Allele | spelling | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | X | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 59,335,396 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ T (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Atp11c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | ATPase, class VI, type 11C | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | A330005H02Rik, Ig | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 59,268,643-59,450,041 bp (-) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype | PHENOTYPE: Mice homozygous or hemizygous for an ENU mutation exhibit decreased B cells associated with arrested adult B cell lymphopoiesis. [provided by MGI curators] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_001001798; MGI: 1859661 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Isoleucine changed to Lysine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q9QZW0 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000033480 Gene: ENSMUSG00000062949 AA Change: I355K
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000099066 Gene: ENSMUSG00000062949 AA Change: I355K
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000119320 Gene: ENSMUSG00000062949 AA Change: I355K
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.213) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | X-linked Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | X-linked Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Live Mice, Sperm, gDNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 034371-JAX | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2016-05-13 3:09 PM by Stephen Lyon | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2010-03-01 3:39 PM by Carrie N. Arnold | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2011-04-29 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The spelling mutation was discovered during flow cytometry analysis of blood from ENU-mutagenized G3 mice (1). The index mouse and four additional G3 relatives had severely reduced frequencies of peripheral blood B cells and elevated frequencies of CD4+ and CD8+ T cells. The monocyte population was also significantly expanded in the blood of affected mice. Despite the low B cell frequency in the index mouse, it made normal T-independent and T-dependent IgM and IgG responses, respectively (T-dependent Humoral Response Screen and T-independent B Cell Response Screen) (Figure 1).This phenotype resembles that of emptyhive mice, which has a mutation in the Atp11c gene (2). Compound heterozygosity for both alleles caused a B cell deficiency as severe as either parental strain (Figure 2), indicating that both emptyhive and spelling phenotypes are caused by X-linked recessive loss of function alleles of Atp11c. Spelling is also allelic to ambrosius and 18NIH30a (3).
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
The Atp11c gene was directly sequenced in genomic DNA from the index spelling mouse and a T to A transversion was detected at position 1214 of the Atp11c transcript, in exon 12 of 30 total exons.
1198 CTTTTCAACTTCATTATACCTGTCTCCATGTAT
350 -L--F--N--F--I--I--P--V--S--M--Y-
The mutated nucleotide is indicated in red lettering, and converts an isoleucine to lysine at amino acid 355 of the ATP11C protein.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
Please see the record for emptyhive for information about Atp11c.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization |
The amino acid altered in spelling mutants occurs in the fourth transmembrane domain of the aminophospholipid transporter ATP11C. The fourth transmembrane domain contains hydrophobic amino acids likely to be necessary for lipid interaction and transport. The I355K change is adjacent to the invariant proline, which is a key structural feature of P-type ATPases and results in unwinding of the transmembrane helical structure. It is likely that alteration of the adjacent isoleucine to a charged lysine critically alters the structure of this region, resulting in loss of protein function.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | The amino acid altered in spelling mutants occurs in the fourth transmembrane domain of the aminophospholipid transporter ATP11C. The fourth transmembrane domain contains hydrophobic amino acids likely to be necessary for lipid interaction and transport. The I355K change is adjacent to the invariant proline, which is a key structural feature of P-type ATPases and results in unwinding of the transmembrane helical structure. It is likely that alteration of the adjacent isoleucine to a charged lysine critically alters the structure of this region, resulting in loss of protein function. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Spelling genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
Primers
Spell(F): 5’- GGCAAAGTTCCCCATACAATGATGAACC -3’
Spell(R): 5’- GTTCAATGTCATAAGAAATGCACCCCAG -3’
PCR program
1) 95°C 2:00
2) 95°C 0:30
3) 56°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 29X
6) 72°C 7:00
7) 4°C 8
Primers for sequencing
Spell _seq(F): 5'- TGTGATTAGACTAGCCTTCACTG -3'
Spell _seq(R): 5’- CACCTGACCAAGTTCTTCATTAAGG -3’
The following sequence of 1166 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome X, bases 57,543,817 to 57,542,652) is amplified:
ggcaaagttc cccatacaat gatgaaccat ggtataacca aaagactcaa aaggaacggg
aaacttttca ggtaattgct ttgctgtgag aagaattact ctttgtgatt agactagcct
tcactgaaac actactcaga aaaatgagac cttttgattt agatttgttt ttattttata
tatctctatg tttttttgat tctttcatta agagatttga aaagtaatga gctttctggc
attttaattc aatatgaact tgtattccta tctatatatg aattttgaat gtttccatct
atggatagga ggaatttagg acttaatgag gtgaaaaagt attaaagtag aaagctgaaa
aatatagata aaattcatag tgttctaaaa tgttgttaat actaatactt ttgaatataa
tgatatagtg tcattaggaa gtttctttat attaatagtg tgttaagcat taaaacaaaa
gaaagccatt ttatatttta ttcatctaag gctgtgaatc taattaacat gaaccatctc
ttattttagg ttttgaaaat gttcactgac tttttatcat tcatggttct tttcaacttc
attatacctg tctccatgta tgtcacagta gaaatgcaga aatttttagg gtcattcttt
atttcatggg ataaagactt ttttgatgaa gaaattaatg aaggagcctt ggttaataca
tcagacctta atgaagaact tggtcaggtg agaacacagt ttttgcttta attaaactac
tatagtaaaa acattttctg gtctggaata ccaatataag taaccatttc ttttattgac
atataattca aaggaatatc tttagtgtag acaaataatt aaaggtttgc aatattttca
caactgccac ttcagttatt gtttactagt atttttacaa aggataaaat gtatgcattt
aatataaata ttacagaaat ctatataaaa gttcaccaaa cgatactgtc agataaaaac
atgaaatgtg gttttcctta cttcctataa tcaattctga atagaatgaa gtataataaa
atattgctat tttacacatg catgtttgtt aaccatagtt atcctatatt gatattttct
ggggtgcatt tcttatgaca ttgaac
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Nora G. Smart | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Carrie N. Arnold, Elaine Pirie, and Bruce Beutler |