Phenotypic Mutation 'frazz'

• Allele: frazz
• Mutation Type: critical splice donor site (2 bp from exon)
• Chromosome: 11
• Coordinate: 34,198,572 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Dock2
• Gene Name: dedicator of cyto-kinesis 2
• Synonym(s): CED-5, Hch, MBC
• Chromosomal Location: 34,176,815-34,674,719 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016] ; PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q8C3J5
• SMART Domains: Protein: ENSMUSP00000090884; Gene: ENSMUSG00000020143

Domain	Start	End	E-Value	Type
SH3	11	68	1.22e-11	SMART
Pfam:DOCK_N	71	414	2e-113	PFAM
Pfam:DOCK-C2	419	616	1e-60	PFAM
Pfam:DHR-2	1114	1614	6.3e-96	PFAM
low complexity region	1691	1706	N/A	INTRINSIC
low complexity region	1793	1800	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000090884; Gene: ENSMUSG00000020143

Domain	Start	End	E-Value	Type
SH3	11	68	1.22e-11	SMART
Pfam:DOCK_N	71	414	2e-113	PFAM
Pfam:DOCK-C2	419	616	1e-60	PFAM
Pfam:DHR-2	1114	1614	6.3e-96	PFAM
low complexity region	1691	1706	N/A	INTRINSIC
low complexity region	1793	1800	N/A	INTRINSIC

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Sperm
• MMRRC Submission: 036113-MU
• Last Updated: 2019-05-21 7:37 PM by Diantha La Vine
• Record Created: 2010-08-03 1:19 PM by Carrie N. Arnold
• Record Posted: 2011-07-06
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Carrie N. Arnold, Elaine Pirie, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_033374; MGI: 2149010

Alleles Listed at MGI

All alleles(18) : Targeted(4) Gene trapped(11) Spontaneous(1) Chemically induced(2)

Phenotypic Description

The frazz mutation was discovered while screening N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice for aberrant T-dependent and T-independent B cell responses. Frazz mice lack a T-dependent immuoglobin G (IgG) response to model antigens encoded by a recombinant nonreplicating vector based on the Semliki Forest Virus (rSFV) (Figure 1).  T-independent IgM responses to haptenated ficoll need to be re-analyzed due to variability.  Flow cytometry analysis of blood from this mouse revealed low expression of B220 (the B cell form of CD45; see the record for belittle), suggesting a block in B cell maturation.

Nature of Mutation

Whole genome sequencing of a homozygous frazz mouse using the SOLiD technique covered the coding/splicing region at least 1x or 3x with 77.1% and 50.6% coverage, respectively. Validation sequencing using the Sanger method was attempted on all nucleotides for which discrepancies were seen at 3x or greater coverage, with 89 of 102 discrepancies successfully processed. Mutations in 10 genes were identified including a T to A transversion at position 34148572 in the Genbank genomic region NC_000077 for the Dock2 gene on chromosome 11 (GTGAGTATAA  -> GAGAGTATAA). Dock2 contains 30 exons according to Genbank record NM_033374 and 52 exons according to Ensembl record ENSMUST00000093193. The mutation is located within the donor splice site of intron 43 in Ensembl (intron 21 in GenBank) from the ATG exon, two nucleotides from the previous exon.  Multiple Dock2 transcripts are displayed on Ensembl and Vega. The mutation was confirmed using standard Sanger sequencing (Figure 2). The effect of the mutation at the cDNA and protein level is currently being determined.  One possibility, shown below (from Ensembl), is that aberrant splicing may result in skipping of the 85 bp exon 43 and in-frame splicing to exon 44.  This would result in deletion of 28 amino acids.

 

      <--exon 42   <--exon 43 intron 43-->  exon 44-->  <--exon 52   

     CAGATCATAAA…………GAGTTTGCT GTGAGTATAA…………TCCATGTGG…………AACATGTGA

1428 -Q--I--I--N…………-E--F--A-               -S--M--W-…………-N--M--*  1828

       correct       deleted                       correct

 

The donor splice site of intron 43, which is destroyed by the mutation, is indicated in blue; the mutated nucleotide is indicated in red.

Protein Prediction

Figure 3. Domain structure of mouse DOCK2, a member of the DOCK A subfamily. DOCK A proteins contain an N-terminal SH3 domain. SH3-containing DOCK proteins have been shown to interact physically with the scaffolding proteins engulfment and cell motility protein 1 (ELMO1) and ELMO2, significantly promoting Rac activation. DHR-1 domain shares weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac. The frazz mutation causes a T to A transversion within intron 21. The mutation likely results in abnormal splicing of Dock2 and may cause an internal deletion of amino acids 1432-1459 in the DHR-2 domain. This image is interactive. Other mutations found in DOCK2 are noted in red. Click on each mutation for more specific information.

