Phenotypic Mutation 'bumble' (pdf version)
List |< first << previous [record 46 of 511] next >> last >|
Allelebumble
Mutation Type critical splice donor site (2 bp from exon)
Chromosome7
Coordinate30,425,411 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Nfkbid
Gene Name nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, delta
Synonym(s) IkappaBNS
Chromosomal Location 30,421,732-30,428,746 bp (+)
MGI Phenotype Mice homozygous for a null allele produce higher levels of IL-6 following stimulation and are more susceptible to chemically induced endotoxin shock and colitis.
Accession Number

NCBI RefSeq: NM_172142; MGI: 3041243

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000042317 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
ANK 98 127 2.07e-2 SMART
ANK 131 160 1.5e1 SMART
ANK 166 215 5.58e1 SMART
ANK 220 250 4.93e0 SMART
ANK 257 290 8.39e-3 SMART
Phenotypic Category decrease in B cells, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance 100% 
Alleles Listed at MGI

All alleles(9) : Targeted(5) Gene trapped(4)          

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Nfkbid APN 7 30425264 nonsense probably null 0.00
IGL02809:Nfkbid APN 7 30425235 missense possibly damaging 0.45
R1515:Nfkbid UTSW 7 30425356 missense probably benign 0.00
R2233:Nfkbid UTSW 7 30425859 splice donor site probably benign
R2234:Nfkbid UTSW 7 30425859 splice donor site probably benign
R2235:Nfkbid UTSW 7 30425859 splice donor site probably benign
R5550:Nfkbid UTSW 7 30426001 missense possibly damaging 0.94
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission 036725-MU
Last Updated 03/28/2017 2:20 PM by Katherine Timer
Record Created 02/09/2010 9:14 PM by Carrie N. Arnold
Record Posted 07/19/2012
Other Mutations in This Stock Stock #: N/A - 535 Run Code: SLD00202
Coding Region Coverage: 1x: 83.1% 3x: 57.4%
Validation Efficiency: 80/91

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
Cacna1e A to T 1: 154,465,764 L920Q probably damaging Het
Cd44 T to C 2: 102,814,189 M763V probably benign Het
Eif4g3 T to A 4: 138,120,428 V210D possibly damaging Het
Gm12778 T to A 7: 34,175,922 W80R possibly damaging Homo
Klhl29 C to T 12: 5,084,019 A773T probably damaging Homo
Lifr A to T 15: 7,186,953 H803L possibly damaging Het
Macf1 T to C 4: 123,473,808 T2387A probably damaging Het
Obscn A to T 11: 59,000,308 C1653S possibly damaging Het
Ogdh T to C 11: 6,324,911 L180P possibly damaging Het
Rnf5 T to C 17: 34,603,356 S40G possibly damaging Het
Sbf2 T to C 7: 110,312,752 T1742A probably benign Het
Ska2 C to T 11: 87,117,854 probably benign Het
Phenotypic Description

Figure 1.  Serum NP-specific IgM (A) and βGal-specific IgG (B) measured by ELISA in WT and G3 mice immunized 5 or 14 d before with NP-Ficoll and rSFV-βGal.  The bumble index mice are indicated in red.  Reproduced from (1).

Figure 2.  Mice with a targeted mutation in Nfkbid phenocopy bumble mice.  Serum NP-specific IgM (A) and βGal-specific igG (B) responses measured by ELISA in WT mice, bumble homozygotes, and mice with a targeted mutation in Nfkbid immunized 5 or 14 d before with NP-Ficoll and rSFV-βGal, respectively.  Each point represents data from one mouse, and the bar indicates the mean of all values.  Background (indicated by the dashed line) was determined by incubating pooled WT sera on uncoated wells.  Reproduced from (1).
Figure 3.  Basal serum levels of IgM and IgG3 are reduced in bumble mice.  Please see cellophane and Worker for more details about these mutations. Levels of immunoglobins of the indicated isotypes in sera from naïve WT and mutant mice.  Each point represents data from one mouse, and the bar indicates the mean of all values.  Background (indicated by the dashed line) was determined by incubating a positive control sample on uncoated ELISA wells.  Reproduced from (1).
Figure 4.  The primary T-dependent antibody response is impaired in bumble mice. Please see cellophane and Worker for more details about these mutations.  WT and mutant mice were immunized with alum-precipitated NP-CGG.  Serum levels of NP-specific IgM (A)  and total NP-specific IgG1 (B) were measured by ELISA.  Each point represents the mean  (+ range) of greater than or equal to three mice per genotype.  Reproduced from (1).
Figure 5.  Germinal center formation and memory B cell function is normal in bumble mice. (A) CD38 vs. Peanut Agglutinin (PNA) binding on IgDlowB220high splenocytes from naïve WT or WT and bumble mice immunized 14 d before (Upper) or WT and cellophane mice immunized 11 d before (Lower) with alum-precipitated NP-CGG.  Plots are representative of two to five naïve WT and three to seven immunized mice per genotype. (B)  GC B cells as a percent of total B220high splenocytes in naïve WT or immunized WT and bumble mice.  WT vs. bumble, P > 0.05, Mann-Whitney U test.  Reproduced from (1).
Figure 6.  Lymphocyte development is impaired in bumble mice.  Please see cellophane and Worker for more details about these mutations.  Single-cell suspensions from WT and mutant mice were analyzed by flow cytometry. (A) IgM- B220int pro- or pre-B cells, IgM+ B220int immature B cells, and IgM+ B220high mature B cells as a percent of bone marrow lymphocytes. (B) B220+ B cells as a percent of splenocytes and IgDlow IgMhigh B200+ immature, IgDhigh IgMint B220+ mature follicular, and CD21/35high CD23low B220+ MZ B cells as a percent of splenic B220+ B cells. (C) Mean fluorescence intensity of CD44 on CD4+ and CD8+ T cells and IgM on B220+ B cells in spleen.  (D) CD19int B220high B2 and CD19high B220low/int B1 B cells as a percent of peritoneal cavity lymphocytes. (E) CD5high CD43high CD19high B220low/int B1a and CD5low CD43low CD19high B220low/int B1b B cells as a percent of peritoneal cavity B1 B cells.  (F) CD4- CD- DN, CD4+ CD8+ DP, and CD4or CD8+ SP cells as a percent of thymocytes.  (G) CD69- and CD69+ TCRβ+ CD4or CD8+ cells as a percent of CD4+ or CD8+ thymocytes, respectively. (H) CD4+ and CD8+ T cells and NK1.1+ cells as a percent of splenocytes.  Bars indicate the mean (+ range) of three to seven mice per genotype analyzed, except for A, in which the mean (+ range) is shown for two WT mice.  Reproduced from (1).

