Phenotypic Mutation 'Worker' (pdf version)
AlleleWorker
Mutation Type critical splice donor site (2 bp from exon)
Chromosome7
Coordinate45,431,318 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Ruvbl2
Gene Name RuvB-like protein 2
Synonym(s) p47, mp47
Chromosomal Location 45,421,852-45,438,096 bp (-)
MGI Phenotype Mice homozygous for an ENU-induced allele exhibit lethality. Mice heterozygous for a knock-out allele exhibit impaired T cell development and maximal T dependent antibody responses.
Accession Number

NCBI RefSeq: NM_011304; MGI: 1342299

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000033087 (fasta)
Ensembl: ENSMUSP00000103400 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
AAA 69 361 5.17e-10 SMART
Phenotypic Category decrease in CD4+ T cells, T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance <100% 
Alleles Listed at MGI

All alleles(14) : Targeted(3) Gene trapped(11)          

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Ruvbl2 APN 7 45425172 missense probably benign 0.00
IGL00970:Ruvbl2 APN 7 45429570 missense probably benign 0.37
IGL01084:Ruvbl2 APN 7 45422523 splice acceptor site probably null 0.00
IGL01382:Ruvbl2 APN 7 45422737 missense probably benign 0.00
IGL01798:Ruvbl2 APN 7 45422163 missense probably damaging 1.00
IGL01936:Ruvbl2 APN 7 45428698 missense probably damaging 1.00
IGL02282:Ruvbl2 APN 7 45425165 missense probably benign 0.00
R0469:Ruvbl2 UTSW 7 45431306 splice donor site probably benign
R0510:Ruvbl2 UTSW 7 45431306 splice donor site probably benign
R0570:Ruvbl2 UTSW 7 45422197 missense probably damaging 1.00
R1533:Ruvbl2 UTSW 7 45424142 missense probably damaging 1.00
R1591:Ruvbl2 UTSW 7 45424711 missense possibly damaging 0.57
R1679:Ruvbl2 UTSW 7 45424967 missense probably damaging 1.00
R1758:Ruvbl2 UTSW 7 45425162 missense probably benign 0.39
R2113:Ruvbl2 UTSW 7 45424103 missense probably benign 0.40
R3017:Ruvbl2 UTSW 7 45422164 missense probably damaging 0.99
R3806:Ruvbl2 UTSW 7 45422190 missense possibly damaging 0.65
R4940:Ruvbl2 UTSW 7 45424726 missense possibly damaging 0.95
R6045:Ruvbl2 UTSW 7 45425009 missense probably damaging 1.00
Mode of Inheritance Autosomal Dominant
Local Stock Live Mice, Sperm
MMRRC Submission 036724-UNC
Last Updated 05/13/2016 3:09 PM by Stephen Lyon
Record Created 03/09/2010 2:11 PM by Carrie N. Arnold
Record Posted 07/31/2012
Other Mutations in This Stock Stock #: G4846 Run Code: SLD00228
Coding Region Coverage: 1x: 77.7% 3x: 53.3%
Validation Efficiency: 104/115

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
2700049A03Rik A to G 12: 71,137,909 I24V probably benign Het
Col4a2 T to C 8: 11,408,872 probably benign Homo
Cyp3a13 C to T 5: 137,898,823 E410K possibly damaging Het
Gm20518 A to T 16: 17,836,645 probably benign Homo
Nbea T to A 3: 56,087,497 D166V probably damaging Het
Olfr221 T to A 14: 52,035,977 M45L probably benign Het
Olfr794 A to T 10: 129,571,170 I172F probably damaging Het
Plxna4 T to A 6: 32,192,272 D1330V probably damaging Het
Ppl A to G 16: 5,087,206 S1742P probably benign Homo
Samd4 T to A 14: 47,016,319 I80N probably damaging Het
Spinkl T to A 18: 44,169,106 probably benign Het
Ttll5 T to A 12: 86,024,244 I1297N probably damaging Het
Phenotypic Description
Figure 1.  Serum NP-specific IgM (E) and βGal-specific IgG (F) measured by ELISA in WT and G3 mice immunized 5 or 14 d before with NP-Ficoll and rSFV-βGal.  The Worker index mice are indicated in green.  Reproduced from (1)
Figure 2.  Lymphocyte development is impaired in Worker mice.  Please see bumble and cellophane for more details about these mutations.  Single-cell suspensions from WT and mutant mice were analyzed by flow cytometry. (A) IgM- B220int pro- or pre-B cells, IgM+ B220int immature B cells, and IgM+ B220high mature B cells as a percent of bone marrow lymphocytes. (B) B220+ B cells as a percent of splenocytes and IgDlow IgMhigh B200+ immature, IgDhigh IgMint B220+ mature follicular, and CD21/35high CD23low B220+ MZ B cells as a percent of splenic B220+ B cells. (C) Mean fluorescence intensity of CD44 on CD4+ and CD8+ T cells and IgM on B220+ B cells in spleen.  (D) CD19int B220high B2 and CD19high B220low/int B1 B cells as a percent of peritoneal cavity lymphocytes. (E) CD5high CD43high CD19high B220low/int B1a and CD5low CD43low CD19high B220low/int B1b B cells as a percent of peritoneal cavity B1 B cells.  (F) CD4- CD- DN, CD4+ CD8+ DP, and CD4or CD8+ SP cells as a percent of thymocytes.  (G) CD69- and CD69+ TCRβ+ CD4or CD8+ cells as a percent of CD4+ or CD8+ thymocytes, respectively. (H) CD4+ and CD8+ T cells and NK1.1+ cells as a percent of splenocytes.  Bars indicate the mean (+ range) of three to seven mice per genotype analyzed, except for A, in which the mean (+ range) is shown for two WT mice.  Reproduced from (1).
Figure 3. The primary T-dependent antibody response is impaired in Worker mice. Please see bumble and cellophane for more details about these mutations.   WT and mutant mice were immunized with alum-precipitated NP-CGG.  Serum levels of NP-specific IgM (A)  and total NP-specific IgG1 (B) were measured by ELISA.  Each point represents the mean (+ range) of greater than or equal to three mice per genotype.  Reproduced from (1).