The full-length mouse DOCK2 (dedicator of cytokinesis 2) protein is 1828 amino acids long, and is 96% identical to its human homologue (Figure 3).  DOCK2 belongs to the DOCK180 superfamily of guanine nucleotide exchange factors (GEFs) that have been shown to activate members of the Rho family of small GTPases (1-4).  In mammals, 11 of these proteins have been identified, and can be classified into four subfamilies; DOCK A (which includes DOCK2), DOCK B, DOCK C (which includes DOCK7; see the record for moonlight) and DOCK D based on theirdiffering specificities for binding to the Rho GTPases Rac and Cdc42, regulatory domains,and associated subunits (1;3;4).  DOCK A and B subfamilies activate Rac, the DOCK D subfamily is specific for Cdc42, whereas the DOCK C subfamily has dual specificity for Rac and Cdc42 (1;2;5;6).  Two domains are shared amongst all DOCK proteins, the catalytic DHR-2 (DOCK homology region 2) or CZH-2 (CDM-zizimin homology 2) domain and the DHR-1 or CZH-1 domain.  The DHR-1 domain is located N-terminal to the DHR-2 domain (3;4).  The sequences between the recognized domains are predicted to be mostly helical, and may fold as armadillo (ARM) repeat domains.  The armadillo repeat is a roughly 40 amino acid long tandemly repeated sequence motif and forms suprahelical structures used to bind to other proteins, especially those containing the same motifs (7).

The DHR-2 domains of several DOCK family members interact with the nucleotide-free form of Rac and/or Cdc42 (3;4), and deletion of the DHR-2 domain in many of these proteins abolishes their ability to activate these GTPases (2;5;8;9).  The DHR-2 domain is large domain containing roughly 450-550 amino acids, and is located at residues 1114-1620 in DOCK2.  The zizimin 1/DOCK9 protein is able to dimerize through its DHR-2 domain (10), while structural analysis of DOCK9-Cdc42 complexes suggests that the presence of a nucleotide sensor contributes to release of guanine diphosphate (GDP) and subsequently, that of activated GTP-bound Cdc42 (Figure 4) (PDB 2WMO; 2WMN; 2WM9).  Magnesium (Mg²⁺) exclusion, which promotes GDP release, is mediated by a conserved valine residue (Val 1538 in DOCK2) within the nucleotide sensor.  Binding of GTP-Mg²⁺ to the nucleotide-free DOCK9/Cdc42 complex results in displacement of the sensor to allow discharge of GTP-bound Cdc42.  The structure of the DHR-2 domain differs from that of other GEF catalytic domains and consists of three lobes A, B and C.  The Cdc42 binding site and catalytic center are located in lobes B and C.  Lobe A consists of an antiparallel array of five α helices (α1-α5) and stabilizes the DHR-2 domain through contacts with lobe B.  DOCK9 dimerization occurs through helices 4 and 5.  This interface contains residues that are conserved in other DOCK proteins (Lys 1301, Glu 1308, Leu 1317, and Tyr 1328 for DOCK2).  Lobe B consists of two antiparallel β sheets arranged orthogonally, and lobe C comprises a four-helix bundle (α7-α10).  The α10 helix is the most conserved region of the DHR-2 domain, and is interrupted by the seven-residue loop nucleotide sensor (11).

The roughly 250 amino acid DHR-1 domain (amino acids 420-662 in DOCK2) is not as well defined in these proteins.  However, the DOCK A and B DHR-1 domains share weak homology to the C2 domain, a well characterized Ca²⁺-dependent lipid-binding module (12).  Several DOCK proteins, including DOCK2, appear to be localized to the plasma membrane via interaction of the DHR-1 domain with phosphatidylinositol (3,5)-biphosphate [PtdIns(3,5)P₂] and phosphatidylinositol (3,4,5) P₃ (PIP₃) signaling lipids (13-15).  Other studies have shown that the DHR-1 domain for zizimin 1/DOCK9 is able to bind to the DHR-2 domain and inhibit its function (16).  The structure of the DOCK180 (also known as DOCK1) DHR-1 domain confirms the similarity to C2 (Fiugre 5) (PDB 3L4C).  The DHR-1 domain folds into a type II C2 domain fold consisting of an antiparallel β sandwich consisting of two four-stranded β sheets (β1- β8).  The DHR-1 domain also contains three loops between β1-β2 (L1), β3-β4 (L2), and β5-β6 (L3) on the upper surface of the structure as well as two large insertions between β2 and β3 and β7 and β8.  The loop region creates a positively charged pocket at the top of the molecule that allows recognition of the PIP₃ head group.  The pocket has many of the characteristics of lipid-binding pleckstrin homology (PH) domains.  Residues predicted to contact phospholipid are Lys 437, Lys 440, Arg 444, Tyr 482, Glu 483, His 513, Ser 515, Glu 517 and Lys 522, and mutagenesis of Lys 437, Lys 440, Arg 444 (a lysine in DOCK180) and Lys 522 reduces or abolishes phospholipid binding.  Unlike many C2 domains, the DHR-1 domain binds phospholipids independently of calcium.  The DHR-1 domain also contains another highly basic pocket on its concave surface often called the β-groove in many C2 domains, but this does not participate in phospholipid binding (17).