Bumble mice fail to make detectable T-independent IgM responses 5 days after immunization with NP-Ficoll (Figure 1A) and T-dependent IgG responses 14 days after immunization with a recombinant SFV vector encoding the model antigen, β-galactosidase (βGal) (Figure 1B(1). Mice with a targeted disruption in Nfkbid phenocopy bumble mice in their response to both NP-Ficoll (Figure 2A) and βGal (Figure 2B), indicating that the bumble mutation causes loss of function of Nfkbid. Levels of basal serum antibodies are, for the most part, normal in bumble mice, with the exception of IgM and IgG3, both of which are reduced compared with wild-type littermates (Figure 3(1). Seven and fourteen days post-immunization with alum-precipitated NP-chicken gamma globulin (CGG), the bumble mice have no detectable NP-specific IgM responses (Figure 4A) (1). NP-specific IgG1 levels are low at seven days, but reach wild-type levels by fourteen days post-immunization (Figure 4B); most of the NP-specific IgG1 on day 14 is high affinity and therefore most likely produced by germinal center (GC) antibody secreting cells (ASCs) (1). Germinal center formation and memory B cell function are normal in bumble mice (Figure 5A & B) (1). These findings strongly suggest a specific defect in extrafollicular ASC responses.

 

B-cell development in the bone marrow of the bumble mice is normal, as indicated by normal frequencies of pro- or pre-, immature, and mature B cells (Figure 6A).  Although the frequencies of follicular B cells in the spleens of the bumble mice are normal (Figure 6B), the levels of surface IgM are slightly higher than wild-type (Figure 6C) (1).  The bumble mice have reduced frequencies of marginal zone (MZ) B cells (Figure 6B) and peritoneal B1 B cells (Figure 6D); most B1 B cells that developed were B1b B cells (Figure 6E(1).  Bumble mice have normal frequencies of double-negative, double-positive, and CD4 and CD8 single-positive thymocytes (Figure 6F) (1).  There are no significant differences between the bumble and wild-type mice in the frequencies of CD69- and CD69+ TCRβ+ CD4or CD8+ thymocytes (Figure 6G) (1). In addition, the frequencies of splenic CD44lo and CD44hi CD4+ and CD8+ T cells, and NK1.1+ cells in the bumble mice are comparable to those of wild-type mice (Figure 6H) (1).

Nature of Mutation
Figure 7.  DNA sequencing trace.
Figure 8.  The bumble mutation.  Nfkbid contains 12 exons, 9 of which encode 327 translated amino acids.  The bumble mutation is located with intron 4 and prevents the removal of the fourth intron; this results in the addition of a glycine and valine residues and a premature stop codon after exon 4.

The bumble mutation was mapped using bulk segregation analysis (BSA) of 47 F2 intercross offspring using C57BL/10J as the mapping strain (18 lacking and 29 with normal IgM responses to NP-Ficoll immunization).  The bumble mutation showed strongest linkage with the marker at position 28467081 bp on chromosome 7 (synthetic LOD=11.93). Whole genome SOLiD sequencing of a homozygous bumble mouse identified a T to G transversion at base pair 31210430, 2.7 Mb from the marker of peak lineage, on chromosome 7 in the genomic region NC_000073 encoding Nfkbid.  The mutation corresponds to nucleotide two within the donor splice site of the fourth intron of Nfkbid (Figure 7).  Nfkbid contains 12 exons, 9 of which encode 327 translated amino acids (Figure 8).  The bumble mutation prevents the removal of the fourth intron and results in the addition of a glycine and valine residue and a premature stop codon after exon 4. 

