide loading complex (6;7) (see Background). The tapasin-binding accessory domains of TAP1 and TAP2 consist of four and three transmembrane helices, respectively (5;6), where the first N-terminal helix is essential for tapasin binding (8). Structural information about these domains is discussed below.

 

The structural arrangement of the TAP TMDs is predicted to follow that of the bacterial transporters Sav1866 (a putative drug transporter) and MsbA (a lipid flippase) (9;10), which share approximately 40% sequence similarity and 15% identity with TAP (11). The crystal structures of the bacterial transporters reveal that each TMD consists of a bundle of six long helices that extend into the cytoplasm (Figure 3, PDB ID 2HYD). The helices exhibit a domain-swapped organization in which two helices from one protein in the dimer form a bundle with four helices from the second protein subunit and vice versa. Thus, each TMD is formed by helices from both proteins of the dimer. In TAP, peptides would be translocated through the pore formed by the TMDs, which appears to have a V-shaped opening that normally faces the cytosol. This opening is predicted to alternate between facing the cytosolic side and facing the ER lumenal side of the membrane, powered by the ATP-dependent opening and closing of the NBDs (see below) (12). In addition to residues that map to cytosolic loops and transmembrane domains of both TAP1 and TAP2 (13), at least three sites predicted to lie near the base of the opening have been shown to mediate binding to antigenic peptide. These consist of a TAP2 polymorphic site identified in the rat that alters TAP peptide specificity (14-17), and sites identified because they are either cleaved by reactive peptides or crosslink to cysteine-containing peptides (18).

 

The crystal structure of the isolated TAP1 NBD bound to ADP reveals the typical NBD fold comprising two subdomains (Figure 4; PDB ID 1JJ7) (19). The ATPase subdomain, containing two β-sheets and six α-helices, is homologous to other RecA-like ATPases and binds nucleotides, and is joined by a hinge-like loop (Q-loop) to an α-helical bundle called the helical subdomain. In the TAP heterodimer, two ATP molecules are clasped within two ATPase sites formed at the interface of the NBDs. Both NBDs make contacts with both ATP molecules, and contribute to ATP hydrolysis (20-22). Several sequence motifs in the TAP NBDs, characteristic of all ABC transporters, form critical interactions that facilitate ATP binding and hydrolysis (Table 1) [reviewed in (12)]. These include the Walker A, Walker B, and switch motifs provided by one NBD (from its ATPase subdomain), and the signature motif provided by the second NBD (from its helical subdomain) (23).  Only when the NBDs close are the nucleotide and water molecules appropriately positioned for hydrolysis (22).

 

Table 1. Conserved sequence motifs in TAP NBDs

Motif	Consensus	Function
Walker A (P-loop)	GPNGSGKST	contacts α- and β-phosphates of bound nucleotide; coordinates ATP-associated Mg2+
Walker B	VLILDD (TAP1) VLILDE (TAP2)	critical E residue positions hydrolytic water molecule
switch (H-loop)	ITQHL (TAP1) IAHRL (TAP2)	contacts γ-phosphate
signature (C-loop)	LSGGQ (TAP1) LAAGQ (TAP2)	contacts γ-phosphate and mediates NBD dimerization
D-loop	SALD	positions and polarizes the hydrolytic water molecule
Q-loop	VGQEP	links ATPase and helical subdomains

Nonconsensus substitutions are in red text.

 

In TAP1, the Walker B and switch motifs each contain one amino acid substitution in the consensus sequences; in TAP2 the signature motif contains two substitutions (Table 1). In the context of the NBD dimer, all three nonconsensus motifs map to one ATPase site, while the second ATPase site is formed exclusively from consensus motifs (24). Such asymmetry of ATPase sites, where one site contains sequence motifs that follow the consensus (called the consensus site), and the second site contains one or more sequence motifs that deviate from consensus (called the degenerate site), is a common feature of many eukaryotic ABC transporters (12). Biochemical and mutagenesis experiments demonstrate that the consensus ATPase site has higher activity than the degenerate site and is the principal driver of NBD closure and ATP hydrolysis (24). Consistent with this, TAP can still function when mutations prevent ATP hydrolysis in the degenerate site, but TAP loses all peptide transport function when the equivalent mutations are introduced to the consensus site (25-29). 

 

ABC transporters including TAP are believed to share the same basic transport mechanism in which a substrate-binding cavity formed by the two TMDs alternately faces the inside or outside of the membrane (12;30).  When the NBDs are bound to ATP and dimerized, the TMDs form an outward facing (opposite the cytosolic side) cavity. Following ATP hydrolysis, the NBDs separate and the TMDs shift to face inward. Recent work supports the following model for the mechanism of TAP (Figure 5), proposed by Procko et al (12). In the resting state, the TAP NBDs are open (i.e. not dimerized) and the peptide-binding site faces the cytosol. Via their ATPase subdomains, TAP1 is bound to ATP, while TAP2 is bound to ADP [for which in isolation it has a strong preference (27)]. Peptide binding in the cytosol-facing cavity causes a conformational change transmitted to the NBDs via a coupling helix, which fits in a groove between the subdomains of each NBD, and connects each TMD to its respective NBD (10). This conformational change triggers the exchange of ADP for ATP on TAP2, dimerization of the NBDs, and thus the closing of the peptide binding site to the cytosol and opening to the ER lumen. Peptide affinity is lowest in the ATP-bound closed NBD conformation of TAP (18), and peptide is thereby released into the ER at this stage. ATP hydrolysis in the consensus ATPase site alone is sufficient to destabilize the closed NBDs, as described above, allowing the NBD dimer to separate and returning TAP to the resting conformation. Consistent with the requirement for a functional degenerate ATPase site for optimal transport activity, hydrolysis may also occur at the degenerate ATPase site and further favor NBD opening.

 

The rose mutation occurs in the Walker B motif of TAP1, in the consensus aspartic acid residue.

Expression/Localization

TAP1 is expressed in all cell types and is found in complex with TAP2 in the ER membrane.

