Phenotypic Mutation 'frazz' (pdf version)
Allelefrazz
Mutation Type critical splice donor site (2 bp from exon)
Chromosome11
Coordinate34,248,572 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Dock2
Gene Name dedicator of cyto-kinesis 2
Synonym(s) CED-5, MBC, Hch
Chromosomal Location 34,226,815-34,783,892 bp (-)
MGI Phenotype Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells.
Accession Number

NCBI RefSeq: NM_033374; MGI: 2149010

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000090884 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Blast:C2 425 542 N/A BLAST
low complexity region 582 597 N/A INTRINSIC
Pfam:Ded_cyto 1430 1614 2.4e-35 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Phenotypic Category decrease in B cells, immune system, T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance 100% 
Alleles Listed at MGI

All alleles(18) : Targeted(4) Gene trapped(11) Spontaneous(1) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense possibly damaging 0.62
IGL00469:Dock2 APN 11 34229603 splice site 0.00
IGL01061:Dock2 APN 11 34705826 missense probably damaging 0.99
IGL01319:Dock2 APN 11 34698790 missense probably benign 0.32
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense possibly damaging 0.85
IGL01601:Dock2 APN 11 34239528 critical splice donor site probably null 0.00
IGL01800:Dock2 APN 11 34756273 missense possibly damaging 0.95
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.08
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense possibly damaging 0.94
IGL01830:Dock2 APN 11 34691917 nonsense probably null 0.00
IGL01835:Dock2 APN 11 34310435 missense probably benign 0.31
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.00
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.00
IGL01989:Dock2 APN 11 34268053 missense probably benign 0.00
IGL02081:Dock2 APN 11 34254355 missense probably benign 0.00
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.00
IGL02170:Dock2 APN 11 34267949 missense probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense possibly damaging 0.65
IGL02389:Dock2 APN 11 34698740 splice site 0.00
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 splice site 0.00
IGL02929:Dock2 APN 11 34268048 missense probably damaging 0.99
IGL02951:Dock2 APN 11 34310448 splice site 0.00
IGL02999:Dock2 APN 11 34692259 missense probably damaging 1.00
IGL03165:Dock2 APN 11 34687533 missense possibly damaging 0.93
Arches UTSW 11 34689760 missense probably damaging 1.00
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense
frizz UTSW 11 34258184 splice acceptor site
liaoning UTSW 11 34708793 missense probably damaging 1.00
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
R0006:Dock2 UTSW 11 34312453 splice donor site probably benign
R0012:Dock2 UTSW 11 34783795 missense probably benign 0.29
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 splice acceptor site probably benign
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.56
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.01
R0538:Dock2 UTSW 11 34704718 splice acceptor site probably benign
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably benign 0.39
R0722:Dock2 UTSW 11 34464970 splice acceptor site probably benign
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.63
R1121:Dock2 UTSW 11 34756291 splice acceptor site probably benign
R1171:Dock2 UTSW 11 34695241 missense possibly damaging 0.93
R1387:Dock2 UTSW 11 34273309 splice acceptor site probably benign
R1435:Dock2 UTSW 11 34718836 splice donor site probably benign
R1445:Dock2 UTSW 11 34239705 missense probably benign 0.00
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense possibly damaging 0.63
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1616:Dock2 UTSW 11 34363848 splice donor site probably benign
R1629:Dock2 UTSW 11 34262480 splice acceptor site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.00
R1924:Dock2 UTSW 11 34464934 missense probably benign 0.02
R2031:Dock2 UTSW 11 34727470 splice acceptor site probably benign
R2045:Dock2 UTSW 11 34294106 splice donor site probably benign
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.08
R2098:Dock2 UTSW 11 34719005 missense possibly damaging 0.83
R2129:Dock2 UTSW 11 34727415 missense probably benign 0.27
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2185:Dock2 UTSW 11 34227740 splice acceptor site probably benign
R2230:Dock2 UTSW 11 34294323 missense possibly damaging 0.89
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 unclassified probably benign
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 unclassified probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.04
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0022:Dock2 UTSW 11 34261564 splice acceptor site probably benign
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
MMRRC Submission 036113-MU
Last Updated 12/02/2016 4:07 PM by Katherine Timer
Record Created 08/03/2010 1:19 PM by Carrie N. Arnold
Record Posted 07/06/2011
Other Mutations in This Stock Stock #: H8930 Run Code: SLD00240
Coding Region Coverage: 1x: 77.1% 3x: 50.6%
Validation Efficiency: 89/120