 

wild-type:
<--exon 4           intron 4-->              exon 5-->
...GATGAGGAAGGAGACACgtgagtatagg..cccctccccagGCTCCTGCACCTG...
....D..E..E..G..D..T                        ..L..L..H..L...                        
       correct                                  correct
 
bumble:
<--exon 4           intron 4-->              exon 5-->
...GATGAGGAAGGAGACACgggagtatagg..cccctccccagGCTCCTGCACCTG...
....D..E..E..G..D..T..G..V..*.                                              
       correct        aberrant                        
 
The donor splice site of intron 4, which is destroyed by the mutation, is indicated in blue; the mutated nucleotide is indicated in red.
Protein Prediction
Figure 9.  The IκB family.  There are two IκB family subsets: classical and novel.  The classical IκBs are IκBα, IκBβ, and IκBε; the novel IκBs are Bcl3 (B cell CLL/lymphoma 3), IκBζ, and IκBNS. IκBNS is reported to have seven ankyrin repeats labeled A-G.  The mouse protein is 91% identical to the human homologue, and is most similar to IκBζ. 

Figure 10. Ankyrin domains of two IκB proteins.  (A) The first six of seven ankyrin domains in IκBNS align with ankyrin domains 1 through 6 of the structurally characterized IκBα (PDB: 1NFI).  (B) Bcl3 (PDB: 1K1A) is a seven ankyrin repeat protein, and shows great similarity to the IκBα structure through the central ankyrin repeats.  3D structures were generated using UCSF Chimera.

The Nfkbid gene encodes a 327 amino acid protein, IκBNS, that belongs to a family of proteins known as the inhibitors of nuclear factor-κB (NF-κB)or IκB proteins [reviewed by (2;3)] (Figure 9). IκBs include the classical IκBs, IκBα, IκBβ, and IκBε, which inhibit the NF-κB pathway by sequestering NF-κB proteins in the cytoplasm, and the novel or nuclear IκBs; Bcl3 (B cell CLL/lymphoma 3), IκBζ (also known as MAIL and INAP) and IκBNS (4). In addition, the p100/NFκB2 (see the record for xander) and p105/NFκB1 NF-κB precursor proteins, which are cleaved into p52 and p50 respectively, share common structural features with this family of proteins that allow them to function as IκBs. Lastly, an alternative transcript of the Nfkb1 gene in the mouse encodes an IκB molecule, IκBγ, whose biological role remains unclear (5). These proteins all contain multiple C-terminal ankyrin repeats that mediate binding to NF-κB dimers and can interfere with the function of NF-κB nuclear localization signals (NLS).  Unlike the classical IκB proteins that contain six ankyrin repeats, the novel IκBs generally contain seven, although the predicted number of repeats varies depending on the analysis used (4). IκBNS is reported to have seven ankyrin repeats labeled A-G (Figure 9). The mouse protein is 91% identical to the human homologue, and is most similar to IκBζ with 43% identity (6)

 

Ankyrin repeats span over 33 residues and are highly divergent (7), but contain a basic core motif of an initial β-hairpin followed by two anti-parallel α helices connected by a tight-hairpin loop.  When an alignment using the entire IκBNS protein sequence is performed, the first six of seven ankyrin domains in IκBNS align with ankyrin domains 1 through 6 of the structurally characterized IκBα (PDB 1NFI; Figure 10A) (8;9).  Repeats B, C, E, and F are the most conserved whereas the N-terminal (A) and C-terminal (G) repeats are much less conserved (6).  Ankyrin repeats do not behave independently, but associate in tandem to provide stabilizing interactions. The C-terminal and N-terminal ankyrin repeats interact only with one neighboring repeat and therefore are less evolutionarily constrained.  The seven ankyrin repeat protein, Bcl3, has also been structurally characterized (PDB 1K1A; Figure 10b), and shows great similarity to the IκBα structure through the central ankryin repeats, but is divergent at the N- and C-terminal ankyrin repeats (10). A large portion of the IκBα surface is involved in recognizing NF-κB and different ankyrin repeats contact different portions of the NF-κB dimer p65 (RelA)/p50 including the nuclear localization sequence (NLS)-containing C-terminus of p65, and the dimerization domains of both subunits (8;9). These regions are relatively well conserved in Bcl3, but changes are observed especially in residues contacting the NLS of NF-κB proteins. Unlike IκBα, Bcl3 is mainly a nuclear protein and does not sequester NF-κB proteins in the cytoplasm. Binding and masking the NF-κB NLS is less important for its function (10).  Similar changes are observed in the other nuclear IκBs including IκBNS (6). As compared with other IκBs including p100, p105, Bcl3 and IκBα, both IκBNS and IκBζ have an insertion in ankyrin repeat D within the tight β-turn that lies between the α helices. Secondary structure predictions suggest that this results in an extended outer helix rather than a long loop insertion between the inner and outer helices of the ankyrin repeat.  This may lead to an interruption of the ankyrin repeat packing, and a second tandem of ankyrin repeats would start at ankyrin repeat E and terminate with ankyrin repeat G (6).