Background

T cell receptors recognize antigens in the context of MHC class I and MHC class II molecules. MHC class I molecules are present on most nucleated cells, and mainly carry peptides derived from endogenous proteins for display to CD8⁺ cytotoxic T cells. In contrast, MHC class II molecules are generally restricted to antigen presenting cells, and present peptide fragments of exogenous proteins to CD4⁺ T helper cells. Some antigen presenting cells are also able to present antigens from exogenous pathogens on MHC class I via an alternative presentation pathway termed “cross-presentation” (31).

 

TAP is essential for the transport of peptides into the ER for loading onto MHC class I molecules and display at the cell surface. Cell lines with reduced cell surface expression of MHC class I molecules and defective antigen presentation provided the first clue to the existence of a transporter for cytoplasm to ER translocation of antigenic peptides (32-35). These cell lines possessed normal levels of MHC class I heavy chain and β2-microglobulin expression and function, as indicated by their ability to efficiently present exogenously added peptides or peptides targeted to the ER by an ER retention signal. The genetic defect mapped to the MHC locus (33), and subsequently four independent groups identified deletions in two genes encoding proteins homologous to ABC transporters (later named TAP1 and TAP2) (36-39). It was then shown that transfection of the deficient cell lines with genes for TAP1 and/or TAP2 restored their ability to present antigen (40-43).

 

Mature MHC class I heterotrimers consist of the MHC encoded polymorphic α-chain (heavy chain), the invariant β2-microglobulin subunit, and peptide. The construction of this complex requires an amazing series of coordinated enzymatic events (Figure 6). The pathway, constitutively active in all nucleated cells, begins in the cytoplasm with the degradation of intracellular proteins (both host and foreign) by the proteasome and peptidases [reviewed in (44)]. A small fraction of the generated peptides are translocated from the cytosol to the ER lumen by TAP for loading onto MHC class I by the peptide loading complex, consisting of TAP, MHC class I, and the chaperones calreticulin, ERp57, and tapasin. Some peptides must be further trimmed to the appropriate size in the ER lumen. Once bound to antigenic peptide, ER-resident chaperones are released, allowing peptide-bound MHC to migrate through the Golgi apparatus and on to the cell surface.

 

Peptide loading complex

Folding and loading of MHC class I is initiated when the MHC I heavy chain is cotranslationally inserted in the ER membrane and associates with calnexin and immunoglobulin-binding protein (BiP), chaperones that promote assembly with β2-microglobulin (Figure 6) (45). After formation of a noncovalent dimer with β2-microglobulin, calnexin is replaced by calreticulin, which is thought to stabilize the complex and optimize peptide loading on MHC class I (46). The thiol reductase ERp57 is also added to the complex, and promotes intramolecular disulfide bond formation in the MHC class I heavy chain (47-49). ERp57 forms complexes with both calnexin and calreticulin, but only associates with the calreticulin-containing peptide loading complex; it is retained in the complex by a disulfide bond with tapasin (50).

 

Tapasin (also known as TAP-binding protein) is an essential component of the peptide loading complex (51). It is a type I membrane glycoprotein present in four copies in the complex, and performs multiple functions. Tapasin simultaneously binds to chaperone-associated MHC class I through its N-terminal ER lumenal domain, and to TAP through its C-terminal transmembrane and cytosolic stalk, acting to localize nascent MHC class I molecules close to the source of peptides (52-54). Cells and mice lacking tapasin display reduced levels of MHC class I cell surface expression due to a reduction in the efficiency of binding and in the optimization of peptide cargo, which selects peptides that confer high stability to MHC class I molecules (53;55-57). Tapasin also stabilizes TAP expression (52;58;59), and recruits and retains ERp57 in the peptide loading complex (47).

 

TAP substrates

The majority of substrates for TAP are derived from newly synthesized proteins, and TAP activity depends on continuing protein translation (60). Several cytosolic peptidases have been implicated in peptide generation, including tripeptidyl peptidase-II (TPP-II) (61), puromycin-sensitive aminopeptidase (PSA) (62), and bleomycin hydrolase (BH) (62), but the bulk are generated by the proteasome. The 20S/26S proteasome cotranslationally degrades an estimated one third to one half of newly synthesized proteins, typically damaged or unwanted proteins in the form of defective ribosomal products (DRiPs), polypeptides that never attain native structure as a result of errors in translation or post-translational processing that prevent proper folding (60;63;64). Perhaps surprisingly, the fraction of peptides presented on MHC class I out of the total number generated by the proteasome is exceedingly small (≤0.1%) (65). This is due in part to the fact that TAP cannot translocate many potential substrates because they are either too long or too short.

 

Peptides generated by the proteasome are 3-22 amino acids in length (66), whereas TAP preferentially binds peptides of 8-16 amino acids, and most efficiently transports peptides of 8-12 amino acids (67-69). Approximately 2% of proteasome-generated peptide fragments are of the appropriate size for TAP translocation and direct presentation by MHC class I molecules (70). For example, two percent of the products from proteasomal degradation of the model antigen ovalbumin are the immunodominant peptide SIINFEKL, but 6-8% of the products are SIINFEKL or an N-extended version of the peptide, suggesting that most MHC-presented peptides are derived from N-terminal trimming of extended peptides (70;71). The leucine aminopeptidase and other peptidases likely function redundantly in the trimming of N-extended peptides (72;73). However, cytosolic peptidases actually destroy most potential TAP substrates, and are the main reason so few peptides are ultimately presented by MHC class I (60;74). More than 99% of intracellular peptides are destroyed within one minute of their generation, before encountering TAP (75), due in particular to the action of the endopeptidase thimet oligopeptidase (74). To have a chance at MHC class I presentation, peptides of 8-11 amino acids, potential TAP substrates, must interact with TAP within a few seconds of generation.

 

Some peptides successfully bound and translocated by TAP are still too long for presentation by MHC class I. TAP transports peptides ranging in length from 7 to more than 20 amino acids, whereas class I MHC holds peptides of 8-10 residues (69). The ER aminopeptidase 1 (ERAP1) can trim peptides to the canonical 8-10 residues required for class I MHC binding (76-78). The functions of other ER aminopeptidases, including ERAP2 (78;79), in antigen processing remain to be determined.

