Phenotypic Mutation 'frizz' (pdf version)
Allelefrizz
Mutation Type splice acceptor site (11 bp from exon)
Chromosome11
Coordinate34,258,184 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Dock2
Gene Name dedicator of cyto-kinesis 2
Synonym(s) CED-5, MBC, Hch
Chromosomal Location 34,226,815-34,783,892 bp (-)
MGI Phenotype Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells.
Accession Number

NCBI RefSeq: NM_033374; MGI: 2149010

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000090884 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Blast:C2 425 542 N/A BLAST
low complexity region 582 597 N/A INTRINSIC
Pfam:Ded_cyto 1430 1614 2.4e-35 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Phenotypic Category decrease in B cells, decrease in CD4+ T cells, decrease in CD8+ T cells, immune system, T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All alleles(18) : Targeted(4) Gene trapped(11) Spontaneous(1) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense probably damaging 1.00
IGL00469:Dock2 APN 11 34229603 unclassified noncoding transcript
IGL01061:Dock2 APN 11 34705826 missense probably damaging 1.00
IGL01319:Dock2 APN 11 34698790 missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense probably damaging 0.97
IGL01601:Dock2 APN 11 34239528 unclassified probably null
IGL01800:Dock2 APN 11 34756273 missense probably damaging 1.00
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.01
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense probably damaging 0.98
IGL01830:Dock2 APN 11 34691917 nonsense probably null
IGL01835:Dock2 APN 11 34310435 missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.02
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.28
IGL01989:Dock2 APN 11 34268053 missense probably benign
IGL02081:Dock2 APN 11 34254355 missense probably benign
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.01
IGL02170:Dock2 APN 11 34267949 unclassified probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense probably damaging 0.98
IGL02389:Dock2 APN 11 34698740 unclassified noncoding transcript
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 unclassified probably null
IGL02929:Dock2 APN 11 34268048 missense probably damaging 1.00
IGL02951:Dock2 APN 11 34310448 unclassified noncoding transcript
IGL02999:Dock2 APN 11 34692259 missense probably damaging 0.99
IGL03165:Dock2 APN 11 34687533 missense probably damaging 0.99
Arches UTSW 11 34689760 missense probably damaging 1.00
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense
frazz UTSW 11 34248572 critical splice donor site
liaoning UTSW 11 34708793 missense probably damaging 1.00
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
JAX1:Dock2 UTSW 11 34229472 critical splice donor site probably null
JAX1:Dock2 UTSW 11 34438327 missense probably damaging 1.00
JAX1:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R0006:Dock2 UTSW 11 34312453 splice site noncoding transcript
R0012:Dock2 UTSW 11 34783795 missense possibly damaging 0.51
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 splice site noncoding transcript
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.30
R0538:Dock2 UTSW 11 34704718 splice site noncoding transcript
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably damaging 0.99
R0722:Dock2 UTSW 11 34464970 splice acceptor site noncoding transcript
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.78
R1121:Dock2 UTSW 11 34756291 splice acceptor site noncoding transcript
R1171:Dock2 UTSW 11 34695241 missense probably damaging 1.00
R1387:Dock2 UTSW 11 34273309 splice acceptor site
R1435:Dock2 UTSW 11 34718836 splice donor site noncoding transcript
R1445:Dock2 UTSW 11 34239705 missense probably benign
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense probably damaging 0.99
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1616:Dock2 UTSW 11 34363848 splice donor site
R1629:Dock2 UTSW 11 34262480 splice acceptor site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.25
R1924:Dock2 UTSW 11 34464934 missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34727470 splice acceptor site noncoding transcript
R2045:Dock2 UTSW 11 34294106 splice donor site
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.16
R2098:Dock2 UTSW 11 34719005 missense probably damaging 0.99
R2129:Dock2 UTSW 11 34727415 missense probably damaging 1.00
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2185:Dock2 UTSW 11 34227740 splice acceptor site noncoding transcript
R2230:Dock2 UTSW 11 34294323 missense probably damaging 0.99
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 unclassified noncoding transcript
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 unclassified probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
R6155:Dock2 UTSW 11 34294123 missense probably benign 0.06
R6156:Dock2 UTSW 11 34247789 missense possibly damaging 0.51
R6173:Dock2 UTSW 11 34262388 missense probably null 0.80
R6182:Dock2 UTSW 11 34229476 missense probably damaging 0.97
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.08
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0022:Dock2 UTSW 11 34261564 splice acceptor site probably benign
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Sperm, gDNA
MMRRC Submission 036114-MU
Last Updated 05/31/2017 3:46 PM by Katherine Timer
Record Created 03/15/2010 3:55 PM by Carrie N. Arnold
Record Posted 07/06/2011
Other Mutations in This Stock Stock #: G5538 Run Code: SLD00239
Coding Region Coverage: 1x: 75.9% 3x: 46.5%
Validation Efficiency: 69/84

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
Eif3a A to T 19: 60,781,902 N120K probably damaging Het
Pikfyve T to C 1: 65,202,916 W272R probably damaging Homo
Polr3b T to A 10: 84,631,794 N79K probably benign Het
Phenotypic Description

Figure 1.

Figure 2.

