Phenotypic Mutation 'Winnie' (pdf version)
List |< first << previous [record 567 of 584] next >> last >|
AlleleWinnie
Mutation Type missense
Chromosome7
Coordinate141,699,460 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Muc2
Gene Name mucin 2
Synonym(s) 2010015E03Rik
Chromosomal Location 141,690,340-141,754,693 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_023566; MGI: 1339364

Mapped Yes 
Amino Acid Change Cysteine changed to Tyrosine
Institutional SourceAustralian Phenomics Network
Ref Sequences
C987Y in NCBI: NP_076055.2 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
VWD 20 183 1.2e-40 SMART
C8 216 290 3.1e-15 SMART
Pfam:TIL 293 349 1.7e-9 PFAM
VWC 351 411 5.6e-4 SMART
VWD 378 542 7e-44 SMART
C8 579 653 9.7e-37 SMART
SCOP:d1coua_ 654 728 6e-6 SMART
VWC_def 820 865 1e-2 SMART
VWD 848 1006 2.6e-53 SMART
C8 1042 1116 7.8e-35 SMART
low complexity region 1235 1356 N/A INTRINSIC
low complexity region 1359 1453 N/A INTRINSIC
low complexity region 1503 1553 N/A INTRINSIC
VWD 1614 1782 2e-50 SMART
C8 1826 1899 7.2e-19 SMART
VWC 1956 2024 2.2e-4 SMART
VWC 2065 2129 9.2e-14 SMART
CT 2216 2299 1.4e-37 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using NCBI: NP_076055.2)
Phenotypic Category Autosomal Semidominant
Penetrance 100% 
Alleles Listed at MGI
All alleles(7) : Targeted, knock-out(1) Targeted, other(2) Chemically induced(4)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141693356 missense unknown
kenny APN 7 nonsense
IGL01303:Muc2 APN 7 141752395 missense unknown
IGL01482:Muc2 APN 7 141754060 unclassified unknown
IGL01875:Muc2 APN 7 141752740 missense probably damaging 0.99
IGL02088:Muc2 APN 7 141751504 missense unknown
IGL02415:Muc2 APN 7 141751872 nonsense probably null
IGL02548:Muc2 APN 7 141751857 missense unknown
IGL02836:Muc2 APN 7 141746713 missense probably null 0.00
IGL03196:Muc2 APN 7 141747630 missense probably damaging 0.97
Muskatenwein UTSW 7 141753439 missense unknown
nomoco UTSW 7 141753719 missense probably damaging 1.00
Schlendrian UTSW 7 141695682 missense probably damaging 1.00
E0370:Muc2 UTSW 7 141696355 missense probably damaging 1.00
R0127:Muc2 UTSW 7 141748954 missense probably benign 0.00
R0179:Muc2 UTSW 7 141748971 missense probably damaging 1.00
R0201:Muc2 UTSW 7 141699185 frame shift probably null
R0299:Muc2 UTSW 7 141752729 missense probably damaging 1.00
R0547:Muc2 UTSW 7 141699185 frame shift probably null
R0699:Muc2 UTSW 7 141752300 missense probably damaging 1.00
R0900:Muc2 UTSW 7 141699185 frame shift probably null
R1348:Muc2 UTSW 7 141699185 frame shift probably null
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1625:Muc2 UTSW 7 141697162 missense probably damaging 1.00
R2010:Muc2 UTSW 7 141700875 missense probably damaging 0.99
R2149:Muc2 UTSW 7 141699185 frame shift probably null
R2163:Muc2 UTSW 7 141699185 frame shift probably null
R3008:Muc2 UTSW 7 141695104 missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141745488 missense not run
R3112:Muc2 UTSW 7 141745488 missense not run
R3424:Muc2 UTSW 7 141693352 missense probably damaging 0.99
R3786:Muc2 UTSW 7 141697347 missense probably benign 0.01
R3854:Muc2 UTSW 7 141754344 missense probably damaging 1.00
R3964:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3965:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3966:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3973:Muc2 UTSW 7 141746804 missense not run
R3974:Muc2 UTSW 7 141746804 missense not run
R3976:Muc2 UTSW 7 141746804 missense not run
R4327:Muc2 UTSW 7 141695334 missense probably damaging 0.96
R4694:Muc2 UTSW 7 141752345 missense probably damaging 1.00
R4764:Muc2 UTSW 7 141745608 missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141699691 critical splice donor site probably null
R4798:Muc2 UTSW 7 141754140 missense probably benign 0.01
R4900:Muc2 UTSW 7 141749543 missense probably benign 0.45
R5383:Muc2 UTSW 7 141753719 missense probably damaging 1.00
R5489:Muc2 UTSW 7 141751432 missense probably benign 0.00
R5615:Muc2 UTSW 7 141691203 missense probably damaging 1.00
R5856:Muc2 UTSW 7 141745644 missense not run
R5919:Muc2 UTSW 7 141694928 missense probably damaging 0.97
R5953:Muc2 UTSW 7 141701382 missense probably damaging 0.96
R5979:Muc2 UTSW 7 141697250 missense probably null
R5979:Muc2 UTSW 7 141751406 missense probably damaging 0.99
R6175:Muc2 UTSW 7 141696632 missense probably damaging 1.00
R6213:Muc2 UTSW 7 141751414 missense probably damaging 1.00
R6281:Muc2 UTSW 7 141752403 missense probably damaging 1.00
R6320:Muc2 UTSW 7 141700828 missense possibly damaging 0.71
R6390:Muc2 UTSW 7 141752146 missense unknown
R6485:Muc2 UTSW 7 141746736 missense not run
R6582:Muc2 UTSW 7 141696698 missense probably benign 0.00
Mode of Inheritance Autosomal Semidominant
Local Stock None
Repository