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
Cdc20b A to T 13: 113,083,966 I460F probably damaging Homo
Ddx4 A to C 13: 112,613,833 probably benign Homo
Ick T to A 9: 78,150,619 I150N possibly damaging Het
Malt1 T to G 18: 65,462,815 Y431* probably null Het
Mtr A to G 13: 12,235,460 S346P probably damaging Het
Nup155 T to C 15: 8,157,658 V1357A possibly damaging Het
Prl3c1 T to A 13: 27,200,706 L66* probably null Het
Spata1 A to T 3: 146,487,271 L155* probably null Homo
Phenotypic Description

The frazz mutation was discovered while screening N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice for aberrant T-dependent and T-independent B cell responses. Frazz mice lack a T-dependent immuoglobin G (IgG) response to model antigens encoded by a recombinant nonreplicating vector based on the Semliki Forest Virus (rSFV) (Figure 1).  T-independent IgM responses to haptenated ficoll need to be re-analyzed due to variability.  Flow cytometry analysis of blood from this mouse revealed low expression of B220 (the B cell form of CD45; see the record for belittle), suggesting a block in B cell maturation.

Nature of Mutation
Whole genome sequencing of a homozygous frazz mouse using the SOLiD technique covered the coding/splicing region at least 1x or 3x with 77.1% and 50.6% coverage, respectively. Validation sequencing using the Sanger method was attempted on all nucleotides for which discrepancies were seen at 3x or greater coverage, with 89 of 102 discrepancies successfully processed. Mutations in 10 genes were identified including a T to A transversion at position 34148572 in the Genbank genomic region NC_000077 for the Dock2 gene on chromosome 11 (GTGAGTATAA  -> GAGAGTATAA). Dock2 contains 30 exons according to Genbank record NM_033374 and 52 exons according to Ensembl record ENSMUST00000093193. The mutation is located within the donor splice site of intron 43 in Ensembl (intron 21 in GenBank) from the ATG exon, two nucleotides from the previous exon.  Multiple Dock2 transcripts are displayed on Ensembl and Vega. The mutation was confirmed using standard Sanger sequencing (Figure 2). The effect of the mutation at the cDNA and protein level is currently being determined.  One possibility, shown below (from Ensembl), is that aberrant splicing may result in skipping of the 85 bp exon 43 and in-frame splicing to exon 44.  This would result in deletion of 28 amino acids.
 
      <--exon 42   <--exon 43 intron 43-->  exon 44-->  <--exon 52   
     CAGATCATAAA…………GAGTTTGCT GTGAGTATAA…………TCCATGTGG…………AACATGTGA
1428 -Q--I--I--N…………-E--F--A-               -S--M--W-…………-N--M--*  1828
       correct       deleted                       correct
 
The donor splice site of intron 43, which is destroyed by the mutation, is indicated in blue; the mutated nucleotide is indicated in red.
Protein Prediction
Figure 3. Domain structure of mouse DOCK2, a member of the DOCK A subfamily. DOCK A proteins contain an N-terminal SH3 domain. SH3-containing DOCK proteins have been shown to interact physically with the scaffolding proteins engulfment and cell motility protein 1 (ELMO1) and ELMO2, significantly promoting Rac activation. DHR-1 domain shares weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac. The frazz mutation causes a T to A transversion within intron 21. The mutation likely results in abnormal splicing of Dock2 and may cause an internal deletion of amino acids 1432-1459 in the DHR-2 domain. Click on the image to view other mutations found in DOCK2. Click on each mututation for more specific information.