Figure 4.  The Worker mice display white belly spotting and white paws.

The index Worker mouse was identified among the ENU-mutagenized G3 population.   It displayed suboptimal T-dependent IgG responses to recombinant Semliki Forest Virus (rSFV)-encoded β-galactosidase in the T-dependent humoral response screen (Figure 1, right), and normal T-independent IgM responses to NP-Ficoll (T-independent B cell response screen) (Figure 1, left(1).


B-cell development in Worker mice is normal (Figure 2A and B(1)Worker mice had significant changes in thymic cell subsets (i.e. DN thymocyte frequency was increased; DP thymocyte frequency was decreased) (Figure 2F).  The Worker mice had reduced frequencies of splenic CD4+ and CD8+ T cells (Figure 2H) and they expressed high levels of surface CD44 (Figure 2C(1).  

 

When Worker mice were injected with NP-CGG, seven days post-immunization the mice were found to have undetectable levels of NP-specific IgM (Figure 3A) and low levels of NP-specific IgG1 (Figure 3B(1), consistent with an impaired extrafollicular response in these mice.  At day 14 post-immunization, the Worker IgG1 and IgM responses were normal; at 28 days post-immunization, most of the NP-specific IgG1 was high affinity (Figure 3C), indicating that affinity maturation occurs in Worker mice (1).  Memory B cell function was normal in Worker mice.

 

The humoral response and T cell deficiencies of Worker mice were dominant but incompletely penetrant (one third of heterozygotes displayed these phenotypes), and fully concordant with white belly spotting.  Expressivity of the pigmentation phenotype varies, ranging from a few white hairs to large patches covering the abdomen (Figure 4). Homozygosity for the Worker mutation causes lethality at an undetermined prenatal stage.

Nature of Mutation

The dominant Worker mutation was mapped by bulk segregation analysis (BSA) of F1 offspring (n=9 with mutant phenotype, 63 with normal phenotype) of Worker males crossed to C57BL/10J females.  Strongest linkage was observed with the marker at position 71519895 bp on chromosome 7 (synthetic LOD=10.7), within a critical region of 54410823 - 87465557 bp.  However, separate sample genotyping revealed that the T-dependent IgG response phenotype is not fully penetrant, and defined the critical region as 38216957-71519895 bp, with strongest linkage to the marker at 54410823 bp (LOD=5.02).  Whole genome SOLiD sequencing of a Worker mutant identified a T to A transversion at position 3147 of the genomic sequence of Ruvbl2 (NC_000073), affecting the second nucleotide of intron 2.  Ruvbl2 contains 15 exons (ENSMUST00000107771).

 

The Worker mutation causes skipping of exon 2, resulting in a frameshift upon splicing of exon 1 to exon 3, as shown below.  A premature stop codon following 27 aberrant amino acids encoded by exon 3 and part of exon 4 is expected to cause nonsense-mediated decay of the transcript.  However, the incomplete penetrance of the Worker phenotype among heterozygous mice suggests that in some animals at least some normal splicing may occur; thymic cDNA sequencing confirmed this hypothesis.

 

       <--exon 1         exon 2        intron 2--> exon 3-->
202 ATGGCAACCGTG GCAGCCACC……GAGCGAATCG GTGAGTGAGCA GCGCTCACTCCCACATCCGGGGGCTGGGACTGGATG..GGCAGCTAG
1   -M--A--T--V- -A--A--T-……-E--R--I--             -A--L--T--P--T--S--G--G--W--D--W--M-..-G--S--*-
      correct     deleted                             aberrant

 

The mutated nucleotide is indicated in red lettering; the splice donor site is in blue.  Nucleotide numbering corresponds to the genomic NCBI reference sequence (NC_000073).

