Phenotypic Mutation 'Nd5' (pdf version)
AlleleNd5
Mutation Type missense
Chromosome11
Coordinate59,565,879 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Nlrp3
Gene Name NLR family, pyrin domain containing 3
Synonym(s) Cias1, cryopyrin, Pypaf1, NALP3, Mmig1
Chromosomal Location 59,541,568-59,566,955 bp (+)
MGI Phenotype Strain: 3686871
Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning.
Accession Number

NCBI RefSeq: NM_145827; MGI: 2653833

Mapped Yes 
Amino Acid Change Tryptophan changed to Arginine
Institutional SourceBeutler Lab
Ref Sequences
W956R in Ensembl: ENSMUSP00000098707 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:PAAD_DAPIN 4 87 8.6e-24 PFAM
Pfam:NACHT 216 385 1.3e-46 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.29)
(Using Ensembl: ENSMUSP00000098707)
Phenotypic Category immune system, NALP3 inflammasome signaling defect
Penetrance  
Alleles Listed at MGI

All alleles(10) : Targeted, knock-out(3) Targeted, other(4) Chemically induced(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59565943 missense probably damaging 1.00
IGL00573:Nlrp3 APN 11 59565116 missense probably benign 0.20
IGL01025:Nlrp3 APN 11 59551887 missense probably benign 0.06
IGL01637:Nlrp3 APN 11 59549378 missense probably damaging 1.00
IGL02010:Nlrp3 APN 11 59549535 missense probably benign 0.00
IGL02116:Nlrp3 APN 11 59549184 missense probably damaging 1.00
IGL02334:Nlrp3 APN 11 59565083 missense probably benign 0.00
IGL02417:Nlrp3 APN 11 59566023 splice site 0.00
IGL02578:Nlrp3 APN 11 59548401 missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59565976 missense probably damaging 1.00
IGL02816:Nlrp3 APN 11 59555782 missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59549546 missense possibly damaging 0.65
IGL03334:Nlrp3 APN 11 59549016 missense probably damaging 1.00
Nd1 UTSW 11 59565974 missense probably benign 0.33
Nd14 UTSW 11 59555875 missense
Nd3 UTSW 11 59565974 missense probably benign 0.33
Nd6 UTSW 11 59549354 missense possibly damaging 0.59
Nd7 UTSW 11 59555875 missense probably damaging 0.99
Nd9 UTSW 11 59549354 missense possibly damaging 0.59
Park2 UTSW 11 59565128 nonsense probably null
Park3 UTSW 11 59565850 missense probably benign 0.02
Park4 UTSW 11 59549531 missense probably benign 0.19
Park5 UTSW 11 59548476 missense probably damaging 0.99
Park6 UTSW 11 59549036 missense probably damaging 1.00
Park7 UTSW 11 59548010 nonsense probably null
Park8 UTSW 11 59566199 missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59558448 missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59565128 nonsense probably null
R0362:Nlrp3 UTSW 11 59548797 missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59555924 splice donor site probably benign
R0649:Nlrp3 UTSW 11 59548542 missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59548256 missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59565850 missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59555768 missense possibly damaging 0.86
R1622:Nlrp3 UTSW 11 59548476 missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59543123 missense probably benign 0.01
R1715:Nlrp3 UTSW 11 59543351 missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59558402 missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59548916 missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59549036 missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59549136 missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59549661 missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59548010 nonsense probably null
R4540:Nlrp3 UTSW 11 59551899 missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59549222 missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59548301 missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59549238 missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59566199 missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59548728 missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59565084 missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59549063 missense probably damaging 1.00
R5869:Nlrp3 UTSW 11 59548134 missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59546852 missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59546791 missense probably benign
R5979:Nlrp3 UTSW 11 59548971 missense probably benign 0.06
Z1088:Nlrp3 UTSW 11 59551860 missense possibly damaging 0.67
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm, gDNA
Repository

none

Last Updated 03/02/2017 12:12 PM by Katherine Timer
Record Created 02/26/2010 6:08 PM by Hua Huang
Record Posted 10/15/2010
Phenotypic Description
Figure 1.
The ND5 phenotype was initially identified among G3 mice homozygous for mutations induced by N-ethyl-N-nitrosourea (ENU) and tested in the NALP3 Inflammasome Screen.  Peritoneal macrophages isolated from ND5 homozygous mice (G4857 and G4858) secreted reduced amounts of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 1).  ND5 mice produced normal levels of tumor necrosis factor (TNF)-α in response to LPS stimulation alone, suggesting that signaling from the Toll-like receptor 4 (TLR4), which senses LPS, was unimpaired. 