The full-length mouse DOCK2 (dedicator of cytokinesis 2) protein is 1828 amino acids long, and is 96% identical to its human homologue (Figure 3).  DOCK2 belongs to the DOCK180 superfamily of guanine nucleotide exchange factors (GEFs) that have been shown to activate members of the Rho family of small GTPases (1-4).  In mammals, 11 of these proteins have been identified, and can be classified into four subfamilies; DOCK A (which includes DOCK2), DOCK B, DOCK C (which includes DOCK7; see the record for moonlight) and DOCK D based on theirdiffering specificities for binding to the Rho GTPases Rac and Cdc42, regulatory domains,and associated subunits (1;3;4).  DOCK A and B subfamilies activate Rac, the DOCK D subfamily is specific for Cdc42, whereas the DOCK C subfamily has dual specificity for Rac and Cdc42 (1;2;5;6).  Two domains are shared amongst all DOCK proteins, the catalytic DHR-2 (DOCK homology region 2) or CZH-2 (CDM-zizimin homology 2) domain and the DHR-1 or CZH-1 domain.  The DHR-1 domain is located N-terminal to the DHR-2 domain (3;4).  The sequences between the recognized domains are predicted to be mostly helical, and may fold as armadillo (ARM) repeat domains.  The armadillo repeat is a roughly 40 amino acid long tandemly repeated sequence motif and forms suprahelical structures used to bind to other proteins, especially those containing the same motifs (7).

 

Figure 4. Structure of the complex between DOCK9 and Cdc42-GDP. UCSF Chimera model is based on PDB 2WMN, Yang et al., Science 325, 1398-1402 (2009). Click on the 3D structure to view it rotate.

The DHR-2 domains of several DOCK family members interact with the nucleotide-free form of Rac and/or Cdc42 (3;4), and deletion of the DHR-2 domain in many of these proteins abolishes their ability to activate these GTPases (2;5;8;9).  The DHR-2 domain is large domain containing roughly 450-550 amino acids, and is located at residues 1114-1620 in DOCK2.  The zizimin 1/DOCK9 protein is able to dimerize through its DHR-2 domain (10), while structural analysis of DOCK9-Cdc42 complexes suggests that the presence of a nucleotide sensor contributes to release of guanine diphosphate (GDP) and subsequently, that of activated GTP-bound Cdc42 (Figure 4) (PDB 2WMO; 2WMN; 2WM9).  Magnesium (Mg2+) exclusion, which promotes GDP release, is mediated by a conserved valine residue (Val 1538 in DOCK2) within the nucleotide sensor.  Binding of GTP-Mg2+ to the nucleotide-free DOCK9/Cdc42 complex results in displacement of the sensor to allow discharge of GTP-bound Cdc42.  The structure of the DHR-2 domain differs from that of other GEF catalytic domains and consists of three lobes A, B and C.  The Cdc42 binding site and catalytic center are located in lobes B and C.  Lobe A consists of an antiparallel array of five α helices (α1-α5) and stabilizes the DHR-2 domain through contacts with lobe B.  DOCK9 dimerization occurs through helices 4 and 5.  This interface contains residues that are conserved in other DOCK proteins (Lys 1301, Glu 1308, Leu 1317, and Tyr 1328 for DOCK2).  Lobe B consists of two antiparallel β sheets arranged orthogonally, and lobe C comprises a four-helix bundle (α7-α10).  The α10 helix is the most conserved region of the DHR-2 domain, and is interrupted by the seven-residue loop nucleotide sensor (11).

 

Figure 5. Structure of the DHR-1 domain of DOCK1. UCSF Chimera model is based on PDB 3L4C, Premkumar et al., J. Biol. Chem 285, 13211-13222 (2010). Click on the 3D structure to view it rotate.

