Phenotypic Mutation 'Meager' (pdf version)
AlleleMeager
Mutation Type missense
Chromosome9
Coordinate106,224,139 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Tlr9
Gene Name toll-like receptor 9
Chromosomal Location 106,222,598-106,226,883 bp (+)
MGI Phenotype Mice homozygous for a knock-out allele exhibit impaired immune system response to LPS, CpG, and Leishmania bazillensis infection.
Accession Number

NCBI RefSeq: NM_031178; MGI: 1932389

Mapped Yes 
Amino Acid Change Asparagine changed to Tyrosine
Institutional SourceBeutler Lab
Ref Sequences
N210Y in Ensembl: ENSMUSP00000082207 (fasta)
Gene Model not available
PDB Structure
Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 363 386 N/A BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
Blast:LRR 471 494 N/A BLAST
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 N/A BLAST
Pfam:TIR 872 1012 1.1e-13 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000082207)
Phenotypic Category immune system, TLR signaling defect: type I IFN production by pDC
Penetrance 100% 
Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(1) Gene trapped(1) Chemically induced(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 0.99
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.86
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 0.99
IGL02851:Tlr9 APN 9 106224730 nonsense probably null 0.00
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 0.99
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
Cpg7 UTSW 9 106225349 missense probably benign 0.01
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign 0.00
R0071:Tlr9 UTSW 9 106223578 missense probably benign 0.00
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.02
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign 0.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.65
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 unclassified probably null
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm, gDNA
MMRRC Submission 034618-UCD
Last Updated 04/11/2017 2:53 PM by Katherine Timer
Record Created 06/18/2010 3:33 PM by Amanda L. Blasius
Record Posted 02/08/2011
Phenotypic Description

The Meager phenotype was identified in a screen of ENU-mutagenized homozygous G3 mice looking for reduced type I interferon (IFN) responses to CpG DNA challenge in vivo (Figure 1). 

Nature of Mutation

 The Meager mutation was mapped to Chromosome 9 by outcrossing the index mouse to the closely related C57BL/10J strain and intercrossing F1 animals.  Progeny were tested for in vivo type I interferon responses (Figure 2) and the DNA samples from phenotypically wild type and mutant animals were pooled separately and analyzed by bulk segregation analysis (BSA) using a panel of 124 single nucleotide polymorphisms (SNPs) (1).  Sequencing of the candidate gene Tlr9 on Chromosome 9 found an A to T transversion at position 734 of the Tlr9 transcript using Genbank record NM_031178.2, in exon 2 of 2 total exons (Figure 3). 

 


 

719 TCTCTGAAGTATAACAACCTCACAAAGGTGCCC

205 -S--L--K--Y--N--N--L--T--K--V--P-

 

The mutated nucleotide is indicated in red lettering, and causes an asparagine to tyrosine substitution at amino acid 210 of the TLR9 protein.

Protein Prediction

The Meager mutation results in an asparagine to tyrosine amino acid change at position 210 of the TLR9 protein, which lies in the predicted sixth LRR module of the TLR9 ectodomain. 

Please see the record for CpG1 for information about Tlr9.
Putative Mechanism
The Meager mutation substitutes tyrosine for asparagine at position 210 of the TLR9 protein, which lies in the predicted sixth LRR module of the TLR9 ectodomain and is conserved in human TLR9. This residue is located just after the invariant tenth asparagine residue present in all LRR motifs (XLXXLXLXXN), which folds into a β-strand. No tertiary structural data presently exist for TLR9, making it difficult to hypothesize how the Meager mutation could affect either ligand binding or receptor dimerization.  Recently, the crystal structure of the related TLR3 heterodimer bound to double-stranded (ds) RNA has been elucidated (see record for CpG1).  The ligand-bound TLR3 heterodimer forms an M-shape with the dsRNA binding to the concave surfaces of the TLR3 heterodimer at two locations on each ectodomain (2). It has been hypothesized that TLR7, 8 and 9 ligands may also bind to the concave surface of the ectodomain at a site made up by insertions at LRR 2, 5, 8 and 11 (3).  The Meager mutation might somehow disrupt ligand binding and/or receptor dimerization, or destroy proper folding or localization of the receptor. 
 
Only homozygous Meager mice have been tested in the in vivo CpG screen, but Tlr9 mutations are known to behave semidominantly in other assays.  The Meager mutation is thus tentatively classified as semidominant.
Primers Primers cannot be located by automatic search.
Genotyping
Meager genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 
 
Primers
meager(F): 5’- TGGCTGTTCCTGAAGTCTGTACCC -3’
meager(R): 5’- AGATGCCGTTCATGTTCAGCTCC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for sequencing
meager_seq(F): 5'- GTTTCTCTGCGGCAGCATC -3'
meager_seq(R): 5'- CTTGACAATGAGGTTATAGGACACC -3'
 
The following sequence of 985 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 9, bases 106,125,981 to 106,126,965) is amplified:
                                   tggctgtt cctgaagtct gtaccccgtt
tctctgcggc agcatcctgc tccaacatca cccgcctctc cttgatctcc aaccgtatcc
accacctgca caactctgac ttcgtccacc tgtccaacct gcggcagctg aacctcaagt
ggaactgtcc acccactggc cttagccccc tgcacttctc ttgccacatg accattgagc
ccagaacctt cctggctatg cgtacactgg aggagctgaa cttgagctat aatggtatca
ccactgtgcc ccgactgccc agctccctgg tgaatctgag cctgagccac accaacatcc
tggttctaga tgctaacagc ctcgccggcc tatacagcct gcgcgttctc ttcatggacg
ggaactgcta ctacaagaac ccctgcacag gagcggtgaa ggtgacccca ggcgccctcc
tgggcctgag caatctcacc catctgtctc tgaagtataa caacctcaca aaggtgcccc
gccaactgcc ccccagcctg gagtacctcc tggtgtccta taacctcatt gtcaagctgg
ggcctgaaga cctggccaat ctgacctccc ttcgagtact tgatgtgggt gggaattgcc
gtcgctgtga ccatgccccc aatccctgta tagaatgtgg ccaaaagtcc ctccacctgc
accctgagac cttccatcac ctgagccatc tggaaggcct ggtgctgaag gacagctctc
tccatacact gaactcttcc tggttccaag gtctggtcaa cctctcggtg ctggacctaa
gcgagaactt tctctatgaa agcatcaccc acaccaatgc ctttcagaac ctaacccgcc
tgcgcaagct caacctgtcc ttcaattacc gcaagaaggt atcctttgcc cgcctccacc
tggcaagttc ctttaagaac ctggtgtcac tgcaggagct gaacatgaac ggcatct
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red.  
References

1. Xia, Y., Won, S., Du, X., Lin, P., Ross, C., La Vine, D., Wiltshire, S., Leiva, G., Vidal, S. M., Whittle, B., Goodnow, C. C., Koziol, J., Moresco, E. M., and Beutler, B. (2010) Bulk Segregation Mapping of Mutations in Closely Related Strains of Mice. Genetics 186, 1139-1146. 

2.  Liu, L., Botos, I., Wang, Y., Leonard, J. N., Shiloach, J., Segal, D. M., and Davies, D. R. (2008) Structural basis of toll-like receptor 3 signaling with double-stranded RNA, Science 320, 379-381.  

Science Writers Nora G. Smart
Illustrators Peter Jurek
AuthorsAmanda L. Blasius, Bruce Beutler
Edit History
06/15/2011 5:23 PM (current)
02/15/2011 5:30 PM
02/09/2011 9:10 AM
02/09/2011 9:09 AM
02/09/2011 8:57 AM
02/08/2011 3:51 PM