 

In addition to the ankyrin repeats, IκBNS contains four potential protein kinase C (PKC; see the record for Untied) phosphorylation sites S/T-X-R/K at amino acids 20–22, 43–45, 220–222, and 289–291, and one potential casein kinase II phosphorylation site S/T-X2-D/E at amino acids 214–217 (6). However, IκBNS does not contain the DSGL-D/G/E-S motif found in the classical IκB proteins that targets these serines for phosphorylation thereby creating a binding site for the recognition subunit of the E3 ligase SCFβ-TrCP leading to K48-linked polyubiquitination and protein degradation [reviewed in (11)]. Furthermore, the lysines that are ubiquitinated in IκBα, β, and ε are not conserved in IκBNS (6). Finally, the seventh ankyrin repeat of IκBNS replaces the C-terminal IκBα PEST domain that controls basal levels of IκBα protein (11).

 

IκBNS has been shown to bind to NF-κB proteins.  In the cytoplasm, this interaction appears to be specific to p50 and RelB, while in the nucleus IκBNS binds to p50, p52, p65 and RelB (6). IκBNS has also been shown to interact with c-Rel (12), suggesting that it has the capability to interact with most or all NF-κB family members.   

 

The bumble mutation results in the creation of a premature stop codon that is predicted to trigger nonsense mediated decay of the mutant transcript.

Expression/Localization

Nfkbid mRNA is observed in the spleen and at low levels in the thymus, but is absent in other tissues (6). Expression is also found in colonic lamina propria (CLP) macrophages (13) and in a subset of antigen-presenting dendritic cells (DCs), which appear to negatively regulate the inflammatory response and are known as regulatory DCs (14)

 

IκBNS is localized predominantly to the nucleus (6). The expression of the novel IκBs is regulated very differently from classical IκB proteins. Whereas IκBα, IκBβ and IκBε are phosphorylated, ubiquitinated and subject to degradation, the novel IκBs are under tight transcriptional regulation rather than proteasomal degradation.  Both IκBNS and IκBζ are induced by TLR stimulation in macrophages and DCs (13;15-17), while the anti-inflammatory cytokine interleukin-10 (IL-10) can induce IκBNS and Bcl3 (13;18)Nfkbid mRNA is also upregulated in thymocytes upon TCR-triggered cell death during negative selection (6).

 

According to SymAtlas, Nfkbid mRNA is also found in B cells and mast cells stimulated with IgE for one hour.

Background
Figure 11. Canonical and non-canonical NF-κB signaling pathways. In the canonical pathway, several membrane receptors, including TNFR (tumor-necrosis factor receptor), IL-1R (interleukin-1 receptor) and TLRs (toll-like receptors), signal through kinases and adaptors (TRAFs), resulting in IKK activation. This activation occurs after the K63 ubiquitination of TRAFs and RIP. TAK1 and its adaptor proteins TAB1 and TAB2 bind ubiquitin chains to TRAF and NEMO (IKKγ) resulting in the activation of the IKK complex (NEMO, IKKα and IKKβ). Ubiquitination can be inhibited by deubiquitinating enzymes (DUB). Stimulation of the T-cell receptor (TCR) and B-cell receptor (BCR) results in the recruitment of Src and Syk family kinases. These kinases activate a phosphorylation cascade which leads to the activation of protein kinase C (PKC). The phosphorylation of CARMA1 (CARD (caspase-recruitment domain)-MAGUK (membrane-associated guanylate kinase) protein 1) recruits BCL 10 (B-cell lymphoma 10) and MALT1 (mucosa-associated lymphoid tissue lymphoma translocation gene 1), forming the CBM complex and activating the IKK complex. The IKK complex phosphorylates both IκB, p105 and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles) by 26S proteasome. Degradation of IκB releases activated NF-κB dimers for translocation to the nucleus. A subset of TNFRs such as the lymphotoxin-β receptor (LT-βR),CD40, B-cell-activating factor receptor (BAFFR) and receptor activator of Nf-κB (RANK) can activate the canonical or non-canonical NF-κB signaling pathways. In the non-canonical pathway, the receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination, enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKα which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the 26S proteasomal degradation of p100 and the processing of p52. P52 and RelB are released for translocation to the nucleus. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