 

The contribution of each peptide residue to affinity for TAP is well established. MHC class I substrates contain specific amino acids at only three anchor positions (positions 1, 2, and 9) that provide strong contacts to the MHC, while at other positions the sequence can freely vary. TAP substrate affinity must similarly be strong enough to capture substrates yet allow wide sequence diversity. The C-terminal amino acid and the first three N-terminal amino acids are the most important determinants of TAP substrate specificity (80-83). For the C-terminus, human TAP has highest affinity for hydrophobic and positively charged residues, moderate affinity for polar residues, and disfavors Asp and Gly. For the N-terminus, TAP prefers hydrophobic amino acids at position 3, and hydrophobic or charged residues at position 2. Aromatic or acidic residues at position 1, or proline at position 1 or 2 are highly disfavored. Amino acids at positions 4 to 8 have no effect on TAP affinity, but are the main determinants for TCR binding to MHC class I-associated peptide.

 

Regulation of antigen processing

Cytokines such as interferon (IFN)-γ activate the adaptive immune system during infection, causing a concerted upregulation of the machinery for antigen processing and presentation. MHC class I molecules are expressed at low levels in most cells, but are strongly induced by IFNγ. Both TAP1 and TAP2 transcripts are upregulated 10-20-fold within 12 hours of IFNγ stimulation. IFNγ also helps to overcome the low efficiency of presentation of proteasome-generated peptides (84). During interferon IFNγ stimulation, the three active proteasomal β-subunits are replacedby β-immunosubunits to generate an “immunoproteasome” (85). Immunoproteasomes show a different cleavage pattern compared with constitutive proteasomes, generating more peptides that have correct C-termini for MHC class I binding, as well as an overall increased efficiency in generating peptides (84). IFNγ stimulation also upregulates expression of peptidases involved in antigen processing, including leucine aminopeptidase, ERAP1, and ERAP2 (78;79;86).

 

TAP and disease

Peptide binding is required to stabilize MHC class I molecules, so mice with disrupted TAP1 or TAP2 genes assemble drastically reduced amounts of MHC class I molecules, and have nearly absent surface expression of MHC class I.  The cells of Tap1^-/- mice (87) and mice with mutations in TAP2 (see the records for ganymede and jasmine) (1) are deficient in cytosolic antigen presentation, and consequently CD8⁺ T cells fail to develop in these animals. Similarly, human mutations in TAP1 (88;89), TAP2 (90;91), or tapasin (92) cause the rarely occurring bare lymphocyte syndrome type I (type I BLS, OMIM #604571), characterized a reduction in MHC class I surface expression to 1-3% of normal levels. Interestingly, a human TAP2 mutation has been reported that permits cell surface expression of empty MHC class I molecules to levels 3-5 times higher than observed in other TAP-deficient individuals (93), suggesting that TAP also promotes MHC class I surface expression independently of its peptide transport function. Consistent with this, the causative mutation destroys the ATP-binding site and activity of the TAP2 subunit, but is predicted to preserve interactions with TAP1 and tapasin (93).

 

Patients with type I BLS from TAP1 or TAP2 mutations develop chronic bacterial infections of the sinus and bronchi in late childhood and/or granulomatous skin lesions, but no severe combined immunodeficiency, diarrhea, nor persistent systemic infections (94;95). Considering the role of MHC class I proteins in presentation of viral peptides to CTLs, individuals with type I BLS surprisingly do not suffer from severe viral infections. Although the mechanisms of viral resistance remain to be demonstrated, a variety of contributing factors have been proposed [reviewed in (94)]: a normal humoral response; the presence of reduced but significant numbers of TCR αβ⁺ CD8⁺ T cells (89;90); MHC class I presentation of TAP-independent viral antigens to CTLs (96); expansion of TCR γδ⁺ T cells (91;93); and the presence of NK cells (91;97).

 

Polymorphisms in human TAP2 (or TAP1) have been associated with autoimmune diseases including type I diabetes mellitus (98-100), Graves’ disease (101), and multiple sclerosis (102). The mechanisms by which these polymorphisms predispose individuals to autoimmunity have not been elucidated. It was initially hypothesized that downregulation of TAP2 mRNA leading to reduced MHC class I cell surface expression may flag cells as targets for natural killer (NK) cells. However, TAP2- or TAP1-deficient humans (91;97) and mice (103;104) do not suffer from autoimmune diseases early in life because their NK cells acquire tolerance toward MHC class I-negative cells. Inhibition of NK cell activity in individuals lacking surface MHC class I has been shown to be mediated in part by reduced expression of NK activating receptors and elevated expression of NK inhibitory receptors (103;105).

Putative Mechanism

The mutation in rose mice occurs in the conserved Walker B motif of ABC transporters, which is critical for positioning the hydrolytic water molecule in the ATPase site. The aspartic acid mutated is conserved in TAP molecules across species (human, mouse, chicken, and shark), and in many ABC transporter family members (1). The mutation abrogates TAP-dependent peptide transport, as indicated by the severe reduction of MHC class I surface expression. The lack of CD8⁺ T cells is due to death after failure to interact with peptide-MHC class I, which is known to promote the development and maintenance of these T cells.

Primers

Primers cannot be located by automatic search.

Genotyping

Genotyping protocols are from the Australian PhenomeBank.

11B6 58

References

1. Theodoratos, A., Whittle, B., Enders, A., Tscharke, D. C., Roots, C. M., Goodnow, C. C., and Fahrer, A. M. (2009) Mouse Strains with Point Mutations in TAP1 and TAP2. Immunol. Cell Biol. 88, 72-78.

2. Borst, P., and Elferink, R. O. (2002) Mammalian ABC Transporters in Health and Disease. Annu. Rev. Biochem. 71, 537-592.