The roughly 250 amino acid DHR-1 domain (amino acids 420-662 in DOCK2) is not as well defined in these proteins.  However, the DOCK A and B DHR-1 domains share weak homology to the C2 domain, a well characterized Ca2+-dependent lipid-binding module (12).  Several DOCK proteins, including DOCK2, appear to be localized to the plasma membrane via interaction of the DHR-1 domain with phosphatidylinositol (3,5)-biphosphate [PtdIns(3,5)P2] and phosphatidylinositol (3,4,5) P3 (PIP3) signaling lipids (13-15).  Other studies have shown that the DHR-1 domain for zizimin 1/DOCK9 is able to bind to the DHR-2 domain and inhibit its function (16).  The structure of the DOCK180 (also known as DOCK1) DHR-1 domain confirms the similarity to C2 (Fiugre 5) (PDB 3L4C).  The DHR-1 domain folds into a type II C2 domain fold consisting of an antiparallel β sandwich consisting of two four-stranded β sheets (β1- β8).  The DHR-1 domain also contains three loops between β1-β2 (L1), β3-β4 (L2), and β5-β6 (L3) on the upper surface of the structure as well as two large insertions between β2 and β3 and β7 and β8.  The loop region creates a positively charged pocket at the top of the molecule that allows recognition of the PIP3 head group.  The pocket has many of the characteristics of lipid-binding pleckstrin homology (PH) domains.  Residues predicted to contact phospholipid are Lys 437, Lys 440, Arg 444, Tyr 482, Glu 483, His 513, Ser 515, Glu 517 and Lys 522, and mutagenesis of Lys 437, Lys 440, Arg 444 (a lysine in DOCK180) and Lys 522 reduces or abolishes phospholipid binding.  Unlike many C2 domains, the DHR-1 domain binds phospholipids independently of calcium.  The DHR-1 domain also contains another highly basic pocket on its concave surface often called the β-groove in many C2 domains, but this does not participate in phospholipid binding (17).

 

Members of the DOCK A and B groups contain an N-terminal SH3 domain.  In DOCK2, this domain is located at amino acids 8-69.  SH3-containing DOCK proteins have been shown to interact physically with the scaffolding proteins engulfment and cell motility protein 1 (ELMO1) and ELMO2 (18-21), an association that significantly promotes Rac activation.  ELMO proteins engage DOCK180 in at least three different ways: (1) an ELMO proline-rich motif interacts with the DOCK SH3 domain (2) the ELMO PH domain interacts with the nucleotide free Rac–DOCK DHR-2 complex; and (3) elements within the last 100 residues of ELMO (distinct from the proline-rich motif) interact with elements within the first 357 residues of DOCK180 (distinct from the SH3 domain) (18;22;23).  Interaction of ELMO with the SH3 domain relieves a steric inhibition within DOCK180, in which the SH3 domain interacts with the DHR-2 domain to block Rac binding (23).  In human T cells, the human immunodeficiency virus (HIV) Nef protein binds to the DOCK2-ELMO1 complex and inhibits T cell chemotaxis by promoting generalized instead of polarized Rac activation (24)

 

C-terminal to the DHR-2 domain both DOCK180 and DOCK2 contain a linear motif containing several basic amino acids that enhances membrane binding (25;26).  In DOCK2, this motif is located at residues 1615-1700 and binds to phosphatidic acid (PA).  Mutation of several basic residues within this region abolishes PA binding and prevents correct membrane localization in leukocytes (26).  Unlike DOCK180, DOCK2 does not contain a C-terminal proline-rich region known to bind to the SH3-containing adaptor protein Crk (Hasegawa et al., 1996).  DOCK2 may bind to the hematopoietic-specific adaptor CrkL, but this interaction is controversial (18;27).  DOCK2 can also associate with Vav, another Rac GEF (27).