Protein Prediction

Ruvbl1 and Ruvbl2 are paralogous ATPases of the AAA+ (ATPases associated with diverse cellular activities) superfamily, the members of which are structurally similar but functionally diverse.  All AAA+ proteins contain a structurally conserved ATP-binding module that hetero- or homo-oligomerizes into active complexes, most commonly hexamers (2).  AAA+ proteins switch between at least two distinct nucleotide-mediated conformational states, transducing these conformational changes to target molecules.  Intersubunit interactions within oligomers, for example through a characteristic ‘arginine-finger’ (3;4), enable conformational changes to be propagated from one active site to the next.  Thus, depending on the kinetics of nucleotide binding and release, AAA+ oligomers can function as bimodal switches or processive motors.

 

Ruvbl1 was identified in rat liver nuclear extracts in a complex containing TATA-binding protein (TBP) (5) and shown to possess ATPase activity that was stimulated by single-stranded DNA, but not RNA or double-stranded DNA (6).  Ruvbl2 was discovered as a Ruvbl1-related protein (42% identical) by sequence analysis of the Saccharomyces cerevisiae genome (7;8), and was subsequently cloned from a human liver cDNA library (9).  Ruvbl2 also displayed single-stranded DNA-stimulated ATPase activity.  Ruvbl1 and Ruvbl2 share sequence similarity with the bacterial protein RuvB, a helicase with 5’ to 3’ DNA unwinding activity required for DNA repair and recombination.  Together with bacterial RuvA, RuvB binds to the four-stranded DNA crossover intermediate known as the Holliday junction and promotes branch migration in an ATP-dependent manner (10;11).  Both Ruvbl1 and Ruvbl2 display ATP-dependent DNA helicase activity in vitro (9).  The directionality of Ruvbl2 helicase activity has been reported to be 3’ to 5’ (9).  For Ruvbl1, both 5’ to 3’ (9) and 3’ to 5’ (6) helicase activities have been reported; other groups failed to detect helicase activity at all (8;12;13).

 

Figure 5. Domain structure of Ruvbl2. The Worker mutation is an T to A transversion of the second nucleotide of intron 2. Skipping of exon 2 is predicted to cause a frameshift resulting in a premature stop codon that triggers nonsense mediated decay. WA, Walker A domain; WB, Walker B domain.

Figure 6. Crystal structure of the human AAA+ protein RUVBL1.  β-strands are represented by flat arrows and α-helices by coils. UCSF Chimera model is based on PDB 2C9O. Click on the 3D structure to view it rotate.

Ruvbl2 shares the same domain organization (Figure 5) and presumably the same overall 3D structure as Ruvbl1.  The X-ray crystal structure of monomeric ADP-bound human Ruvbl1 revealed the canonical AAA+ domain fold consisting of a nucleotide-binding core domain made from a five-stranded β sheet sandwiched between two α helices (αβα domain), and a bundle of four α helices that caps the nucleotide-binding pocket (Figure 6, PDB ID 2C90) (12).  The αβα nucleotide-binding domain contains a Walker A motif (GXXXXGK[T/S]) important for binding and orienting ATP, a Walker B motif (hhhhDEX[H/N], h=hydrophobic) required for ATP hydrolysis, and sensor-I and sensor-II elements that discriminate between di- and triphosphate nucleotides.  The αβα domain is interrupted by an ‘insertion domain’ of 170 amino acids between the Walker A and Walker B motifs; such an insertion is not found in RuvB or in most other AAA+ proteins (Figure 5) (8;9;12).  The insertion domain resembles the DNA-binding domain of replication protein A (RPA; required for DNA recombination, repair and replication), and by itself can bind to ssDNA, dsDNA, and ssRNA (12)

 

In the crystal structure, Ruvbl1 assembles into a hexameric structure with a central channel (12).  The central channel has a diameter of 18 Å, which is sufficient for ssDNA but not dsDNA to pass through.  Negative electrostatic potential of the channel also favors interaction with ssDNA over dsDNA.  The authors proposed that one strand of a forked DNA substrate is threaded through the channel, while the second strand binds to the outside of the ring through an interaction with the insertion domain.  Nucleotide binding occurs at the interface between subunits, but hexamerization results in inaccessibility of the nucleotide-binding pocket and inability to exchange ATP for ADP.  No ATPase activity, and consequently no helicase activity, was observed for this structure.  It was proposed that a conformational change is required for successful completion of nucleotide hydrolysis and release.  Arginine 357 serves as the ‘arginine-finger’ described above, forming part of the nucleotide binding pocket of the adjacent subunit, and suggesting that intersubunit cooperativity contributes to Ruvbl1 function.

 

Ruvbl1 and Ruvbl2 interact as purified proteins and in yeast two-hybrid experiments, and co-immunoprecipitate in a large complex from HeLa nuclear extracts (9).  Three rather different electron microscopic structures of Ruvbl1 and Ruvbl2 heterohexamers have been reported [(14-16); discussed in (17)], highlighting the fact that the in vivo oligomeric state of these proteins remains unknown.  The human Ruvbl1-Ruvbl2 complex is an asymmetric double hexameric ring with a central channel 26 Å in diameter, large enough to accommodate dsDNA (16).  Similarly, the yeast Ruvbl1-Ruvbl2 complex examined by cryo-electron microscopy (EM) is organized into an asymmetric double hexameric ring with a 25 Å diameter (14).  In this structure, electron density was observed sandwiched between the top and bottom rings and was proposed to derive from intercalating insertion domains at the equator of the structure.  Contrasting with these structures is the yeast Ruvbl1-Ruvbl2 complex visualized by negative-staining scanning transmission EM, which forms a single hexameric ring that changes conformation upon binding to ATP or ADP (15).  In none of these three structures were the identities of individual subunits discernable.  Thus, whether the single rings were homomeric or heteromeric, and whether the double hexamers were formed from stacks of homomeric or heteromeric rings could not be determined. 