3. Higgins, C. F. (1992) ABC Transporters: From Microorganisms to Man. Annu. Rev. Cell Biol. 8, 67-113.

4. Biemans-Oldehinkel, E., Doeven, M. K., and Poolman, B. (2006) ABC Transporter Architecture and Regulatory Roles of Accessory Domains. FEBS Lett. 580, 1023-1035.

5. Schrodt, S., Koch, J., and Tampe, R. (2006) Membrane Topology of the Transporter Associated with Antigen Processing (TAP1) within an Assembled Functional Peptide-Loading Complex. J. Biol. Chem. 281, 6455-6462.

6. Koch, J., Guntrum, R., Heintke, S., Kyritsis, C., and Tampe, R. (2004) Functional Dissection of the Transmembrane Domains of the Transporter Associated with Antigen Processing (TAP). J. Biol. Chem. 279, 10142-10147.

7. Procko, E., Raghuraman, G., Wiley, D. C., Raghavan, M., and Gaudet, R. (2005) Identification of Domain Boundaries within the N-Termini of TAP1 and TAP2 and their Importance in Tapasin Binding and Tapasin-Mediated Increase in Peptide Loading of MHC Class I. Immunol. Cell Biol. 83, 475-482.

8. Koch, J., Guntrum, R., and Tampe, R. (2006) The First N-Terminal Transmembrane Helix of each Subunit of the Antigenic Peptide Transporter TAP is Essential for Independent Tapasin Binding. FEBS Lett. 580, 4091-4096.

9. Ward, A., Reyes, C. L., Yu, J., Roth, C. B., and Chang, G. (2007) Flexibility in the ABC Transporter MsbA: Alternating Access with a Twist. Proc. Natl. Acad. Sci. U. S. A. 104, 19005-19010.

10. Dawson, R. J., and Locher, K. P. (2006) Structure of a Bacterial Multidrug ABC Transporter. Nature. 443, 180-185.

11. Procko, E., and Gaudet, R. (2009) Antigen Processing and Presentation: TAPping into ABC Transporters. Curr. Opin. Immunol. 21, 84-91.

12. Procko, E., O'Mara, M. L., Bennett, W. F., Tieleman, D. P., and Gaudet, R. (2009) The Mechanism of ABC Transporters: General Lessons from Structural and Functional Studies of an Antigenic Peptide Transporter. FASEB J. 23, 1287-1302.

13. Abele, R., and Tampe, R. (1999) Function of the Transport Complex TAP in Cellular Immune Recognition. Biochim. Biophys. Acta. 1461, 405-419.

14. Deverson, E. V., Leong, L., Seelig, A., Coadwell, W. J., Tredgett, E. M., Butcher, G. W., and Howard, J. C. (1998) Functional Analysis by Site-Directed Mutagenesis of the Complex Polymorphism in Rat Transporter Associated with Antigen Processing. J. Immunol. 160, 2767-2779.

15. Momburg, F., Armandola, E. A., Post, M., and Hammerling, G. J. (1996) Residues in TAP2 Peptide Transporters Controlling Substrate Specificity. J. Immunol. 156, 1756-1763.

16. Powis, S. J., Young, L. L., Joly, E., Barker, P. J., Richardson, L., Brandt, R. P., Melief, C. J., Howard, J. C., and Butcher, G. W. (1996) The Rat Cim Effect: TAP Allele-Dependent Changes in a Class I MHC Anchor Motif and Evidence Against C-Terminal Trimming of Peptides in the ER. Immunity. 4, 159-165.

17. Powis, S. J., Deverson, E. V., Coadwell, W. J., Ciruela, A., Huskisson, N. S., Smith, H., Butcher, G. W., and Howard, J. C. (1992) Effect of Polymorphism of an MHC-Linked Transporter on the Peptides Assembled in a Class I Molecule. Nature. 357, 211-215.

18. Herget, M., Oancea, G., Schrodt, S., Karas, M., Tampe, R., and Abele, R. (2007) Mechanism of Substrate Sensing and Signal Transmission within an ABC Transporter: Use of a Trojan Horse Strategy. J. Biol. Chem. 282, 3871-3880.

19. Gaudet, R., and Wiley, D. C. (2001) Structure of the ABC ATPase Domain of Human TAP1, the Transporter Associated with Antigen Processing. EMBO J. 20, 4964-4972.

20. Chen, M., Abele, R., and Tampe, R. (2003) Peptides Induce ATP Hydrolysis at both Subunits of the Transporter Associated with Antigen Processing. J. Biol. Chem. 278, 29686-29692.

21. Moody, J. E., Millen, L., Binns, D., Hunt, J. F., and Thomas, P. J. (2002) Cooperative, ATP-Dependent Association of the Nucleotide Binding Cassettes during the Catalytic Cycle of ATP-Binding Cassette Transporters. J. Biol. Chem. 277, 21111-21114.

22. Smith, P. C., Karpowich, N., Millen, L., Moody, J. E., Rosen, J., Thomas, P. J., and Hunt, J. F. (2002) ATP Binding to the Motor Domain from an ABC Transporter Drives Formation of a Nucleotide Sandwich Dimer. Mol. Cell. 10, 139-149.

23. Procko, E., and Gaudet, R. (2008) Functionally Important Interactions between the Nucleotide-Binding Domains of an Antigenic Peptide Transporter. Biochemistry. 47, 5699-5708.

24. Procko, E., Ferrin-O'Connell, I., Ng, S. L., and Gaudet, R. (2006) Distinct Structural and Functional Properties of the ATPase Sites in an Asymmetric ABC Transporter. Mol. Cell. 24, 51-62.

25. Perria, C. L., Rajamanickam, V., Lapinski, P. E., and Raghavan, M. (2006) Catalytic Site Modifications of TAP1 and TAP2 and their Functional Consequences. J. Biol. Chem. 281, 39839-39851.

26. Chen, M., Abele, R., and Tampe, R. (2004) Functional Non-Equivalence of ATP-Binding Cassette Signature Motifs in the Transporter Associated with Antigen Processing (TAP). J. Biol. Chem. 279, 46073-46081.