The frizz mutation was discovered while analyzing N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice using flow cytometry analysis of blood.  Frizz animals have reduced frequencies of peripheral CD4+ and CD8+ T cells and low expression of B220 (the B cell form of CD45; see the record for belittle), suggesting a block in B cell maturation (Figure 1).  In addition, these animals lack a T-dependent immunoglobin (IgG) response to model antigens encoded by a recombinant nonreplicating vector based on the Semliki Forest Virus (rSFV), but make normal T-independent IgM responses to haptenated ficoll (Figure 2).  The frizz phenotype is similar to that of frazz mutants with a mutation in the Dock2 gene.  Complementation testing between the two strains confirmed that frizz is also an allele of Dock2.

Nature of Mutation

Whole genome sequencing of a homozygous frizz mouse using the SOLiD technique covered the coding/splicing region at least 1x or 3x with 75.9% and 46.5% coverage, respectively.  Validation sequencing using the Sanger method was attempted on all nucleotides for which discrepancies were seen at 3x or greater coverage, with 69 of 84 discrepancies successfully processed and mutations in three genes were identified. Whole genome sequencing did not identify the causative mutation in Dock2.  Standard Sanger sequencing of the Dock2 gene identified a T to A transversion at position 34158184 in the GenBank genomic region NC_000077 for the Dock2 gene on chromosome 11 (TGATCCCATAG  -> AGATCCCATAG) (Figure). In GenBank, the mutation is located near the acceptor splice site of intron 16 (intron 38 in Ensembl record ENSMUST00000093193) from the ATG exon, eleven nucleotides to the next exon.  Dock2 contains 30 exons according to Genbank record NM_033374 and 52 exons according to Ensembl record ENSMUST00000093193.  Multiple Dock2 transcripts are displayed on Ensembl and Vega. The effect of the mutation at the cDNA and protein level is currently being determined.  One possibility, shown below, is that aberrant splicing may result in skipping of the 90 bp exon 39, utilization of the acceptor splice site from intron 39 and in-frame splicing to exon 40 (depicted below as seen on Ensembl). This would result in deletion of 30 amino acids.

 

    <--exon 38 <--intron 38 exon 39-->  exon 40--> <--exon 52

     CACCAACAG……TGATCCCATAG ATGTGGGAA………ACCCAGCAG………AACATGTGA

1289 -K--G--K-              -M--W--E-   -T--Q--Q-………-N--M--*  1828

      correct                deleted          correct

       
The acceptor splice site of intron 38, which is destroyed by the mutation, is indicated in blue; the mutated nucleotide is indicated in red.

Protein Prediction
Figure 3. Domain structure of mouse DOCK2, a member of the DOCK A subfamily. DOCK A proteins contain an N-terminal SH3 domain. SH3-containing DOCK proteins have been shown to interact physically with the scaffolding proteins engulfment and cell motility protein 1 (ELMO1) and ELMO2, significantly promoting Rac activation. DHR-1 domain shares weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac. The frizz mutation causes a T to A transversion near the acceptor splice site of intron 16, eleven nucleotides to the next exon. The mutation may result aberrant splicing and skipping of exon 17. Click on the image to view other mutations found in DOCK2. Click on each mututation for more specific information.

The frizz mutation likely results in abnormal splicing of Dock2 and may cause an internal deletion of amino acids 1292-1321 in the DHR-2 domain.

 

For more information on the Dock2 gene, see the record for frazz.

Primers Primers cannot be located by automatic search.
Genotyping
Frizz genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 
Primers
Frizz(F): 5’- GATGCTCACCAAGACCTCATCAGG -3’
Frizz(R): 5’- GCGCAGATGACTCTCCATTTCTCAC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for sequencing
Frizz_seq(F): 5'- AGACCTCATCAGGCCCTTC -3'
Frizz_seq(R): 5'- TCTCTCCCAGTACTTAGGAAGATCAG -3'
 
The following sequence of 513 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 11, bases 34,157,954 to 34,158,466) is amplified:
 
gcgcagatga ctctccattt ctcacctaga gtgtaggtct gatgttagtg acctctctcc
cagtacttag aagatcaga gcacatgtaa acaagttact ccattattca gtaaaggagc
tggttagaaa gccaggggaa gtttgtacta ctaccaaggc ccgctctgtg tgagcactag
gtaagaagct gtctgcggtg caacgggcga tggcaaggct caagtccctc cttcagcaaa
ggctctgaaa agttggacca cctctaacca ctgtccccat gatgatccca tagatgtggg
aagaggccat cagcctgtgc aaggaactgg cggaacaata tgagatggag atctttgact
acgagctact cagccagaac ctggtaaggc tctcccaaga aagccatgca cgccacacac
gcggtgctcg ctcagctcag agacagaagc gaggcccgtg ggttagggag acagaagact
ggggaagggc ctgatgaggt cttggtgagc atc
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
Science Writers Nora G. Smart
Illustrators Katherine Timer
AuthorsCarrie N. Arnold, Elaine Pirie, and Bruce Beutler
Edit History
09/15/2011 5:59 PM (current)
07/18/2011 3:11 PM
07/15/2011 10:26 AM
07/06/2011 11:34 AM
07/06/2011 11:32 AM
07/06/2011 10:42 AM
07/06/2011 10:38 AM