 

The single and double hexameric structures may represent different functional states of Ruvbl1-Ruvbl2 complexes, but it has also been suggested that the double hexameric structure is an artifact induced by histidine tags (18), which were employed in the studies by Puri et al. (16) and Torreira et al. (14).  Another study used size-exclusion chromatography, analytical ultracentrifugation, and mass spectrometry to investigate the different oligomeric forms of human Ruvbl1-Ruvbl2 complexes (19).  Ligand-free Ruvbl1 and Ruvbl2 were shown to be monomeric; Ruvbl2 formed hexamers in the presence of nucleotide.  When co-expressed and purified from E. coli, Ruvbl1-Ruvbl2 complexes comprised monomeric, dimeric, trimeric, hexameric and dodecameric species.  Mass spectrometry of the hexamers demonstrated that the complexes contained Ruvbl1 and Ruvbl2 mixed in various stoichiometries.  Ruvbl1 and Ruvbl2 exist in multiple protein complexes in cells, and their oligomeric states in vivo remain to be determined.

 

Figure 7.  Crystal structure of the biologically active human Ruvbl1/Ruvbl2 complex based on PDB: 2XSZ.  The top figure is a view of the top of the complex; the bottom figure is the side view.  Click on the bottom figure to rotate.  The colors for Ruvbl1 are the same as in Figures 5 & 6.  Ruvbl2 is gray, ATP is orange. See the text for more details.

A recent study crystallized the biologically active human Ruvbl1/Ruvbl2 complex at 3Å resolution [PDB: 2XSZ; (20); Figure 7].  The crystal consists of truncated Ruvbl1 and Ruvbl2 proteins (Ruvbl1 is missing aa 127-233; Ruvbl2 is missing aa 134-237); a linker was inserted to replace the deleted regions. The complex is comprised of two heterohexamers stacked on each other to form a dodecamer.  This study determined that the hexameric ring is composed of alternating Ruvbl1 and Ruvbl2 monomers.  The nucleotide-binding pockets of each heterohexamer are close to the top and bottom faces of the dodecamer at the interface between the AAA+ domain (αβα) and the AAA+ domain (α); the hexameric rings interact through the retained, internal region of the insertion domain. The findings in this study indicated that ATP hydrolysis activity was 3 times higher in the complex relative to the individual wild type Ruvbl1 and Ruvbl2 proteins, consistent with previous studies (13-16).  A complex of the truncated versions of Ruvbl1 and Ruvbl2 used for crystallization displayed even higher ATPase activity.  The truncated proteins individually also displayed 2-fold higher ATPase activity compared to the individual wild type proteins.  In agreement with previous reports that wild type purified Ruvbl1 and Ruvbl2 lacked helicase activity (8;12;13), only the truncated forms of Ruvbl1 and Ruvbl2, either individually or in complex, showed helicase activity toward a dsDNA substrate (20). Gorynia et al. thus propose that the DNA helicase activity of Ruvbl1 and Ruvbl2 can be autoinhibited by the insertion domain and that cofactors within chromatin remodeling complexes may bind to the proteins, causing a conformational change to the insertion domain that permits subsequent helicase activity (20).  Measurements of the central channel of the dodecamer indicate that it is 85 Å long and has an ~19 Å internal diameter at either end, respectively.  The central part of the channel is much wider (~35 Å). Gorynia et al. report that the crystal structure of the Ruvbl1-Ruvbl2 complex differs from the EM studies mentioned above.  For example, the crystal structure is symmetrical as opposed to the findings of Puri et al. (16) and Torreira et al. (14). Second, the crystal structure shows a heterohexameric arrangement of monomers within a dodecamer (as opposed to the isolated hexamers proposed by Gribun et al. (15)).

Expression/Localization
Figure 8. Relative tissue-specific expression of Ruvbl2 in mice.

Western blot analysis revealed that Ruvbl2 was most abundantly expressed in thymus and testis (9), whereas Ruvbl1 was most abundantly expressed in spleen, thymus, lung, and testis (6;21).  Data from the BioGPS database supports strong expression in testis in both mice and humans, and moderate expression in the thymus (~3X the median in humans) and thymocytes (roughly equivalent to the median in mice) (see figure 8).  In mouse follicular B cells, bone marrow macrophages, and whole bone marrow, Ruvbl2 transcript levels are approximately 3X the median level.

 

Ruvbl1 and Ruvbl2 are nuclear proteins that localize to the nucleoplasm (22;23).