27. Alberts, P., Daumke, O., Deverson, E. V., Howard, J. C., and Knittler, M. R. (2001) Distinct Functional Properties of the TAP Subunits Coordinate the Nucleotide-Dependent Transport Cycle. Curr. Biol. 11, 242-251.

28. Lapinski, P. E., Neubig, R. R., and Raghavan, M. (2001) Walker A Lysine Mutations of TAP1 and TAP2 Interfere with Peptide Translocation but Not Peptide Binding. J. Biol. Chem. 276, 7526-7533.

29. Karttunen, J. T., Lehner, P. J., Gupta, S. S., Hewitt, E. W., and Cresswell, P. (2001) Distinct Functions and Cooperative Interaction of the Subunits of the Transporter Associated with Antigen Processing (TAP). Proc. Natl. Acad. Sci. U. S. A. 98, 7431-7436.

30. Rees, D. C., Johnson, E., and Lewinson, O. (2009) ABC Transporters: The Power to Change. Nat. Rev. Mol. Cell Biol. 10, 218-227.

31. Trombetta, E. S., and Mellman, I. (2005) Cell Biology of Antigen Processing in Vitro and in Vivo. Annu. Rev. Immunol. 23, 975-1028.

32. Anderson, K., Cresswell, P., Gammon, M., Hermes, J., Williamson, A., and Zweerink, H. (1991) Endogenously Synthesized Peptide with an Endoplasmic Reticulum Signal Sequence Sensitizes Antigen Processing Mutant Cells to Class I-Restricted Cell-Mediated Lysis. J. Exp. Med. 174, 489-492.

33. Cerundolo, V., Alexander, J., Anderson, K., Lamb, C., Cresswell, P., McMichael, A., Gotch, F., and Townsend, A. (1990) Presentation of Viral Antigen Controlled by a Gene in the Major Histocompatibility Complex. Nature. 345, 449-452.

34. Hosken, N. A., and Bevan, M. J. (1990) Defective Presentation of Endogenous Antigen by a Cell Line Expressing Class I Molecules. Science. 248, 367-370.

35. Townsend, A., Ohlen, C., Bastin, J., Ljunggren, H. G., Foster, L., and Karre, K. (1989) Association of Class I Major Histocompatibility Heavy and Light Chains Induced by Viral Peptides. Nature. 340, 443-448.

36. Deverson, E. V., Gow, I. R., Coadwell, W. J., Monaco, J. J., Butcher, G. W., and Howard, J. C. (1990) MHC Class II Region Encoding Proteins Related to the Multidrug Resistance Family of Transmembrane Transporters. Nature. 348, 738-741.

37. Monaco, J. J., Cho, S., and Attaya, M. (1990) Transport Protein Genes in the Murine MHC: Possible Implications for Antigen Processing. Science. 250, 1723-1726.

38. Spies, T., Bresnahan, M., Bahram, S., Arnold, D., Blanck, G., Mellins, E., Pious, D., and DeMars, R. (1990) A Gene in the Human Major Histocompatibility Complex Class II Region Controlling the Class I Antigen Presentation Pathway. Nature. 348, 744-747.

39. Trowsdale, J., Hanson, I., Mockridge, I., Beck, S., Townsend, A., and Kelly, A. (1990) Sequences Encoded in the Class II Region of the MHC Related to the 'ABC' Superfamily of Transporters. Nature. 348, 741-744.

40. Attaya, M., Jameson, S., Martinez, C. K., Hermel, E., Aldrich, C., Forman, J., Lindahl, K. F., Bevan, M. J., and Monaco, J. J. (1992) Ham-2 Corrects the Class I Antigen-Processing Defect in RMA-S Cells. Nature. 355, 647-649.

41. Spies, T., Cerundolo, V., Colonna, M., Cresswell, P., Townsend, A., and DeMars, R. (1992) Presentation of Viral Antigen by MHC Class I Molecules is Dependent on a Putative Peptide Transporter Heterodimer. Nature. 355, 644-646.

42. Powis, S. J., Townsend, A. R., Deverson, E. V., Bastin, J., Butcher, G. W., and Howard, J. C. (1991) Restoration of Antigen Presentation to the Mutant Cell Line RMA-S by an MHC-Linked Transporter. Nature. 354, 528-531.

43. Spies, T., and DeMars, R. (1991) Restored Expression of Major Histocompatibility Class I Molecules by Gene Transfer of a Putative Peptide Transporter. Nature. 351, 323-324.

44. Gromme, M., and Neefjes, J. (2002) Antigen Degradation Or Presentation by MHC Class I Molecules Via Classical and Non-Classical Pathways. Mol. Immunol. 39, 181-202.

45. Paulsson, K., and Wang, P. (2003) Chaperones and Folding of MHC Class I Molecules in the Endoplasmic Reticulum. Biochim. Biophys. Acta. 1641, 1-12.

46. Gao, B., Adhikari, R., Howarth, M., Nakamura, K., Gold, M. C., Hill, A. B., Knee, R., Michalak, M., and Elliott, T. (2002) Assembly and Antigen-Presenting Function of MHC Class I Molecules in Cells Lacking the ER Chaperone Calreticulin. Immunity. 16, 99-109.

47. Dick, T. P., Bangia, N., Peaper, D. R., and Cresswell, P. (2002) Disulfide Bond Isomerization and the Assembly of MHC Class I-Peptide Complexes. Immunity. 16, 87-98.

48. Lindquist, J. A., Hammerling, G. J., and Trowsdale, J. (2001) ER60/ERp57 Forms Disulfide-Bonded Intermediates with MHC Class I Heavy Chain. FASEB J. 15, 1448-1450.

49. Lindquist, J. A., Jensen, O. N., Mann, M., and Hammerling, G. J. (1998) ER-60, a Chaperone with Thiol-Dependent Reductase Activity Involved in MHC Class I Assembly. EMBO J. 17, 2186-2195.