 

The frazz mutation likely results in abnormal splicing of Dock2 and may cause an internal deletion of amino acids 1432-1459 in the DHR-2 domain.

Expression/Localization

Both human and mouse DOCK2 mRNA and protein is specifically expressed in hematopoietic cells and hematopoietic stem cells, bone marrow, and lymphoid tissue (28-30).  DOCK2 is also found in mouse and human brain localized to microglia, which are resident macrophages of the brain and spinal cord.  In microglia, Dock2 expression is regulated by signaling through the prostaglandin E2 receptor (EP2) (31).

 

In response to chemoattractants, DOCK2 is recruited to the leading edge of chemotaxing cells (14).  In general, members of the DOCK A and B subgroups are localized to the membrane through their DHR-1 domains and also by association with ELMO proteins, which bind to the membrane-localized constitutively active RhoG GTPase (32;33).

 

DOCK2 is highly expressed in human B cell lymphomas (34).

Background
Figure 6. Rho GTPase activation cycle. Rho GTPases cycle between the inactive GDP-bound state and active GTP-bound state which interacts with effectors. Guanine nucleotide exchange factors (GEFs) promote the exchange of GDP for GTP. GTPase-activating proteins (GAPs) inactivate Rho GTPases by stimulating GTP hydrolysis. Rho guanine nucleotide-dissociation inhibitors (RhoGDIs) recruit inactive GDP-bound Rho GTPases from the membrane.

The Rho GTPases are known regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation and apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, transcription and neurite extension and retraction (Figure 6).  The Rho GTPases are active when bound to GTP and are inactive in their GDP-bound form [reviewed in (35)].  Regulation of Rho GTPase activity is complex and involves the guanine nucleotide exchange factors (GEFs) that promote the exchange of GDP for GTP, the GTPase-activating proteins (GAPs) that enhance the GTPase activity of Rho proteins, and the Rho guanine nucleotide-dissociation inhibitors (RhoGDIs) that sequester Rho GTPases in a GDP-bound state.  GEFs that activate Rho GTPases can be divided into two main groups; the classical GEFs containing the nucleotide-exchanging Dbl-homology (DH) domain, and the DOCK180 superfamily, including DOCK2 (7).

 

The DOCK180 GEFs are also known as the CDM proteins, named for CED-5 (cell death abnormal 5), DOCK180, and 'Myoblast City' (MBC).  CED-5 and MBC are the Caenorhabditis elegans and Drosophila melanogaster orthologues of DOCK180, respectively (4).  Human DOCK180 was the first of these identified, and was cloned as a binding partner of Crk, which plays a role in signaling from focal adhesions (36).  CED-5 was identified as a protein required for cell migration and phagocytosis (37), while MBC was identified as a protein essential for myoblast fusion and dorsal closure (38).  All three of these molecules were found to be important for Rac activation and control of the actin cytoskeleton and microtubule dynamics.  Rac GTPases are critical in generating actin-rich lamellipodial protusions that drive the movement of migrating cells.  During this and similar processes, elevated levels of PIP3 are created at the leading edge by the local activity of phosphatidylinositol 3-kinase (PI3K), which promotes membrane attachment by DOCK-ELMO complexes leading to polarized activation of Rac (1;5;13-15).

 

Three Rac isoforms have been identified in mammals, Rac1, Rac2 and Rac3.  Rac1 is ubiquitously expressed and Rac3 is highly expressed in the brain, whereas Rac2 is largely restricted to the hematopoietic system similar to DOCK2 (39)Rac2 -/- neutrophils (40), B cells (41) and T cells (42) show reduced migration and F-actin polymerization in response to chemokines, although chemotaxis is not completely abolished.  Consistent with these observations, recruitment of Rac2 -/- neutrophils to sites of inflammation is impaired.  Rac2-deficient mice also display a lack of peritoneal B-1 and marginal zone B cells, as well as abnormal T-independent and T-dependent antibody responses (41).  The incomplete block in chemotaxis most likely reflects the continued presence of Rac1 in these cell types.  Deficiency in both Rac1 and Rac2 almost completely blocks B cell development and leads to defects in proliferation and survival (43), as well as preventing the formation of dendrites in mature dendritic cells (DCs), their polarized short-range migration toward T cells, and T cell priming (44).