Background

The circumstances in which Ruvbl1 and Ruvbl2 were discovered suggested their intimate involvement with DNA and/or with the machinery that regulates DNA.  For example, the findings that they interacted with TBP (5;9) and were components of the RNA polymerase II holoenzyme (8) suggested a role in transcription.  The association of Ruvbl1 with RPA (8), and the homology between bacterial RuvB and both Ruvbl1 and Ruvbl2 led to the hypothesis that the Ruvbl proteins play a role in DNA replication or recombination.  More recent discoveries have demonstrated that Ruvbl1 and Ruvbl2 participate in chromatin remodeling during the processes of transcription, DNA damage repair, and DNA replication; and aid in the assembly and stabilization of ribonucleoprotein complexes.

 

Despite the abundance of in vitro data, the function(s) of Ruvbl1 and Ruvbl2 in whole organisms and the physiological processes requiring them remain largely unknown.  Studies using S. cerevisiae have shown that both Rvb1 and Rvb2 (as they are known in yeast) are essential genes (8;9).  The ATP binding and hydrolysis activity of Rvb1 and Rvb2 are also required for the viability of yeast (24).  Yeast with conditional mutations in either Rvb1 or Rvb2 displayed rapid changes, both upregulation and downregulation, in the transcription of over 5% of the yeast genome upon shift to the non-permissive temperature.  However, whether helicase activity is important in vivo has not been shown.  To date, no mouse model of Ruvbl1 or Ruvbl2 deficiency has been reported.

 

Chromatin remodeling

Figure 9. Nucleosomes consist of eight histones (pink) and 147 bp of DNA.

Nucleosomes consist of a histone octamer (two each of H2A, H2B, H3, and H4) and 147 base pairs of DNA wrapped two times around it (Figure 9).  Chromosomal DNA is packaged into nucleosomes to facilitate its compact packing into the nucleus, but nucleosomes must be disassembled in order to gain access to DNA for transcription, replication, or repair.  The process of nucleosome assembly and disassembly is controlled by several chromatin remodeling complexes that use the energy of ATP to slide nucleosomes along DNA, to remove histones and nucleosomes, or to replace canonical histones with histone variants, which induce distinct chromatin structures that signal particular DNA processing events such as transcription or repair.  Histones are further regulated by histone acetyltransferases (HATs) and deacetylases (HDACs) that promote either relaxation or tightening, respectively, of the association of DNA with the modified histones.

 

Figure 10. Ruvbl1- and Ruvbl2-containing complexes (top) and ribonucleoprotein complexes that require Ruvbl1 and Ruvbl2 for assembly (bottom). Homologous yeast and human proteins are shown with matching colors, while nonconserved proteins are shown in gray.

Ruvbl1 and Ruvbl2 have been identified as members of the mammalian INO80 (named for an inositol-requiring S. cerevisiae strain containing a mutation in Ino80) and SRCAP (Snf2-related CREB-binding protein activator protein) complexes that mediate nucleosome remodeling, and as a member of the Tip60 HAT complex (Figure 10).  These three complexes share at least one subunit, actin regulatory protein 4 (Arp4), which has been shown to bind directly to histones (25-27).  Each complex functions in a mechanistically distinct way to remodel chromatin.

 

INO80 and SWR1 complexes

All known ATP-dependent chromatin remodeling complexes contain a SNF2 family ATPase that is responsible for the nucleosome remodeling activity of the complex.  Ino80 is a member of the SNF2 family of chromatin remodeling proteins, and functions in a complex containing approximately fifteen proteins including Ruvbl1 and Ruvbl2.  The INO80 complex was first identified in yeast (28;29), and a similar human complex containing eight orthologous proteins along with seven human-specific proteins has also been identified (30).  The core subunits common to yeast and humans are Ruvbl1 and Ruvbl2, present in 6:1 stoichiometry relative to other subunits, as well as Ino80, Arp4, Arp5, Arp8, Ies2, and Ies6 proteins.  In yeast, acute inactivation of Ino80 or Rvb2 affected significantly overlapping sets of genes (31).  Based on the finding that INO80 complexes isolated from Rvb2-deficient yeast lacked Arp5 and Rvb proteins, it has been hypothesized that the Rvb proteins are required for the assembly of Arp5p into the complex (31).  Indeed, studies examining other Ruvbl protein-containing complexes suggest that an important function of these AAA+ ATPases is facilitating the assembly of complexes, possibly by acting as scaffolding proteins.

 

The yeast chromatin remodeling complex SWR1 (named for S. cerevisiae strain ‘Sick With Rat8 ts’ that contains a mutation in Swr1, and known as SRCAP in mammals) consists of fourteen subunits (10 in mammals) including the SNF2 family ATPase Swr1, Rvb1, and Rvb2 (32-34).  Between the yeast and human complex six subunits are conserved: Swr1, Rvb1, Rvb2, Arp4, Arp6, and Yaf9 (yeast names given).  Like INO80, the SWR1 complex exhibits nucleosome-stimulated ATPase activity.  In the yeast complex, the Rvb proteins associate with the ATPase domain of Swr1, which is also required for the association of four other subunits.  This finding suggests that Rvb proteins may aid in the assembly of the SWR1 complex.  However, a function for Rvb proteins in the assembled SWR1 complex is unknown.