50. Harris, M. R., Lybarger, L., Yu, Y. Y., Myers, N. B., and Hansen, T. H. (2001) Association of ERp57 with Mouse MHC Class I Molecules is Tapasin Dependent and Mimics that of Calreticulin and Not Calnexin. J. Immunol. 166, 6686-6692.

51. Momburg, F., and Tan, P. (2002) Tapasin-the Keystone of the Loading Complex Optimizing Peptide Binding by MHC Class I Molecules in the Endoplasmic Reticulum. Mol. Immunol. 39, 217-233.

52. Bangia, N., Lehner, P. J., Hughes, E. A., Surman, M., and Cresswell, P. (1999) The N-Terminal Region of Tapasin is Required to Stabilize the MHC Class I Loading Complex. Eur. J. Immunol. 29, 1858-1870.

53. Ortmann, B., Copeman, J., Lehner, P. J., Sadasivan, B., Herberg, J. A., Grandea, A. G., Riddell, S. R., Tampe, R., Spies, T., Trowsdale, J., and Cresswell, P. (1997) A Critical Role for Tapasin in the Assembly and Function of Multimeric MHC Class I-TAP Complexes. Science. 277, 1306-1309.

54. Sadasivan, B., Lehner, P. J., Ortmann, B., Spies, T., and Cresswell, P. (1996) Roles for Calreticulin and a Novel Glycoprotein, Tapasin, in the Interaction of MHC Class I Molecules with TAP. Immunity. 5, 103-114.

55. Williams, A. P., Peh, C. A., Purcell, A. W., McCluskey, J., and Elliott, T. (2002) Optimization of the MHC Class I Peptide Cargo is Dependent on Tapasin. Immunity. 16, 509-520.

56. Tan, P., Kropshofer, H., Mandelboim, O., Bulbuc, N., Hammerling, G. J., and Momburg, F. (2002) Recruitment of MHC Class I Molecules by Tapasin into the Transporter Associated with Antigen Processing-Associated Complex is Essential for Optimal Peptide Loading. J. Immunol. 168, 1950-1960.

57. Garbi, N., Tan, P., Diehl, A. D., Chambers, B. J., Ljunggren, H. G., Momburg, F., and Hammerling, G. J. (2000) Impaired Immune Responses and Altered Peptide Repertoire in Tapasin-Deficient Mice. Nat. Immunol. 1, 234-238.

58. Garbi, N., Tiwari, N., Momburg, F., and Hammerling, G. J. (2003) A Major Role for Tapasin as a Stabilizer of the TAP Peptide Transporter and Consequences for MHC Class I Expression. Eur. J. Immunol. 33, 264-273.

59. Raghuraman, G., Lapinski, P. E., and Raghavan, M. (2002) Tapasin Interacts with the Membrane-Spanning Domains of both TAP Subunits and Enhances the Structural Stability of TAP1 x TAP2 Complexes. J. Biol. Chem. 277, 41786-41794.

60. Reits, E. A., Vos, J. C., Gromme, M., and Neefjes, J. (2000) The Major Substrates for TAP in Vivo are Derived from Newly Synthesized Proteins. Nature. 404, 774-778.

61. Seifert, U., Maranon, C., Shmueli, A., Desoutter, J. F., Wesoloski, L., Janek, K., Henklein, P., Diescher, S., Andrieu, M., de la Salle, H., Weinschenk, T., Schild, H., Laderach, D., Galy, A., Haas, G., Kloetzel, P. M., Reiss, Y., and Hosmalin, A. (2003) An Essential Role for Tripeptidyl Peptidase in the Generation of an MHC Class I Epitope. Nat. Immunol. 4, 375-379.

62. Stoltze, L., Schirle, M., Schwarz, G., Schroter, C., Thompson, M. W., Hersh, L. B., Kalbacher, H., Stevanovic, S., Rammensee, H. G., and Schild, H. (2000) Two New Proteases in the MHC Class I Processing Pathway. Nat. Immunol. 1, 413-418.

63. Schubert, U., Anton, L. C., Gibbs, J., Norbury, C. C., Yewdell, J. W., and Bennink, J. R. (2000) Rapid Degradation of a Large Fraction of Newly Synthesized Proteins by Proteasomes. Nature. 404, 770-774.

64. Turner, G. C., and Varshavsky, A. (2000) Detecting and Measuring Cotranslational Protein Degradation in Vivo. Science. 289, 2117-2120.

65. Yewdell, J. W., Reits, E., and Neefjes, J. (2003) Making Sense of Mass Destruction: Quantitating MHC Class I Antigen Presentation. Nat. Rev. Immunol. 3, 952-961.

66. Kisselev, A. F., Akopian, T. N., Woo, K. M., and Goldberg, A. L. (1999) The Sizes of Peptides Generated from Protein by Mammalian 26 and 20 S Proteasomes. Implications for Understanding the Degradative Mechanism and Antigen Presentation. J. Biol. Chem. 274, 3363-3371.

67. Koopmann, J. O., Post, M., Neefjes, J. J., Hammerling, G. J., and Momburg, F. (1996) Translocation of Long Peptides by Transporters Associated with Antigen Processing (TAP). Eur. J. Immunol. 26, 1720-1728.

68. van Endert, P. M., Tampe, R., Meyer, T. H., Tisch, R., Bach, J. F., and McDevitt, H. O. (1994) A Sequential Model for Peptide Binding and Transport by the Transporters Associated with Antigen Processing. Immunity. 1, 491-500.

69. Momburg, F., Roelse, J., Hammerling, G. J., and Neefjes, J. J. (1994) Peptide Size Selection by the Major Histocompatibility Complex-Encoded Peptide Transporter. J. Exp. Med. 179, 1613-1623.

70. Cascio, P., Hilton, C., Kisselev, A. F., Rock, K. L., and Goldberg, A. L. (2001) 26S Proteasomes and Immunoproteasomes Produce mainly N-Extended Versions of an Antigenic Peptide. EMBO J. 20, 2357-2366.