 

Studies in Dock2 knockout mice have demonstrated that DOCK2 also has a role in the polarization and migration of immune cell subsets.  DOCK2 functions downstream of chemokine receptors to regulate Rac activation and migration of B and T lymphocytes, neutrophils, plasmacytoid dendritic cells (pDCs), and hematopoietic stem cells, but not monocytes or other myeloid cell types (14;26;29;30;45).  The immune cells affected by DOCK2 deficiency display aberrant homing, activation, adhesion, polarization and migration.  As in Rac2-deficient mice, chemotaxis of immune cells is not completely abolished suggesting the existence of other chemotaxis mechanisms.  Although the PI3K-dependent mode of cell polarization is necessary for DOCK2-dependent chemotaxis in neutrophils (14), this is not the case in T and B lymphocytes (46).

 

After undergoing a selection process in primary lymphoid organs such as bone marrow and thymus, naive lymphocytes continually home from blood to secondary lymphoid organs (SLO), such as peripheral and mesenteric lymph nodes (PLN and MLN, respectively), spleen and gut-associated lymphoid tissue including Peyer's patches (PP). Inside SLO, T and B cells localize in T cell area and B cell follicles, respectively, where they screen antigen (Ag)-presenting cells for specific surface Ag complexes. Upon activation with cognate Ag in presence of costimulatory molecules, T and B cells undergo specific changes in microenvironmental positioning. These changes allow T–B cell interactions at the T cell area–B cell follicle border and in germinal centre (GC) light zones to occur. Activated T and B cells eventually leave SLO to accumulate at sites of inflammation or other effector sites.  Lymphocyte migration is regulated by chemokines, integrins and adhesion receptors.  Chemokines are small, secreted polypeptides that signal via heterotrimeric G-protein-coupled receptors.  T cell areas of SLO express the chemokines CCL21 and CCL19, attracting CCR7-positive T cells and DCs, while CXCL13 and CXCL12 attract CXCR5 and CXCR4-expressing B cells to the follicle and splenic red pulp, respectively [reviewed by (39;47)].  DOCK2-deficient lymphocytes fail to respond normally to these chemokines, resulting in impaired homing to SLO and aberrant morphology of these tissues (29).  Differences in the mechanism of B and T cell DOCK2-dependent chemotaxis exist as lack of DOCK2 affected integrin activation in B cells, but did not affect chemokine-triggered integrin activation in T cells (46).

 

Dock2 -/-mice display a number of other immunological phenotypes including lack of marginal zone B cells, reduced numbers of mature CD4+ T cells and the major subset of natural killer T (NKT) cells expressing the semi-invariant Vα14 T cell receptor (TCR), and aberrant TCR signaling (29;48;49).  T and B cell development in the thymus and bone marrow is generally normal in DOCK2-deficient animals (29), including the normal migration of T cell progenitor cells into the thymus. Mice lacking both DOCK2 and DOCK180 do have migration defects at this stage in T cell development (50).  The reduced numbers of CD4+ T and Vα14 NKT cells in Dock2 -/- mice, therefore, are not caused by a migration defect and may be due to aberrant TCR signaling (48;49).  Engagement of TCRs by major histocompatibility complex (MHC) class molecules on antigen presenting cells (APCs) like DCs induces the formation of an immunological synapse composed of a complex of receptors, adhesion molecules and intracellular signaling components at the membrane.  Translocation of TCR and lipid rafts to the synapse is impaired in DOCK2-deficient T cells, although the recruitment and activity of important signaling molecules remains intact.  As a consequence, T cell proliferation, as well as the efficacy of positive and negative selection T cells undergo in the thymus during T cell maturation, are reduced (48).  The altered strength of the TCR signal during T cell development strongly affects the selection of CD4+ T and Vα14 NKT cells, as opposed to cytotoxic CD8+ T cells, as positive selection in these cell types requires a stronger TCR-MHC interaction and TCR signal (48;49).  The T cell migration and TCR signaling defects observed in Dock2 -/- mice contribute to the long-term survival of cardiac allografts in these animals as both the priming and activation of naïve T cells in SLO and migration of alloreactive T cells into the grafts, are impaired (51).