Members of the DOCK A and B groups contain an N-terminal SH3 domain.  In DOCK2, this domain is located at amino acids 8-69.  SH3-containing DOCK proteins have been shown to interact physically with the scaffolding proteins engulfment and cell motility protein 1 (ELMO1) and ELMO2 (18-21), an association that significantly promotes Rac activation.  ELMO proteins engage DOCK180 in at least three different ways: (1) an ELMO proline-rich motif interacts with the DOCK SH3 domain (2) the ELMO PH domain interacts with the nucleotide free Rac–DOCK DHR-2 complex; and (3) elements within the last 100 residues of ELMO (distinct from the proline-rich motif) interact with elements within the first 357 residues of DOCK180 (distinct from the SH3 domain) (18;22;23).  Interaction of ELMO with the SH3 domain relieves a steric inhibition within DOCK180, in which the SH3 domain interacts with the DHR-2 domain to block Rac binding (23).  In human T cells, the human immunodeficiency virus (HIV) Nef protein binds to the DOCK2-ELMO1 complex and inhibits T cell chemotaxis by promoting generalized instead of polarized Rac activation (24). 

C-terminal to the DHR-2 domain both DOCK180 and DOCK2 contain a linear motif containing several basic amino acids that enhances membrane binding (25;26).  In DOCK2, this motif is located at residues 1615-1700 and binds to phosphatidic acid (PA).  Mutation of several basic residues within this region abolishes PA binding and prevents correct membrane localization in leukocytes (26).  Unlike DOCK180, DOCK2 does not contain a C-terminal proline-rich region known to bind to the SH3-containing adaptor protein Crk (Hasegawa et al., 1996).  DOCK2 may bind to the hematopoietic-specific adaptor CrkL, but this interaction is controversial (18;27).  DOCK2 can also associate with Vav, another Rac GEF (27).

The frazz mutation likely results in abnormal splicing of Dock2 and may cause an internal deletion of amino acids 1432-1459 in the DHR-2 domain.

Expression/Localization

Both human and mouse DOCK2 mRNA and protein is specifically expressed in hematopoietic cells and hematopoietic stem cells, bone marrow, and lymphoid tissue (28-30).  DOCK2 is also found in mouse and human brain localized to microglia, which are resident macrophages of the brain and spinal cord.  In microglia, Dock2 expression is regulated by signaling through the prostaglandin E2 receptor (EP2) (31).

In response to chemoattractants, DOCK2 is recruited to the leading edge of chemotaxing cells (14).  In general, members of the DOCK A and B subgroups are localized to the membrane through their DHR-1 domains and also by association with ELMO proteins, which bind to the membrane-localized constitutively active RhoG GTPase (32;33).

DOCK2 is highly expressed in human B cell lymphomas (34).

Background

Figure 6. Rho GTPase activation cycle. Rho GTPases cycle between the inactive GDP-bound state and active GTP-bound state which interacts with effectors. Guanine nucleotide exchange factors (GEFs) promote the exchange of GDP for GTP. GTPase-activating proteins (GAPs) inactivate Rho GTPases by stimulating GTP hydrolysis. Rho guanine nucleotide-dissociation inhibitors (RhoGDIs) recruit inactive GDP-bound Rho GTPases from the membrane.

The Rho GTPases are known regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation and apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, transcription and neurite extension and retraction (Figure 6).  The Rho GTPases are active when bound to GTP and are inactive in their GDP-bound form [reviewed in (35)].  Regulation of Rho GTPase activity is complex and involves the guanine nucleotide exchange factors (GEFs) that promote the exchange of GDP for GTP, the GTPase-activating proteins (GAPs) that enhance the GTPase activity of Rho proteins, and the Rho guanine nucleotide-dissociation inhibitors (RhoGDIs) that sequester Rho GTPases in a GDP-bound state.  GEFs that activate Rho GTPases can be divided into two main groups; the classical GEFs containing the nucleotide-exchanging Dbl-homology (DH) domain, and the DOCK180 superfamily, including DOCK2 (7).