Australian PhenomeBank: 91

Last Updated 2017-09-13 3:35 PM by Diantha La Vine
Record Created 2010-02-03 3:47 PM by Nora G. Smart
Record Posted 2010-02-04
Phenotypic Description
The Winnie phenotype was identified amongst the G3 progeny of an ENU-treated C57BL/6 founder by their visible phenotype of spontaneous watery diarrhoea and high incidence of rectal bleeding and prolapse, suggestive of ulcerative colitis. Due to the similarities in phenotype between Winnie and Eeyore animals, these strains were crossed and noncomplementation was demonstrated indicating that both Winnie and Eeyore contained mutations within the same gene. Compared with wild-type littermates, Winnie small and large intestines were characterized by fewer goblet cells with smaller thecae, and a reduction in stored and secreted mucin. The cellular distribution and processing of MUC2 was altered with increased cytoplasmic and non-glycosylated MUC2 present in mutant tissue.  Animals also displayed increased intestinal epithelial proliferation and apoptosis (Figure 1). Winnie homozygous animals exhibited classical signs of murine colitis, including crypt elongation, neutrophilic infiltrates, goblet cell loss, crypt abscesses, and focal epithelial erosions particularly in the distal large intestine (Figure 2).
 
In addition to spontaneous inflammation, Winnie mice exhibited increased susceptibility to environmentally induced colitis. Low doses dextran sodium sulfate (0.5% DSS), resulted in rapid weight loss and lethal ulcerating colitis in Winnie by day 30, whereas wild-type mice gained weight and survived for at least 9 weeks.  After being administered 2% DSS, Winnie animals showed earlier faecal occult blood than did wild-type mice (after exclusion of mice with spontaneous rectal bleeding or prolapses), and higher histological colitis scores after 3 days, whereas by day 7 colitis scores in wild-type mice were closer to those of mutant mice. After oral 3% DSS for 7 days, Winnie mice exhibited more severe colitis than did wild-type controls, based on rate and extent of weight loss, colon length, changes in stool scores, haematocrit, blood haemoglobin, and leukocyte counts (Figure 3).
 
Winnie heterozygotes exhibited increased rectal bleeding in response to DSS, indicating that these mutations are not simple recessive mutations under environmental stress. On day 4, only one in five wild-type mice showed rectal bleeding compared to five of five Winnie and five of five heterozygous mice (Figure 3) (1).
Nature of Mutation
The Winnie mutation corresponds to a G to A transition at position 2967 of the Muc2 transcript in exon 24 of 47 total exons (2).
 
2951 CTGCAGGGCACTGTATGTGGTCTGTGTGGGAAC
982  -Y--K--G--T--V--C--G--L--C--G--N-
 
The mutated nucleotide is indicated in red lettering, and causes a cysteine to tyrosine change at amino acid 987 of the MUC2 protein.
Protein Prediction
Figure 4.  Domain structure of Mucin2. The Winnie mutation causes a cysteine to tyrosine change in the D3 domain of the MUC2 protein. S=Signal sequence; D=D domains (homology to VWF mediates trimerization); CR=Cystein-rich domain; TR= Tandem repeat domain (heavily O glycosylated); GDPH=GDPH autocatalytic proteolytic site; B=B domain (homology to VWF); C= C domain (homology to VWF); CK= Cysteine-knot domain (homology to VWF mediates dimerization). This image is interactive. Click on the image to view other mutations found in Mucin2 (red). Click on the mutations for more specific information.
The Winnie mutation alters a conserved cysteine residue located in the third VWF-like domain (Figure 4). 
 
For more information about Muc2, please see the record for Schlendrian.

 

Putative Mechanism
The Winnie mutation alters a cysteine in the N-terminal D3 domain of MUC2, which has been shown to mediate MUC2 trimerization through the formation of disulfide bonds (3). It is likely that the amino acid change affects MUC2 biosynthesis and assembly, perhaps by disrupting the formation of an important disulfide bond. In Winnie mice, the development of colitis resulted from the aberrant oligomerization (Figure 5) and subsequent accumulation of MUC2 in the ER, which leads to ER stress, triggering of the unfolded protein response (UPR), subsequent inflammation and goblet cell apoptosis (Figure 6). MUC2 in Winnie mice displayed altered N-terminal oligomerization resulting in hyperoligomerization of the protein (1).

Primers Primers cannot be located by automatic search.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsChad K. Heazlewood, Matthew C. Cook, Rajaraman Eri, Gareth R. Price, Sharyn B. Tauro, Douglas Taupin, David J. Thornton, Chin Wen Png, Tanya L. Crockford, Richard J. Cornall, Rachel Adams, Masato Kato, Keats A. Nelms, Nancy A. Hong, Timothy H. J. Florin, Christopher C. Goodnow and Michael A. McGuckin
List |< first << previous [record 567 of 584] next >> last >|
Edit History
2011-06-10 4:28 PM (current)
2011-01-04 2:56 PM
2010-12-16 11:44 AM
2010-10-14 1:40 PM
2010-10-14 1:39 PM
2010-08-10 11:03 AM
2010-08-10 10:58 AM
2010-08-10 10:58 AM
2010-08-10 10:57 AM
2010-06-26 10:28 PM
2010-06-08 11:52 AM
2010-04-08 4:59 PM
2010-04-08 4:58 PM
2010-02-04 12:00 AM