 

In addition to reduced peripheral numbers of CD4+ T cells, lack of DOCK2 affects the differentiation of CD4+ T helper (Th) cells (52). CD4+ T cells differentiate into functionally distinct subsets of T helper cells including Th1, Th2, Th3, Th17 and follicular helper (TFH) cells (please see the record for sanroque) depending on the immune stimulation.  Thcells are involved in activating and directing other immune cells, and do so by producing cytokines that are specific to each subset. Interferon (IFN)-γ producing Th1 cells are important in stimulating macrophages and cytotoxic CD8+ T cells, whereas Th2 cells produce cytokines such as interleukin 4 (IL-4), IL-5 and IL-13 and are involved in humoral immunity and allergic responses [reviewed by Murphy2002].  Mice lacking DOCK2 develop allergic disease by favoring the differentiation of Th2 cells over Th1 cells.  This occurs due to impaired lysosomal trafficking and degradation of the IL-4 receptor leading to sustained IL-4 signaling and promotion of Th2 differentiation (52).

 

Dock2 -/-mice also have an impairment of type I IFN (IFNα/β) production by pDCs, a phenotype that appears to be independent of the pDC migration defect (53).  pDCs are a rare subtype of DC capable of producing large amounts of type I IFN in response to viral infections (54-56).  pDCs are activated upon engagement of Toll like receptors (TLR), which recognize molecular signatures of microbes including viruses [reviewed in (57)]. In particular, ssRNA and ssDNA engage TLR7 and TLR9, respectively, within acidified endosomal compartments (see records for CpG1 and rsq1).  Signaling through both of these receptors is dependent on the adaptor protein myeloid differentiation 88 (MyD88; see the record for pococurante) and interleukin receptor associated kinase 4 (IRAK-4; see the record for otiose), and in pDCs, additionally dependent on inhibitor of kappa-B kinase-α (IKK-α), osteopontin, and interferon regulator factor 7 (IRF7; see the record for inept) for type I IFN production (58;59).  DOCK2-deficient mice and pDCs displayed a lack of type I IFN production in response to TLR7 and TLR9 ligands although proinflammatory cytokine induction by TLR signaling remained intact.  DOCK2-mediated Rac activation was critical for IKK-α activation, which is thought to be involved in the phosphorylation and nuclear translocation of IRF7 (53).

 

Although human DOCK2 mutations have not been identified, mutations in other human DOCK genes result in clinical phenotypes.  Mutations in DOCK3 are associated with attention-deficit hyperactivity disorder (ADHD; OMIM #143465) (60)DOCK8 is mutated in patients with an autosomal recessive form of hyper-IgE recurrent infection syndrome (HIES; OMIM #243700), a disease characterized by recurrent bacterial and viral infections, increased serum IgE, and eosinophilia (61;62).   As mentioned above, DOCK2 is highly expressed in B cell lymphoma and promotes the proliferation of lymphoma cells by activating Rac and the extracellular signal regulated kinase (ERK) (34).  DOCK2 activity may also contribute to Alzheimer’s disease (AD).  Innate immune activation of the central nervous system is associated with several neurodegenerative diseases including AD due to activated microglia that secrete a variety of molecules including proinflammatory cytokines and prostaglandins that can have neurotoxic effects [reviewed by (63)].  Microglia isolated from Dock2 -/- animals displayed impaired proinflammatory responses in response to TLR stimulation and decreased phagocytosis, while the number of DOCK2 + cells was significantly increased in human patients with AD.  A human mutation in RAC2 causes neutrophil immunodeficiency syndrome (OMIM 608203) (64).

