Phenotypic Mutation 'mrtless' (pdf version)
Allelemrtless
Mutation Type missense
Chromosome1
Coordinate36,781,149 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Zap70
Gene Name zeta-chain (TCR) associated protein kinase
Synonym(s) ZAP-70, TZK, Srk
Chromosomal Location 36,761,798-36,782,818 bp (+)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009539; MGI: 99613

Mapped Yes 
Amino Acid Change Tryptophan changed to Arginine
Institutional SourceAustralian Phenomics Network
Ref Sequences
W504R in Ensembl: ENSMUSP00000027291 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000027291)
Phenotypic Category
Phenotypequestion? Literature verified References
CD8 response - decreased
FACS CD4+ T cells - decreased
FACS CD8+ T cells - decreased
immune system
Penetrance 100% 
Alleles Listed at MGI
All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
murdock APN 1 36779704 missense possibly damaging 0.95
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 unclassified probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36778390 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Mode of Inheritance Autosomal Recessive
Local Stock None
Repository

Australian PhenomeBank: 158

Last Updated 2017-08-08 8:07 PM by Diantha La Vine
Record Created 2010-05-26 9:30 AM by Nora G. Smart
Record Posted 2010-05-26
Phenotypic Description
The mrtless (mrt) phenotype was identified in a flow cytometry screen of blood from N-ethyl-N-nitrosourea (ENU)-mutagenized mice for mutations affecting the circulating proportions of memory and naïve T cells (1). Homozygous mrtless mice display an almost complete arrest of T cell development at the CD4+CD8+ double positive (DP) stage resulting in very few peripheral T cells.  Cluster of differentiation 5 (CD5) and CD69 are upregulated on T cells in response to T cell activation.  A comparison of CD5 and CD69 expression in Zap70mrt/mrt and homozygous null Zap70−/− animals established that Zap70mrt/mrt thymocytes have greater responsiveness to TCR stimulation than thymocytes with no ZAP-70 (Figure 1).  
 
Please see the record for murdock for more information about the Zap70mrt  allele.  
Nature of Mutation
The mrtless mutation was mapped to Chromosome 1, and corresponds to a T to C transition at position 1601 of the Zap70 transcript, in exon 11 of 13 total exons.
 
1586 AAGTGGCCTCTGAAGTGGTACGCGCCAGAGTGC
499  -K--W--P--L--K--W--Y--A--P--E--C-
The mutated nucleotide is indicated in red lettering and causes a tryptophan to arginine change at amino acid 504 of the encoded protein.

 

Protein Prediction
Figure 2. Structure of ZAP-70. Mouse Zap-70 is a 618 amino acid protein tyrosine kinasen (PTK) that consists of two N-terminal Src-homology 2 (SH2) domains and a C-terminal kinase domain. The SH2 domains are connected by a linker known as interdomain A (IDA), while the region between the second SH2 and catalytic domains is known as interdomain B (IDB). The aspartic acid (D) of the residue 459 is the proton acceptor during the catalytic cycle. Several tyrosine (Y) residues located within interdomain B are phosphorylated following TCR stimulation (291, 314, and 318). Phosphorylation of Tyr 492 is required for ZAP-70 activation, while Tyr 491 phosphorylation negatively regulates ZAP-70 function. The mrtless mutation causes a tryptophan to arginine change at amino acid 504. The 3D structure is human ZAP70. UCSF Chimera structure based on PDB 2OZO. This image is interactive. Click on the image to view other mutations found in ZAP-70 (red). Click on the mutations for more specific information. Click on the 3D structure to view it rotate.
The mrtless mutation results in a tryptophan to arginine substitution of a conserved residue in the activation loop within the catalytic site of the kinase domain at amino acid 504 (Figure 2). The aberrant protein is expressed at 25% of wild-type levels (1).
 
Please see the record for murdock for more information about Zap70.
Primers Primers cannot be located by automatic search.
Genotyping

Genotyping protocols are from the Australian PhenomeBank.

Mr T-Less (amplifluor)
Mr T-Less (MS-PCR)

References

1. Siggs, O. M., Miosge, L. A., Yates, A. L., Kucharska, E. M., Sheahan, D., Brdicka, T., Weiss, A., Liston, A., and Goodnow, C. C. (2007) Opposing Functions of the T Cell Receptor Kinase ZAP-70 in Immunity and Tolerance Differentially Titrate in Response to Nucleotide Substitutions. Immunity. 27, 912-926.

Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsOwen M. Siggs, Lisa A. Miosge, Adele L. Yates, Edyta M. Kucharska, Daniel Sheahan, Tomas Brdicka, Arthur Weiss, Adrian Liston, and Christopher C. Goodnow.
Edit History
2011-08-17 10:21 AM (current)
2011-08-16 4:04 PM
2011-01-06 9:37 AM
2011-01-04 2:53 PM
2010-07-13 3:07 PM
2010-07-13 3:05 PM
2010-05-27 3:29 PM
2010-05-27 3:29 PM
2010-05-27 1:25 PM
2010-05-26 2:59 PM
2010-05-26 11:06 AM
2010-05-26 10:14 AM
2010-05-26 9:32 AM