71. Paz, P., Brouwenstijn, N., Perry, R., and Shastri, N. (1999) Discrete Proteolytic Intermediates in the MHC Class I Antigen Processing Pathway and MHC I-Dependent Peptide Trimming in the ER. Immunity. 11, 241-251.

72. Towne, C. F., York, I. A., Watkin, L. B., Lazo, J. S., and Rock, K. L. (2007) Analysis of the Role of Bleomycin Hydrolase in Antigen Presentation and the Generation of CD8 T Cell Responses. J. Immunol. 178, 6923-6930.

73. Towne, C. F., York, I. A., Neijssen, J., Karow, M. L., Murphy, A. J., Valenzuela, D. M., Yancopoulos, G. D., Neefjes, J. J., and Rock, K. L. (2005) Leucine Aminopeptidase is Not Essential for Trimming Peptides in the Cytosol Or Generating Epitopes for MHC Class I Antigen Presentation. J. Immunol. 175, 6605-6614.

74. York, I. A., Mo, A. X., Lemerise, K., Zeng, W., Shen, Y., Abraham, C. R., Saric, T., Goldberg, A. L., and Rock, K. L. (2003) The Cytosolic Endopeptidase, Thimet Oligopeptidase, Destroys Antigenic Peptides and Limits the Extent of MHC Class I Antigen Presentation. Immunity. 18, 429-440.

75. Reits, E., Griekspoor, A., Neijssen, J., Groothuis, T., Jalink, K., van Veelen, P., Janssen, H., Calafat, J., Drijfhout, J. W., and Neefjes, J. (2003) Peptide Diffusion, Protection, and Degradation in Nuclear and Cytoplasmic Compartments before Antigen Presentation by MHC Class I. Immunity. 18, 97-108.

76. Serwold, T., Gonzalez, F., Kim, J., Jacob, R., and Shastri, N. (2002) ERAAP Customizes Peptides for MHC Class I Molecules in the Endoplasmic Reticulum. Nature. 419, 480-483.

77. York, I. A., Chang, S. C., Saric, T., Keys, J. A., Favreau, J. M., Goldberg, A. L., and Rock, K. L. (2002) The ER Aminopeptidase ERAP1 Enhances Or Limits Antigen Presentation by Trimming Epitopes to 8-9 Residues. Nat. Immunol. 3, 1177-1184.

78. Saric, T., Chang, S. C., Hattori, A., York, I. A., Markant, S., Rock, K. L., Tsujimoto, M., and Goldberg, A. L. (2002) An IFN-Gamma-Induced Aminopeptidase in the ER, ERAP1, Trims Precursors to MHC Class I-Presented Peptides. Nat. Immunol. 3, 1169-1176.

79. Tanioka, T., Hattori, A., Masuda, S., Nomura, Y., Nakayama, H., Mizutani, S., and Tsujimoto, M. (2003) Human Leukocyte-Derived Arginine Aminopeptidase. the Third Member of the Oxytocinase Subfamily of Aminopeptidases. J. Biol. Chem. 278, 32275-32283.

80. Uebel, S., Kraas, W., Kienle, S., Wiesmuller, K. H., Jung, G., and Tampe, R. (1997) Recognition Principle of the TAP Transporter Disclosed by Combinatorial Peptide Libraries. Proc. Natl. Acad. Sci. U. S. A. 94, 8976-8981.

81. Neefjes, J., Gottfried, E., Roelse, J., Gromme, M., Obst, R., Hammerling, G. J., and Momburg, F. (1995) Analysis of the Fine Specificity of Rat, Mouse and Human TAP Peptide Transporters. Eur. J. Immunol. 25, 1133-1136.

82. van Endert, P. M., Riganelli, D., Greco, G., Fleischhauer, K., Sidney, J., Sette, A., and Bach, J. F. (1995) The Peptide-Binding Motif for the Human Transporter Associated with Antigen Processing. J. Exp. Med. 182, 1883-1895.

83. Momburg, F., Roelse, J., Howard, J. C., Butcher, G. W., Hammerling, G. J., and Neefjes, J. J. (1994) Selectivity of MHC-Encoded Peptide Transporters from Human, Mouse and Rat. Nature. 367, 648-651.

84. Strehl, B., Seifert, U., Kruger, E., Heink, S., Kuckelkorn, U., and Kloetzel, P. M. (2005) Interferon-Gamma, the Functional Plasticity of the Ubiquitin-Proteasome System, and MHC Class I Antigen Processing. Immunol. Rev. 207, 19-30.

85. Aki, M., Shimbara, N., Takashina, M., Akiyama, K., Kagawa, S., Tamura, T., Tanahashi, N., Yoshimura, T., Tanaka, K., and Ichihara, A. (1994) Interferon-Gamma Induces Different Subunit Organizations and Functional Diversity of Proteasomes. J. Biochem. 115, 257-269.

86. Beninga, J., Rock, K. L., and Goldberg, A. L. (1998) Interferon-Gamma can Stimulate Post-Proteasomal Trimming of the N Terminus of an Antigenic Peptide by Inducing Leucine Aminopeptidase. J. Biol. Chem. 273, 18734-18742.

87. Van Kaer, L., Ashton-Rickardt, P. G., Ploegh, H. L., and Tonegawa, S. (1992) TAP1 Mutant Mice are Deficient in Antigen Presentation, Surface Class I Molecules, and CD4-8+ T Cells. Cell. 71, 1205-1214.

88. de la Salle, H., Zimmer, J., Fricker, D., Angenieux, C., Cazenave, J. P., Okubo, M., Maeda, H., Plebani, A., Tongio, M. M., Dormoy, A., and Hanau, D. (1999) HLA Class I Deficiencies due to Mutations in Subunit 1 of the Peptide Transporter TAP1. J. Clin. Invest. 103, R9-R13.

89. Furukawa, H., Murata, S., Yabe, T., Shimbara, N., Keicho, N., Kashiwase, K., Watanabe, K., Ishikawa, Y., Akaza, T., Tadokoro, K., Tohma, S., Inoue, T., Tokunaga, K., Yamamoto, K., Tanaka, K., and Juji, T. (1999) Splice Acceptor Site Mutation of the Transporter Associated with Antigen Processing-1 Gene in Human Bare Lymphocyte Syndrome. J. Clin. Invest. 103, 755-758.