The NF-κB signaling pathway functions in essentially all mammalian cell types and is activated in response to injury, infection, inflammation and other stressful conditions requiring rapid reprogramming of gene expression (Figure 11). Typically, the rapid and transient activation of NF-κB complexes in response to a wide range of stimuli such as proinflammatory cytokines tumor necrosis factor (TNF)-α, IL-1β, IL-6, and CD40 ligand (see the record for walla), DNA damaging agents, Toll-like receptor (TLR) agonists or viruses is regulated by the canonical NF-κB pathway. In the resting cell, NF-κB dimers are kept inactive in the cytoplasm through their association with the IκB inhibitory molecules IκBα, IκBβ and IκBε (19). In response to stimulation, the classical IκB proteins are phosphorylated by the IκB kinase (IKK) complex, composed of IKK-1 (or IKK-α), IKK-2 (or IKK-β) and IKK-γ (also known as NEMO; see the record for panr2), at conserved serine residues resulting in K48-linked polyubiquitination of IκB molecules and subsequent proteolysis. Degradation of IκBs allows the NF-κB dimers to translocate into the nucleus, where they are able to activate the transcription of target genes, including genes encoding various cytokines [for review see (2;3)]. The genes encoding the IκB proteins have been reported to be NF-κB target genes. Therefore, NF-κB activation generates feedback inhibition within the pathway, whereby re-synthesized IκBs sequester nuclear NF-κB dimers and mediate nuclear export of the inhibited NF-κB dimers to ensure appropriate termination of the canonical NF-κB response (20). Genetic studies have demonstrated that the IKK-2 and NEMO subunits of the IKK complex are required for canonical NF-κB activation (21), while IKK-1 and the NF-κB inducing kinase (NIK; see the record for lucky) are required for the non-canonical or alternative NF-κB pathway (22). The non-canonical NF-κB pathway drives the post-translational processing of p100 to mature p52, and results in the activation of p52/RelB heterodimers (2;23-25), and appears to be mostly restricted to a subset of tumor necrosis factor (TNF) receptors including lymphotoxin-β receptor (LTβR), B cell activating receptor (BAFFR), CD40, receptor activator of NF-κB (RANK) and TNF-related weak inducer of apoptosis (TWEAK) (26-33). These receptors are involved in secondary lymphoid organogenesis (SLO), B cell differentiation, survival and homeostasis, osteoclastogenesis, and angiogenesis (22).

 

Canonical NF-κB signaling regulates both innate and adaptive immune responses, including those mediated by the TLRs, TNF receptors, the IL-1 receptor, as well as BCR and TCR. Upon stimulation, these receptors recruit adaptor proteins and activate immune complexes leading to IKK complex activation and IκB protein degradation. TLR signaling depends on two pathways utilizing different adaptor proteins, the myeloid differentiation (MyD) 88-dependent pathway (see pococurante and lackadaisical) acting in conjunction with MAL (MyD88-adaptor like; see torpid), and the TRIF (Toll-interleukin 1 receptor (TIR) domain-containing adaptor inducing IFN-β)/TRAM (TRIF related adaptor molecule)-dependent pathway (see records for Lps2 and Tram KO). The MyD88-dependent pathway leads to early NF-κB activation, while the TRIF-dependent pathway results in delayed NF-κB activation.  MyD88-dependent signaling requires the recruitment of the IRAK1 and IRAK4 (see otiose) to the receptor, while both MyD88 and TRIF recruit the receptor associated factor 6 (TRAF6). TRAF6 then activates the TGF-β–activated kinase (TAK) 1 resulting in subsequent phosphorylation and activation of the IKK complex kinases [reviewed in (34;35)]. NF-κB activation downstream of TLR stimulation leads to the expression of various proinflammatory cytokines such as TNF-α, interleukin-6 (IL-6) and IL-18.

 

BCR and TCR-induced NF-κB activation requires costimulatory signals and requires the formation of a lipid raft-associated multiprotein complex that includes the scaffolding proteins caspase recruitment domain 11 (CARD11; also known as CARMA1; see the record for king), Bcl10 and MALT1 (Mucosa-Associated Lymphoid tissue lymphoma Translocation-associated gene 1) (36-39). Similar to the TLR pathway, TRAF6 is required downstream of the Bcl10 complex in order to activate the IKK complex (40-42).   

 

The prototypical and most extensively studied member of the IκB family is IκBα.  IκBα is rapidly degraded during activation of canonical NF-κB signaling pathways leading to the release of multiple NF-κB dimers, although the p65/p50 heterodimer is likely the primary target of IκBα. IκBα bound to the p65/p50 heterodimer only masks the NLS of p65 leaving the p50 NLS exposed.  The exposed NLS of p50 coupled with nuclear export sequences (NES) in IκBα and p65 leads to constant shuttling of IκBα/NF-κB complexes between the nucleus and the cytoplasm (8;9).  Degradation of IκBα drastically alters the dynamic balance between cytosolic and nuclear localization signals to favor nuclear localization of NF-κB. Although both IκBβ and IκBε behave similarly, they display significant temporal differences in their degradation and resynthesis. Signal-induced IκBβ and IκBε degradation and resynthesis occur at much slower kinetics than those for IκBα. Analyses of NF-κB responses in MEFs lacking one, two, or all three IκB proteins demonstrate that they have unique functions, even within a given signaling pathway (43).  More recently, cells deficient in all three traditional IκB proteins were demonstrated to have relatively normal nuclear/cytoplasmic p65 distribution but significantly increased basal NF-κB-dependent gene expression (19). The retention of p65 in the cytoplasm despite the absence of the classical IκBs may be due to interaction with the NF-κB precursor proteins p100 and p105. This hypothesis is supported by a missense mutation in Ikbkg, the gene that encodes the IKK-γ component of the IKK complex (see the record for panr2). In mice carrying this allele, degradation of the IκB proteins occurs, but NF-κB does not translocate into the nucleus (44). IκBα-deficient mice display postnatal lethality with severe inflammatory dermatitis due to an increase in granulocyte numbers, and IκBα-deficient cells display increased NF-κB activation. Proliferation of B cells is enhanced and that of T cells is reduced (45-47). IκBε is primarily expressed in hematopoietic cells, and loss of IκBε results in selective defects in hematopoietic lineages in addition to enhanced Ig isotype switching and increased cytokine production (48-50). IκBε loss may be largely compensated for by IκBα as mice deficient in both these proteins display a severe disruption of lymphopoiesis and disrupted splenic architecture (49;50). Mice deficient in IκBβ exhibit no abnormal phenotypes (51).