 

  -Regulation of transcription

Both INO80 and SWR1 complexes help to regulate transcription, but do so using different mechanisms.  The INO80 complex functions to reposition (‘slide’) nucleosomes along the DNA (25;35), and to completely remove nucleosomes from the DNA (36;37).  INO80 complexes lacking Rvb1 and Rvb2 failed to reposition nucleosomes in a 12-nucleosome model substrate (31).  In mammalian cells, the transcription factor YY1, itself an INO80 complex component, is required to recruit the INO80 complex to target promoters (38).  Paradoxically, the INO80 complex is also required for binding of YY1 to target genes.  It was suggested that the INO80 complex moves or removes promoter-associated nucleosomes in order to enable YY1 to gain access to its targets.

 

The SWR1 complex facilitates ATP-dependent replacement of canonical histone H2A with the variant H2AZ in the nucleosome (32-34).  Chromatin containing H2AZ adopts a distinct conformation compared to H2A-containing chromatin, and is typically associated with transcriptionally active chromatin (39;40), although it may also help to establish heterochromatin under specific contexts (41;42).

 

  -DNA damage responses

Eukaryotic cells repair DNA double strand breaks (DSBs) by both non-homologous end joining (NHEJ) and homologous recombination.  Upon sustaining a DSB, DNA ends are recognized and bound by the MRN (Mre11-Rad50-Nbs1) complex (known as the MRX complex in yeast), which promotes the production of single stranded 3’ overhangs in a process called resection.  These single stranded DNA regions recruit the kinases ATM (ataxia telangiectasia mutated) and ATR (ataxia telangiectasia and Rad3 related), which both phosphorylate histone variant H2AX and activate the checkpoint kinases Chk1 and Chk2.  Phosphorylation of H2AX spreads over megabases surrounding the DSB site, and is required for stable accumulation of repair proteins.  In particular, INO80 and SWR1 complexes bind directly to DSBs through association with phospho-H2AX (43;44)

 

Both INO80 and SWR1 complexes are required for processing broken DNA ends, and perform different functions.  INO80 promotes eviction of proximal nucleosomes surrounding DSBs, including nucleosomes containing phospho-H2AX and H2AZ (36;37;45).  Nucleosome eviction facilitates the association of other repair proteins to the DSB, and the invasion of the single stranded DNA into the homologous donor locus.  In contrast, SWR1 is required for recruitment to DSB regions of Mec1 (the yeast ATR-related kinase) and Ku80, proteins required for NHEJ (36;46).  Mutations of the Arp subunits of the yeast INO80 complex lead to defects in both homologous recombination and NHEJ, whereas mutations of Swr1 affect the NHEJ pathway.

 

DNA repair is closely tied to the activation of cell cycle checkpoints that allow time for repair of damaged DNA followed by re-entry into the cell cycle.  Mutations in INO80 and SWR1 complex subunits result in delayed checkpoint activation (36;46), although the mechanisms by which the complexes influence checkpoint regulation are not known.  A possible clue is that the Ies4 subunit of the INO80 complex is phosphorylated by Mec1 and Tel1 (the yeast ATR and ATM proteins) during exposure to DNA damaging agents (47).

 

  -DNA replication

The yeast INO80 complex is enriched at DNA replication origins, even more abundantly at stalled replications forks that are under replicative stress (48-50).  Mutation of Ino80 results in dissociation of components of the replication machinery from the replication fork, leading to defects in sustained replication and survival of yeast exposed to agents that cause replication fork stalling (50).  The human INO80 complex has also been shown to participate in DNA replication, binding to replication forks during S phase of the cell cycle (51).

 

TIP60 complex

The TIP60 complex (named for HIV Tat interactive protein 60 that was originally identified as an activator of Tat-dependent transcription) acetylates the ε-amino groups of lysine residues on nucleosomal histones H2A and H4, as well as on other cellular proteins (52).  Proteins of the mammalian TIP60 complex are orthologous to proteins in either the NuA4 (nucleosomal acetyltransferase of H4) or the SWR1 complexes of yeast (13;53).  Thus, Ruvbl1 and Ruvbl2, which are part of the TIP60 complex and required for its histone acetyltransferase activity (54), are found in the SWR1 complex but not in the NuA4 complex.  It has been proposed that the functions of the two yeast complexes have been integrated into a single complex in mammals (53).

 

The TIP60 complex interacts with a variety of proteins that target the complex to specific substrates.  To promote transcription, it is recruited by a number of transcription factors to acetylate histones at promoters.  For example, c-Myc has been shown to induce histone H4 acetylation at its target promoters by recruiting the TIP60 complex, including Ruvbl1 and Ruvbl2 (55).  The transcriptional activator E2F1 also binds to and recruits the TIP60 complex to its target promoters to induce histone acetylation (56).  Transcriptional activation of histone genes has been shown to require recruitment of the TIP60 complex to histone promoters during the G1/S transition (57).