90. de la Salle, H., Hanau, D., Fricker, D., Urlacher, A., Kelly, A., Salamero, J., Powis, S. H., Donato, L., Bausinger, H., and Laforet, M. (1994) Homozygous Human TAP Peptide Transporter Mutation in HLA Class I Deficiency. Science. 265, 237-241.

91. Moins-Teisserenc, H. T., Gadola, S. D., Cella, M., Dunbar, P. R., Exley, A., Blake, N., Baykal, C., Lambert, J., Bigliardi, P., Willemsen, M., Jones, M., Buechner, S., Colonna, M., Gross, W. L., and Cerundolo, V. (1999) Association of a Syndrome Resembling Wegener's Granulomatosis with Low Surface Expression of HLA Class-I Molecules. Lancet. 354, 1598-1603.

92. Yabe, T., Kawamura, S., Sato, M., Kashiwase, K., Tanaka, H., Ishikawa, Y., Asao, Y., Oyama, J., Tsuruta, K., Tokunaga, K., Tadokoro, K., and Juji, T. (2002) A Subject with a Novel Type I Bare Lymphocyte Syndrome has Tapasin Deficiency due to Deletion of 4 Exons by Alu-Mediated Recombination. Blood. 100, 1496-1498.

93. de la Salle, H., Saulquin, X., Mansour, I., Klayme, S., Fricker, D., Zimmer, J., Cazenave, J. P., Hanau, D., Bonneville, M., Houssaint, E., Lefranc, G., and Naman, R. (2002) Asymptomatic Deficiency in the Peptide Transporter Associated to Antigen Processing (TAP). Clin. Exp. Immunol. 128, 525-531.

94. Zimmer, J., Andres, E., Donato, L., Hanau, D., Hentges, F., and de la Salle, H. (2005) Clinical and Immunological Aspects of HLA Class I Deficiency. QJM. 98, 719-727.

95. Lankat-Buttgereit, B., and Tampe, R. (2002) The Transporter Associated with Antigen Processing: Function and Implications in Human Diseases. Physiol. Rev. 82, 187-204.

96. de la Salle, H., Houssaint, E., Peyrat, M. A., Arnold, D., Salamero, J., Pinczon, D., Stevanovic, S., Bausinger, H., Fricker, D., Gomard, E., Biddison, W., Lehner, P., UytdeHaag, F., Sasportes, M., Donato, L., Rammensee, H. G., Cazenave, J. P., Hanau, D., Tongio, M. M., and Bonneville, M. (1997) Human Peptide Transporter Deficiency: Importance of HLA-B in the Presentation of TAP-Independent EBV Antigens. J. Immunol. 158, 4555-4563.

97. Vitale, M., Zimmer, J., Castriconi, R., Hanau, D., Donato, L., Bottino, C., Moretta, L., de la Salle, H., and Moretta, A. (2002) Analysis of Natural Killer Cells in TAP2-Deficient Patients: Expression of Functional Triggering Receptors and Evidence for the Existence of Inhibitory Receptor(s) that Prevent Lysis of Normal Autologous Cells. Blood. 99, 1723-1729.

98. Qu, H. Q., Lu, Y., Marchand, L., Bacot, F., Frechette, R., Tessier, M. C., Montpetit, A., and Polychronakos, C. (2007) Genetic Control of Alternative Splicing in the TAP2 Gene: Possible Implication in the Genetics of Type 1 Diabetes. Diabetes. 56, 270-275.

99. Penfornis, A., Tuomilehto-Wolf, E., Faustman, D. L., Hitman, G. A., and DiMe (Childhood Diabetes in Finland) Study Group. (2002) Analysis of TAP2 Polymorphisms in Finnish Individuals with Type I Diabetes. Hum. Immunol. 63, 61-70.

100. Rau, H., Nicolay, A., Donner, H., Usadel, K. H., and Badenhoop, K. (1997) Polymorphisms of TAP1 and TAP2 Genes in German Patients with Type 1 Diabetes Mellitus. Eur. J. Immunogenet. 24, 229-236.

101. Rau, H., Nicolay, A., Usadel, K. H., Finke, R., Donner, H., Walfish, P. G., and Badenhoop, K. (1997) Polymorphisms of TAP1 and TAP2 Genes in Graves' Disease. Tissue Antigens. 49, 16-22.

102. Moins-Teisserenc, H., Semana, G., Alizadeh, M., Loiseau, P., Bobrynina, V., Deschamps, I., Edan, G., Birebent, B., Genetet, B., and Sabouraud, O. (1995) TAP2 Gene Polymorphism Contributes to Genetic Susceptibility to Multiple Sclerosis. Hum. Immunol. 42, 195-202.

103. Salcedo, M., Andersson, M., Lemieux, S., Van Kaer, L., Chambers, B. J., and Ljunggren, H. G. (1998) Fine Tuning of Natural Killer Cell Specificity and Maintenance of Self Tolerance in MHC Class I-Deficient Mice. Eur. J. Immunol. 28, 1315-1321.

104. Dorfman, J. R., Zerrahn, J., Coles, M. C., and Raulet, D. H. (1997) The Basis for Self-Tolerance of Natural Killer Cells in beta2-Microglobulin- and TAP-1- Mice. J. Immunol. 159, 5219-5225.

105. Markel, G., Mussaffi, H., Ling, K. L., Salio, M., Gadola, S., Steuer, G., Blau, H., Achdout, H., de Miguel, M., Gonen-Gross, T., Hanna, J., Arnon, T. I., Qimron, U., Volovitz, I., Eisenbach, L., Blumberg, R. S., Porgador, A., Cerundolo, V., and Mandelboim, O. (2004) The Mechanisms Controlling NK Cell Autoreactivity in TAP2-Deficient Patients. Blood. 103, 1770-1778.