 

As mentioned above, the final members of the IκB family, Bcl3, IκBζ and IκBNS are nuclear proteins and appear to regulate NF-κB signaling by a distinctly different mechanism. Bcl3 has been shown to bind to p50 and p52 homodimers, which are unable to initiate transcription on their own due to a lack of a transcriptional activation domain (TAD). p52 and p50 rely on interactions with NF-κB proteins like p65 or RelB that contain this domain in order to positively regulate transcription. A few studies suggest that Bcl3 can promote NF-κB activation by associating with and removing p50 and p52 homodimers from DNA and allowing binding of transcriptionally active NF-κB dimers. Alternatively, Bcl3 appears to contain a TAD, and its interaction with p50 and p52 may convert these homodimers into transcriptionally active complexes [(2) and references therein]. Bcl3 knockout mice exhibit impaired humoral immune responses and lack splenic germinal centers (52;53). This phenotype is similar to a subset of phenotypes displayed in Nfkb2 knockout animals (29;54), suggesting that Bcl3 positively regulates p52 function at least in B cell development. Bcl3 knockout animals also displayed impaired T helper (Th) cell responses (52;53). Th cells are composed of several subsets that produce specific cytokines involved in activating and directing other immune cells. In addition to positive regulation of NF-κB activity, Bcl3 has also been suggested to facilitate the repressive function of p50 by stabilizing p50 homodimers, thus preventing active NF-κB dimers from accessing DNA. Bcl3-deficient mice and macrophages were found to be hypersensitive to lipopolysaccharide (LPS)-induced TLR activation and displayed increased NF-κB activation (55). Bcl3 was also found to specifically inhibit TLR-dependent TNF-α production downstream of the anti-inflammatory cytokine IL-10 in macrophages (18)

 

IκBζ is not expressed constitutively, but rather is upregulated in response to IL-1 and LPS, but not TNF, and localizes to the nucleus (56;57). IκBζ-deficient macrophages display defective IL-6 production in response to all TLR ligands and IL-1 signaling, and show an impairment of a subset of LPS-inducible genes including IL-12p40 (16). Like Bcl3, IκBζ also possesses transactivation potential (58), and IκBζ associates with p50 on the Il6 promoter, suggesting that IκBζ plays a positive role in the NF-κB pathway by potentiating the transcriptional activity of NF-κB dimers. In support of this, NFκB1/p50-deficient cells displayed similar TLR and IL-1 responses (16).  However, IκBζ-deficient mice exhibit eye inflammation and atopic dermatitis-like skin lesions, indicating a negative role of IκBζ in the in vivo immune response (59;60).  Direct stimulation of IκBζ-deficient animals with LPS resulted in prolonged and elevated levels of TNF-α in the sera suggesting that IκBζ may be a negative regulator of TNF-α production in cell types other than macrophages (16). This is consistent with the in vitro role of IκBζ as a negative regulator of NF-κB activity in certain cell types (15).  Recently, IκBζ was found to be important in the development of the IL-17 and IL-21 producing Th17 subset. Th17 cells play an important role in the development of autoimmune diseases and IκBζ-deficient mice are resistance to experimental autoimmune encephalomyelitis (EAE). IκBζ enhances Il17a expression by binding directly to the regulatory region of the Il17a gene in cooperation with the nuclear hormone receptors RORγt and RORα (see the record for 4-limb clasper) (61).

 

IκBNS was originally cloned as a gene rapidly induced by T cell receptor (TCR) stimulation in thymocytes, and was thought to be involved in negative selection of T cells (6).  Negative selection is dependent on the strength of interaction of the final TCR receptor with self-MHC molecules expressed on stromal or antigen presenting cells in the thymus. Strong interactions and increased TCR signaling likely represent autoreactivity and result in negative selection, while moderate interactions indicate usefulness of the TCR and result in positive selection. Cells that are unable to effectively bind MHC are eliminated. Ectopic expression of IκBNS in DN thymocytes by retroviral transduction arrested their development at the DP stage and promoted anti-TCR induced death.  In addition, expression of IκBNS in Cos-7 cells prevented activation of an NF-κB-dependent luciferase reporter and NF-κB DNA binding, suggesting that IκBNS may function as a negative regulator of NF-κB-dependent immune responses (6).