 

In addition to transcriptional regulation, the TIP60 complex plays a key role in DSB repair by both influencing chromatin remodeling at DSBs, and by acetylation and activation of the ATM kinase.  The TIP60 complex is recruited to DSBs by phosphorylated H2AX similarly to the INO80 and SWR1 complexes (27).  TIP60-mediated acetylation of H2AX and H4 at DSBs promotes the recruitment of repair proteins and its absence results in defective repair by homologous recombination (13;58).  In addition, acetylation of histone H4 by TIP60 is required for the exchange of phospho-H2AX, which marks the damaged region of DNA, for unmodified H2AX (59;60).  Another group reported that TIP60 acetylation of histone H4 is required prior to the dephosphorylation of phospho-H2AX surrounding the DSB (54).

 

The TIP60 complex also acetylates ATM in response to DNA damage, a modification that contributes to activation of ATM kinase activity (61;62).  However, it was also reported that downregulation of Ruvbl1 does not reduce phosphorylation levels of ATM substrates (54).

 

Assembly and stabilization of protein complexes

snoRNPs

Figure 11. Structure of snoRNAs. Box C/D snoRNAs (left) direct 2’-O-ribose methylation (green circle) 5 bases upstream of the D or D’ box. H/ACA snoRNAs (right) guide pseudouridylation.

Small nucleolar RNAs (snoRNAs) function within protein-containing complexes called small nucleolar ribonucleoproteins (snoRNPs) that modify and process other noncoding RNAs including small nuclear RNA (snRNA), tRNA, and most commonly, ribosomal RNA (rRNA) (Figure 11).  The snoRNAs, like other noncoding RNAs, function as adaptors that guide substrate RNAs via Watson-Crick base pairing to the active site of the RNP.  They are divided into two classes based on the nucleotide modifications they guide.  Box C/D snoRNAs direct 2’-O-ribose methylation, and box H/ACA snoRNAs guide pseudouridylation (isomerization of uridine to pseudouridine).  These modifications are required for ribosome and spliceosome function. 

 

snoRNAs interact with core sets of highly conserved proteins to form the box C/D and H/ACA RNPs.  These proteins are cotranscriptionally assembled with the nascent RNA to form a stable snoRNP, and Ruvbl1 and Ruvbl2 are thought to be required for this process, which occurs in the nucleoplasm.  When Rvb2 was depleted from yeast, box C/D and box H/ACA snoRNA levels were reduced and core proteins of both snoRNPs were mislocalized from the nucleolus to the nucleoplasm (23).  Mutation of the box C/D motif of the U14 snoRNA prevented binding of C/D core proteins as well as binding of Ruvbl1 and Ruvbl2, and resulted in mislocalization of the snoRNA from the nucleolus to the nucleoplasm (63).  These findings suggested that Ruvbl1 and Ruvbl2 are assembly factors, perhaps acting as scaffolding proteins for snoRNPs.  A restructuring event that stabilizes the interactions of the core proteins with the snoRNA has been shown to occur during snoRNP maturation (64).  The interaction of Ruvbl1 and Ruvbl2 with multiple core box C/D proteins led to the hypothesis that, in addition to aiding snoRNP assembly, Ruvbl1 and Ruvbl2 mediate this restructuring event (22;64-66).

 

Phosphatidylinositol 3-kinase-related kinase (PIKK) proteins

In yeast, Rvb1 and Rvb2, together with Tah1 and Pih1 (also called Nop17), form the R2TP complex that associates with the chaperones Hsp90 (67;68) and prefoldin proteins (69).  The subcellular localization of the interactions between R2TP and either Hsp90, prefoldin 2, or prefoldin 6 is unknown, since these interactions were identified using immunoprecipitation or affinity purification from soluble fractions of whole cell lysates.  The mammalian R2TP complex has been proposed to itself act as a cytoplasmic chaperone that stabilizes members of the PIKK family that includes ATM, ATR, DNA-PKcs, mTOR, SMG1, and TRRAP (70).  Ruvbl1 and Ruvbl2 associated with all PIKKs in pull down assays, and knockdown of either Ruvbl1 or Ruvbl2 in HCT116 colorectal carcinoma cells led to an impairment of PIKK-mediated signaling, for example Chk1 and Chk2 phosphorylation in response to DNA damage (74).  In addition, Ruvbl1 and Ruvbl2 regulate the abundance of PIKK mRNAs, possibly by regulating their transcription as part of chromatin-remodeling complexes or in conjunction with transcription factors (56;71;72). The R2TP complex is also believed to contribute to snoRNP biogenesis and snoRNA accumulation (67;68;73;74).

 

Telomerase core complex

The telomerase complex adds telomere repeats to the ends of chromosomes, and is another RNP complex reported to require Ruvbl1 and Ruvbl2 for proper assembly (75).  Telomerase reverse transcriptase (TERT), the telomerase RNA component (TERC), and the TERC-binding protein dyskerin are the three essential components of the complex.  Ruvbl1 interacts directly with TERT and dyskerin, and depletion of Ruvbl1 and Ruvbl2 results in reduced telomerase complex accumulation.