 

 

 

 

 

 

Nature of Mutation

Figure 2. Domain structure of NLRP3. Shown are the pyrin domain (PYD), NACHT domain, NACHT associated domain (NAD), and leucine-rich repeat (LRR) domain. Together, the NACHT and NAD domains are known as the nucleotide-binding domain (NBD). The amino acid altered by the ND1 mutation is shown. Click on the image to view other mutations found in NLRP3. Click on each mututation for more specific information.

The Nlrp3 gene was directly sequenced as a candidate gene and a T to C transition was found at position 3092 of the Nlrp3 transcript in exon 9 of 10 total exons using Genbank record NM_145827. The mutation is located in the eighth coding exon. 

 

3077 ACCTCACACAGCTGCTGGAATCTCTCCACAATT

951  -T--S--H--S--C--W--N--L--S--T--I- 


 
The mutated nucleotide is indicated in red lettering, and causes a tryptophan to arginine substitution at residue 956 of the NLRP3 protein.
Protein Prediction
The ND5 mutation results in a tryptophan to arginine change in coding exon 8. Depending on the prediction program used, this residue occurs in the third or second to last leucine rich repeat (LRR). It is likely that this mutation affects the structure and function of the LRR domain, perhaps interfering with binding to factors that stimulate the inflammasome.
 
  Please see the record for ND1 for more information about Nlrp3.
Primers Primers cannot be located by automatic search.
Genotyping
ND5 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The ND1 primers are used for genotyping.
 
Primers
ND1(F): 5’- ACAGCTTAAAGGCTAAGCCCCTGC -3’
ND1(R): 5’- TTCCACGCCTACCAGGAAATCTCG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for sequencing
ND1 _seq(F): 5'- GGTTGGCTTCGAACTCAGAAATC -3'
ND1 _seq(R): 5’- CTAAGGCACGTTTTGTTTCACG -3’
 
The following sequence of 921 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 11, bases 59,378,853 to 59,379,774) is amplified:
 
                                                                               acagc ttaaaggcta
agcccctgcc accacagtcc tgccaactgc aaacattcat ttggtccatt gatactttgt
ggaaatctga ggggaacata atgtttagaa aaagtcaatt gacaaatttc tgttactatt
ttggtctgtt caacccagta ccttgggaaa agaaacttcc atctaaagag gggagaaaag
aaaccatatc atatgaagca gcttcacgct ggtcagtctg tggtttgttg ttgttgttgt
tttcaagaca gggtttatct gtgtagccct ggcttgcctg gaactcactc tgtagaccag
gttggcttcg aactcagaaa tccgcctgct tctgcctccc aagtgctggg attaaaggtg
tgcaccacca ctgcccagcc caatctgcgc tttttatgca aatgaaactg caggtttgga
gacccggaag tatggatggt caaggctatt ttctttatat cacccttctc ttctcaaaga
ttagacaact gcagcctcac ctcacacagc tgctggaatc tctccacaat tctgacccac
aaccacagcc ttcggaagct gaacctgggc aacaatgatc ttggcgatct gtgcgtggtg
accctctgtg aggtgctgaa acagcagggc tgcctcctgc agagcctaca gtgagtgtgg
tttgcctaga gcttctcatg gggtaggcga gcggggtgct gaggggaggg tgaccacggg
acaaaagtca gagtttctct ggattaattt gcagttttct gaagagtcca actcaaagct
tcttttctgt gttcacaggt tgggtgaaat gtacttaaat cgtgaaacaa aacgtgcctt
agaagcgctc caggaagaaa agcctgagct gactatagtc ttcgagattt cctggtaggc
gtggaa
       
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
Science Writers Nora G. Smart
Illustrators Katherine Timer
AuthorsHua Huang, Bruce Beutler
Edit History
07/20/2011 12:26 PM (current)
05/25/2011 10:48 AM
05/24/2011 11:10 AM
05/24/2011 11:06 AM
04/24/2011 11:59 AM
02/15/2011 5:45 PM
11/08/2010 11:25 AM
10/19/2010 11:35 AM
10/19/2010 11:26 AM
10/15/2010 8:09 AM
07/01/2010 3:25 PM
07/01/2010 3:23 PM
07/01/2010 3:21 PM
07/01/2010 1:47 PM