 

Two independent studies described the generation and characterization of Nfkbid knockout mice (12;62).  In the first study, the role of IκBNS in TLR-dependent inflammatory responses of macrophages and dendritic cells was examined (62). Treatment of Nfkbid-/- macrophages or dendritic cells with TLR ligands resulted in normal production of “early “cytokines (TNF-α, IL-1β, IL-23) but increased production of “late” cytokines (IL-6, IL-12p40, IL-18). Prolonged NF-κB activity was detected in knockout macrophages, supporting an inhibitory function for IκBNS towards NF-κB on selected promoters. In support of the anti-inflammatory role of IκBNS in macrophages, knockout mice were highly sensitive to LPS-induced endotoxin shock and displayed increased susceptibility to dextran sodium sulfate (DSS)-induced intestinal inflammation (62).

 

In the second study, a Nfkbid knockout mouse was generated to determine the role of IκBNS in thymocyte development (12). Despite previous studies suggesting a role for IκBNS in negative selection (6), Nfkbid-/- mice displayed normal T cell development and selection (6;12), as found in bumble mice.  T cell and thymocyte proliferation in response to anti-CD3ε or anti-CD3ε plus anti-CD28, or to cognate or allogeneic antigens was reduced relative to that of wild type mice (12). Moreover, production of IL-2 and interferon (IFN)-γ by lymph node T cells in response to TCR activation was reduced.  These findings, in contrast to those from macrophages (62), suggest that IκBNS positively regulates NF-κB-dependent gene transcription in thymocytes. 

 

Further studies by Touma et al. found that Nfkbid knockout mice displayed impaired B cell development and antibody responses, similar to bumble mice (63).  In particular, follicular B cell frequencies in the spleen, lymph node, and blood were reduced, as were splenic MZ and peritoneal B1 B cell frequencies. By 10 months of age the knockout mice had almost normal frequencies of MZ B cells, indicating a developmental delay of these cells.  Serum levels of IgM and IgG3 were greatly reduced in Nfkbid-/- mice, possibly due to the existence of fewer antibody-secreting plasma cells in these animals. Induction of the transcription factors Blimp-1, Xbp1, and Irf4, which are required for the differentiation of plasma cells, was impaired upon LPS stimulation of cultured IκBNS knockout B cells. LPS- or anti-CD40-induced B cell proliferation was also reduced. IκBNS knockout mice failed to mount T-independent antibody responses to TNP-Ficoll, and T-dependent responses to TNP-keyhole limpet hemocyanin. Whereas bumble mice phenocopied Nfkbid-/- mice in all the previous assays, they differed from the null mice in their ability to form GCs following immunization with NP-CGG. The knockout animals failed to form GCs following immunization with sheep red blood cells (63).  The reason for this difference in phenotype is not known.

 

In terms of TLR responses in macrophages, IκBNS behaves similarly to Bcl3 and appears to oppose the function of IκBζ. Where Bcl3 is specifically recruited to the Tnfa promoter together with p50 to inhibit LPS-induced TNF-α production (18), IκBNS is recruited to the Il6 promoter along with p50 and suppresses IL-6 production in response to LPS in contrast to IκBζ, which promotes IL-6 induction (13;16). This observation was extended to other secondary response genes downstream of TLR signaling such as IL-12p40 and IL-18 (62). IκBNS-deficient cells show sustained NF-κB DNA binding activity and prolonged recruitment of NF-κB to the promoters of LPS secondary response genes (13;62). Thus, IκBNS appears to play an important role in limiting the strength of the inflammatory response, and IκBNS-deficient animals show increased susceptibility  to LPS-induced septic shock and chemically-induced intestinal inflammation (62). The enhanced susceptibility of these mice to dextran sulfate sodium (DSS)-induced colitis is consistent with IκBNS expression in CLP macrophages of the colon (13). The role of IκBNS as a negative regulator of NF-κB-dependent inflammatory responses is also consistent with IκBNS expression in regulatory DCs, which preferentially produce the anti-inflammatory cytokine IL-10 and suppress LPS-induced production of proinflammatory cytokines in macrophages and mice. Regulatory DCs also express Bcl3 (14).

 

In humans, the only mutations in IκB-encoding genes have been discovered in NFKBIA encoding IκBα. Rather than impairing IκBα function, these mutations affect the ability of the protein to undergo degradation resulting in a constant repression of NF-κB activity. Accordingly, patients with these mutations display autosomal dominant anhidrotic ectodermal dysplasia (EDA or HED) and T-cell immunodeficiency (OMIM #612132), with defects in the development of hair follicles, nails, teeth and exocrine glands and immunodeficiency including a defect in T cell proliferation (64-67). These phenotypes are similar to the phenotypes exhibited by patients with mutations in the NF-κB signaling pathway including IKK-γ or NEMO that display anhidrotic ectodermal dysplasia with immunodeficiency (HED-ID; OMIM #300291) (68;69). The HED phenotype is caused by lack of NF-κB activation by the EDA (ectodysplasin) signaling pathway in hair follicles, nails, teeth and exocrine glands. EDA signals through a TNF-related pathway involving the EDA receptor (EDAR; see achtung2) and the adaptor protein EDARADD (EDAR-associated death domain; see achtung and gizmo). Mutations in all of these factors cause HED without immunodeficiency in humans (OMIM #129490, #224900, #305100) (70). In addition to these genetic immunodeficiencies, somatic cell mutations or rearrangements in genes encoding NF-κB signaling molecules are often reported and are primarily found in lymphomas. Such genes include REL, NFKB2, IKBA, IKBE and BCL3. Typically these mutations result in inappropriate NF-κB activation [reviewed in (71)].

