Phenotypic Mutation 'nd7'

• Allele: nd7
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 59,446,701 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Nlrp3
• Gene Name: NLR family, pyrin domain containing 3
• Synonym(s): Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
• Chromosomal Location: 59,432,395-59,457,781 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008] ; PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Cysteine changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q8R4B8
• SMART Domains: Protein: ENSMUSP00000078440; Gene: ENSMUSG00000032691; AA Change: C816R

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
  (Using ENSMUST00000079476)
• SMART Domains: Protein: ENSMUSP00000098707; Gene: ENSMUSG00000032691; AA Change: C816R

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
  (Using ENSMUST00000101148)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.079)
• Phenotypic Category: Autosomal Semidominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: None
• Last Updated: 2019-01-29 1:21 PM by Diantha La Vine
• Record Created: 2010-07-14 10:42 AM by Hua Huang
• Record Posted: 2011-05-23
• Science Writers: Nora G. Smart
• Illustrators: Katherine Timer
• Authors: Hua Huang,Bruce Beutler

Accession Number

NCBI RefSeq: NM_145827; MGI: 2653833

Alleles Listed at MGI

All alleles(10) : Targeted, knock-out(3) Targeted, other(4) Chemically induced(3)

Phenotypic Description

Figure 1.

The ND7 phenotype was identified in two female sibling G3 mice (H8716 and H8718) tested in the NALP3 Inflammasome Screen.  Peritoneal macrophages isolated from these mice secreted reduced amounts of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 1).  Macrophages from both mice produced normal levels of tumor necrosis factor (TNF)-α in response to LPS stimulation alone, suggesting that signaling from the Toll-like receptor 4 (TLR4), which senses LPS, was unimpaired.

Nature of Mutation

The Nlrp3 gene was directly sequenced as a candidate gene from the genomic DNA (gDNA) of the index mouse, H8716. A heterozygous T to C transition was found at position 2672 of the Nlrp3 transcript in exon 6 of 10 total exons using Genbank record NM_145827. The mutation is located in the fifth coding exon.  The gDNA of the same index mouse was submitted for whole-genome sequencing using the SOLiD technique, which also identified the same mutation.

2657 GGAATCAGATTGCTGTGTGTGGGACTGAAGCAC
811  -G--I--R--L--L--C--V--G--L--K--H-

 

The mutated nucleotide is indicated in red lettering, and causes a cysteine to arginine substitution at residue 816 of the NLRP3 protein.

Protein Prediction

Figure 2. Domain structure of NLRP3. Shown are the pyrin domain (PYD), NACHT domain, NACHT associated domain (NAD), and leucine-rich repeat (LRR) domain. Together, the NACHT and NAD domains are known as the nucleotide-binding domain (NBD). The nd7 mutation causes a cysteine to arginine substitution at residue 816. This image is interactive. Other mutations found in NLRP3 are noted in red. Click on each mutation for more specific information.

The ND7 mutation results in a cysteine to arginine change in coding exon 5. The altered amino acid is located in the third leucine rich repeat (LRR) (Figure 2). It is likely that this mutation affects the structure and function of the LRR domain, perhaps interfering with binding to factors that stimulate the inflammasome.

Please see the record for ND1 for more information about Nlrp3.

Primers

Primers cannot be located by automatic search.

Genotyping

ND7 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 

Primers

ND7(F): 5’- ATGGTCGGGGAGTCTATGCACATC -3’

ND7(R): 5’- AGAAGCGTTCAGTAAGGACCCCAC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               8

 

Primers for sequencing

ND7 _seq(F): 5'- GTCTATGCACATCATGAGGCTAAG -3'

ND7 _seq(R): 5’- ACCATGATGCTTAGCAGTGC -3’

 

The following sequence of 948 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 11, bases 59,368,891 to 59,379,774) is amplified:

 

                                                                               

atggtcgggg agtctatgca catcatgagg ctaaggaaca aaggaggaag agagcaagag
tgagggggaa agagacagac acacagacac acatacagac agagacagag agacagagag
agacagagac agacagagag acagagagag atagagagag acaaaacagt atttcagtat
ctccctaagg tcaccccctt cagtgtccat acatcccatg tgtcttcctc taggctccac
ttcccagagg tttcagtccc cgccccccat agtgtgagcg tgtaggcgtg ggacacgcat
aggatctgga tcctgagaga ggcctctctc tgatgtctga ttctgttctc gctgtgaagg
ttggggcgct gcggactgtc ccatcaatgc tgcttcgaca tctcctctgt cctgagcagc
agccagaagc tggtggagct ggacctcagt gacaatgccc tgggggactt tggaatcaga
ttgctgtgtg tgggactgaa gcacctgctc tgcaacctcc agaaactgtg gtgagtctgg
cctacctccc ttaggcagct ctgctgtgga ggcccaattc aggaactctg cttcagggag
acacagcgag ccatcatcag ctcctgtgtg aggatgagaa tattctcagc ggcctggagg
gcttcctgcg ctcccttctg ctagtttgcc agtcgttcag tcagccagtg attgctgtgc
ggggagttaa tgggaaaata tagcagtggt gtgtatgtct gtgcgtgtgt gtatgtttat
aaatcatcaa ataaactgtc tttaagatat ccgaggaaac agaagcactg ctaagcatca
tggtagaacg gttttgagag gtcataataa atcctcacac taaatagaaa aaaagcagcg
cttaagcaat ggaatattta ttgtgtgggg tccttactga acgcttct

       

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.