Putative Mechanism

The Worker mutation likely causes nonsense-mediated decay of the Ruvbl2 transcript.  Homozygous mutation causes lethality, whereas heterozygous mutation causes a humoral immune phenotype in one-third of heterozygous mice.  Following are several hypotheses for the mechanism of the Worker mutation.

 

The white belly spotting observed in Worker mice is indicative of defective melanoblast migration during embryogenesis.  The incomplete penetrance and perfect concordance of immune and pigmentation phenotypes in Worker mice suggest the possibility of an epigenetic mechanism of the mutation, which may exert its effects during embryogenesis.  The consequences are observed in distinct cell types that differentiate long afterward: T cells (derived from hematopoietic stem cell precursors of the yolk sac) and melanocytes (derived from the neural crest).  The involvement of Ruvbl2 in the regulation of chromatin remodeling by the INO80, SRCAP, and TIP60 complexes supports this hypothesis.

 

Reduced T-dependent IgG responses were observed in heterozygous Worker mice.  The underlying defect appears to be T cell-dependent, since B cell responses to T-independent antigens and B cell development were observed to be normal.  Moreover, CD4+ and CD8+ T cells were reduced in the mutant mice.  These data are consistent with the relatively high expression of Ruvbl2 in the thymus and in thymocytes, which suggests a T cell-intrinsic effect of the Worker mutation.  The existence of Ruvbl1 and Ruvbl2 in the INO80, SRCAP, and TIP60 complexes, all of which participate in the repair of DNA double strand breaks, raises the possibility that they contribute to double strand break repair during V(D)J recombination.  Impaired repair of DSBs made by RAG1/RAG2 during V(D)J recombination in thymocytes, but not in immature B cells, might ultimately result in reduced numbers of T cells in Worker mice.  In support of this hypothesis, homozygous null and nonsense mutations in the NHEJ DNA repair factor DNA-PKcs cause T cell-negative, B-cell negative severe combined immunodeficiency (SCID) (76), and a missense mutation causes a decrease in lymphocyte numbers (Prkdchanky; MGI: 4820716).  Mutations in other components of the NHEJ machinery, including Lig4 (77) and Artemis (78), result in impaired V(D)J recombination and various degrees of B and T lymphocyte reduction, most more severe than observed in Worker mice. 

 

As in Worker mice, immune and pigmentation phenotypes together with putative impairment of RNP function are observed in the syndrome dyskeratosis congenita (OMIM #127550, #305000, #224230).  The disease is characterized by nail dystrophy, skin hyperpigmentation, and oral leukoplakia, as well as immunodeficiency and bone marrow failure.  A report indicates that immunological abnormalities (lymphopenia, low B-cell numbers, hypogammaglobulinemia, and decreased T-cell function) were the most frequent laboratory findings at initial presentation (79).  The disease is caused by premature telomere shortening leading to death of high-turnover cell types including hematopoietic cells, immune cells, and epithelial cells.  Mutations in one of at least five genes encoding dyskerin (X-linked), TERC (autosomal dominant disease), TERT (autosomal dominant disease), NOP10 or NHP2 (both autosomal recessive disease), which are part of the telomerase holoenzyme, have been identified in patients with dyskeratosis congenita.  It may be that a defect in telomerase function due to Ruvbl2 mutation contributes to the T cell deficiency in Worker mice.

Primers Primers cannot be located by automatic search.
Genotyping

Worker genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers

Worker (F): 5’- TGTGACACGAAGCCTGTTTCCC -3’

Worker (R): 5’-CGGACACATGGTTCCAATGTTCCTC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7)  4°C              ∞

 

Primers for sequencing

Worker_seq(F): 5’- ATTAGTGATTGATGGCCCAGAG -3’

Worker_seq(R): 5’- CCAATGTTCCTCAAAGTTCCAG -3’

 

The following sequence of 420 nucleotides (from Genbank genomic region NC_000073.5 for linear genomic sequence of Ruvbl2, sense strand) is amplified:

 

2887       tgtg acacgaagcc tgtttccctg ggccccgtgg tggggctgat cactgccatt

2941 agtgattgat ggcccagagg gtggtggtgg ctgctgttgt gttgcctgcc tgtgcagtgg

3001 ggggctcctg gtgggcagca ggaccttgag ggagcagatg aaactgtgac aactgggaac

3061 cttcttacac gtcatcgtcc tcacctgcag gcagccacca ccaaagtccc tgagatccga

3121 gatgtgacaa gaatcgagcg aatcggtgag tgagcagggt caggaccaag ggagacacca

3181 ctgcttagtg cccagacaga cagagaagga tgcaatgggg ccttagtccc aggctatgct

3241 gccatacgcc tagcatgcct ccacggggtt tctggaactt tgaggaacat tggaaccatg

3301 tgtccg

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References
Science Writers Eva Marie Y. Moresco, Anne Murray
Illustrators Diantha La Vine
AuthorsCarrie N. Arnold, Elaine Pirie, and Bruce Beutler