Putative Mechanism

The frazz mutation is likely to cause defects in splicing in the Dock2 gene, but the nature of the aberrant Dock2 transcripts in frazz mice has yet to be determined.  Frazz mice display defects in T-dependent antigen response that could be due to defects in conventional B-2 cells, T cells, or both as the migration and function of both of these cell types are compromised in DOCK2 deficient animals.  During a T cell-dependent humoral immune response, CD4+ T helper cell subsets including TFH, Th1 and Th2 cells migrate to the T-B borders of SLO, and interact with cognate antigen-specific B cells through the pairing of T cell and B cell surface ligands and receptors such as CD40 with its ligand (see the record for walla).  This interaction results in the secretion by T helper cells of certain cytokines known to promote B cell survival, proliferation, and antibody production (65;66).  Mice that fail to mount a robust IgG response may possess mutations in genes required for B or CD4+ T cell development or activation, isotype class switching, or terminal differentiation.

 

DOCK2-deficient mice are reported to have an absence of marginal zone B cells (29) that, along with peritoneal B-1 cells, are known to mediate T-independent B cell responses (67;68).  Furthermore, Rac2 -/- animals display aberrant T-independent and T-dependent antibody responses, as well as reduced numbers of both marginal zone B and B-1 cells (41).  Antibody responses have not specifically been examined in Dock2 -/- mice, but it is possible that frazz mice may have suboptimal T-independent responses, although normal responses have been observed in some animals.  The presence or absence of B-1 cells has not been reported in DOCK2-deficient animals.  Marginal zone B cell deficiency and aberrant antibody responses can be found in other mouse strains deficientin signaling molecules involved in cytoskeletal changes including Pyk2 (protein tyrosine kinase 2 beta) (69) and Lsc/p115 RhoGEF (70).

Primers Primers cannot be located by automatic search.
Genotyping
Frazz genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 
Primers
Frazz(F): 5’- GCCTCCTGGAAATGCACAAATGTC -3’
Frazz(R): 5’- TCAGACCTTGAAATGCCACTGCC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for sequencing
Frazz_seq(F): 5'- TGTCAAGGTCATCTGACAGGC -3'
Frazz_seq(R): 5'- GCATGGCTTCCAGAAACTTC -3'
 
The following sequence of 418 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 11, bases 34,148,348 to 34,148,765) is amplified:
 
 
tcagaccttg aaatgccact gccagggccc tgccagacct gatgtttaag gtttcagtgg
atgggtagca tggcttccag aaacttctac tcctttctgt ctttcagctt ttacaagtct
aattatgtgc aaaagttcca ctactccagg cctgtgcgca ggggcaaggt agacccagag
aacgagtttg ctgtgagtat aatcccctcc tcagccatct tcagcaacca gaacacacct
ctgccaacca caggtggggg cagcttgatc cagagccagg gagtgaatac tacatggaca
tcccagatag ggtgacaagt ctactgggtc ttctcatttt ttgaggtttg taagatgtaa
gagggctgcc tgtcagatga ccttgacagc caaggacatt tgtgcatttc caggaggc
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
References
  1. Cote, J. F. and Vuori, K. (2002) Identification of an evolutionarily conserved superfamily of DOCK180-related proteins with guanine nucleotide exchange activity, J Cell Sci. 115, 4901-4913.
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsCarrie N. Arnold, Elaine Pirie, and Bruce Beutler
Edit History
09/15/2011 5:58 PM (current)
08/16/2011 4:56 PM
07/18/2011 3:09 PM
07/06/2011 10:35 AM