Putative Mechanism
Figure 12.  Zeb1 (see cellophane), but not Nfkbid, is required for B-cell proliferation after B-cell receptor cross-linking.  Induction of (A) Nfkbid and (B) Zeb1 measured by real-time PCR in WT splenic B cells stimulated for up to 24 h with the indicated stimuli.  Each point represents the mean for triplicate samples.  (C) Histograms showing carboxyfluorescein succinimidyl ester dilution peaks from mock-treated WT B cells and WT or mutant B cells stimulated with the indicated concnetrations of F(ab')αIgM, CpG, or LPS for 72 h.  Results are representative of triplicate cultures.  (D) Percentage of B cells that divided at least one time based on carboxy-fluorescein succinimidyl ester dilution.  Bars (+ range) indicate the mean of triplicate cultures.  Reproduced from (1).
Figure 13.  Fas deficiency fails to rescue humoral defects in bumble mice.  Serum NP-specific IgM (A) and βGal-specific IgG (B) responses measured by ELISA in Nfkbid+/+ or Nfkbidbmb/bmb littermates with at least one WT Fas allele (circles) or homozygous for the Lpr mutation in Fas (triangles) immunized 5 or 14 d before with NP-Ficoll and rSFV-βGal, respectively.  Each point represents data from one mouse, and the bar indicates the mean of all values.  Reproduced from (1).

Our study of bumble mice supports the conclusion that IκBNS is required for the extrafollicular ASC response to T-dependent and T-independent antigenic challenge, but not for germinal center formation or memory B cell development and function.  Nfkbid is rapidly induced at the transcriptional level in wild type B cells stimulated through the BCR in vitro (Figure 12A). This upregulation is dependent on intact BCR signaling and NF-κB. Importantly, Nfkbid is not induced at the RNA or protein levels in stimulated bumble B cells. Bumble B cells in vitro proliferate as well as wild type B cells in response to BCR crosslinking by αIgM, but not in response to CpG oligonucleotides or LPS (Figure 12C and D); the latter observation is consistent with the reduction in bumble MZ and peritoneal B1 B cell frequencies.  Although an increased rate of apoptosis of cultured bumble B cells was observed, homozygosity for the Faslpr mutation failed to rescue antibody responses of bumble homozygotes (Figure 13).  Together, these data suggest that IκBNS is unnecessary for the proliferation or survival of extrafollicular ASCs, but rather required for the differentiation of B cells along the extrafollicular ASC pathway versus the germinal center pathway. We hypothesize that the mechanism by which IκBNS controls extrafollicular ASC differentiation involves the transcriptional regulation of select NF-κB-dependent genes. These genes remain to be discovered.

 

Primers Primers cannot be located by automatic search.
Genotyping
Bumble genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 
 
Primers
Bumble(F): 5’- TCATTTGGCACACATGAGGTCCC -3’
Bumble(R): 5’- GCTCAGCAGGTCTTCCACAATCAG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for sequencing
Bumble_seq(F): 5'- AGGACTCTCTGGATACCCG -3'
Bumble_seq(R): 5’- AGCGGCGTCTGTAAGTCAC -3’
 
The following sequence of 658 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 7, bases 31,210,130 to 31,210,787) is amplified:
 
tcatttggca cacatgaggt cccggtctca cccatttgac catgggctgt gtgttctgtg
tgatgagaat tctcagttga ctgacttgcc ccacccactt tatcccccca ggactctctg
gatacccggc tgtatcctga gccttccctg tcacaggtag ggtcctggag agtctctagt
ctcccctcag gatccccaca gttgccttca cccaccggac cgtccctgga gacagcccga
gctcacatat tggctctggg gccccaacaa ctgctggccc aggatgagga aggagacacg
tgagtatagg gggaaagggt gatgtggacc cctggcttgc ctgcaggtga gggctgttct
cattgctgct ccaccccccg cccctcccca ggctcctgca cctgtttgct gcccgggggc
tgcgctgggc agcatatgct gcggccgagg tgttacagat gtaccgacag ctggatattc
gtgaacataa aggcaaggta agggccacgt gtcaggactt ctgcggccgg ggaagagggc
tcctgatgtc agaggggagg gctctgggag tccaggctga cttttttgtg acttacagac
gccgctcctg gtggcagctg ctgccaacca gccactgatt gtggaagacc tgctgagc
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
References
  35. Kawai, T., and Akira, S. (2007) TLR Signaling. Semin. Immunol.. 19, 24-32.
Science Writers Nora G. Smart, Anne Murray
Illustrators Diantha La Vine
AuthorsCarrie N. Arnold and Elaine Pirie
List |< first << previous [record 46 of 511] next >> last >|