The DOCK180 GEFs are also known as the CDM proteins, named for CED-5 (cell death abnormal 5), DOCK180, and 'Myoblast City' (MBC).  CED-5 and MBC are the Caenorhabditis elegans and Drosophila melanogaster orthologues of DOCK180, respectively (4).  Human DOCK180 was the first of these identified, and was cloned as a binding partner of Crk, which plays a role in signaling from focal adhesions (36).  CED-5 was identified as a protein required for cell migration and phagocytosis (37), while MBC was identified as a protein essential for myoblast fusion and dorsal closure (38).  All three of these molecules were found to be important for Rac activation and control of the actin cytoskeleton and microtubule dynamics.  Rac GTPases are critical in generating actin-rich lamellipodial protusions that drive the movement of migrating cells.  During this and similar processes, elevated levels of PIP₃ are created at the leading edge by the local activity of phosphatidylinositol 3-kinase (PI3K), which promotes membrane attachment by DOCK-ELMO complexes leading to polarized activation of Rac (1;5;13-15).

Three Rac isoforms have been identified in mammals, Rac1, Rac2 and Rac3.  Rac1 is ubiquitously expressed and Rac3 is highly expressed in the brain, whereas Rac2 is largely restricted to the hematopoietic system similar to DOCK2 (39).  Rac2 ^-/- neutrophils (40), B cells (41) and T cells (42) show reduced migration and F-actin polymerization in response to chemokines, although chemotaxis is not completely abolished.  Consistent with these observations, recruitment of Rac2 ^-/- neutrophils to sites of inflammation is impaired.  Rac2-deficient mice also display a lack of peritoneal B-1 and marginal zone B cells, as well as abnormal T-independent and T-dependent antibody responses (41).  The incomplete block in chemotaxis most likely reflects the continued presence of Rac1 in these cell types.  Deficiency in both Rac1 and Rac2 almost completely blocks B cell development and leads to defects in proliferation and survival (43), as well as preventing the formation of dendrites in mature dendritic cells (DCs), their polarized short-range migration toward T cells, and T cell priming (44).

Studies in Dock2 knockout mice have demonstrated that DOCK2 also has a role in the polarization and migration of immune cell subsets.  DOCK2 functions downstream of chemokine receptors to regulate Rac activation and migration of B and T lymphocytes, neutrophils, plasmacytoid dendritic cells (pDCs), and hematopoietic stem cells, but not monocytes or other myeloid cell types (14;26;29;30;45).  The immune cells affected by DOCK2 deficiency display aberrant homing, activation, adhesion, polarization and migration.  As in Rac2-deficient mice, chemotaxis of immune cells is not completely abolished suggesting the existence of other chemotaxis mechanisms.  Although the PI3K-dependent mode of cell polarization is necessary for DOCK2-dependent chemotaxis in neutrophils (14), this is not the case in T and B lymphocytes (46).

After undergoing a selection process in primary lymphoid organs such as bone marrow and thymus, naive lymphocytes continually home from blood to secondary lymphoid organs (SLO), such as peripheral and mesenteric lymph nodes (PLN and MLN, respectively), spleen and gut-associated lymphoid tissue including Peyer's patches (PP). Inside SLO, T and B cells localize in T cell area and B cell follicles, respectively, where they screen antigen (Ag)-presenting cells for specific surface Ag complexes. Upon activation with cognate Ag in presence of costimulatory molecules, T and B cells undergo specific changes in microenvironmental positioning. These changes allow T–B cell interactions at the T cell area–B cell follicle border and in germinal centre (GC) light zones to occur. Activated T and B cells eventually leave SLO to accumulate at sites of inflammation or other effector sites.  Lymphocyte migration is regulated by chemokines, integrins and adhesion receptors.  Chemokines are small, secreted polypeptides that signal via heterotrimeric G-protein-coupled receptors.  T cell areas of SLO express the chemokines CCL21 and CCL19, attracting CCR7-positive T cells and DCs, while CXCL13 and CXCL12 attract CXCR5 and CXCR4-expressing B cells to the follicle and splenic red pulp, respectively [reviewed by (39;47)].  DOCK2-deficient lymphocytes fail to respond normally to these chemokines, resulting in impaired homing to SLO and aberrant morphology of these tissues (29).  Differences in the mechanism of B and T cell DOCK2-dependent chemotaxis exist as lack of DOCK2 affected integrin activation in B cells, but did not affect chemokine-triggered integrin activation in T cells (46).

Dock2 ^-/-mice display a number of other immunological phenotypes including lack of marginal zone B cells, reduced numbers of mature CD4⁺ T cells and the major subset of natural killer T (NKT) cells expressing the semi-invariant Vα14 T cell receptor (TCR), and aberrant TCR signaling (29;48;49).  T and B cell development in the thymus and bone marrow is generally normal in DOCK2-deficient animals (29), including the normal migration of T cell progenitor cells into the thymus. Mice lacking both DOCK2 and DOCK180 do have migration defects at this stage in T cell development (50).  The reduced numbers of CD4⁺ T and Vα14 NKT cells in Dock2 ^-/- mice, therefore, are not caused by a migration defect and may be due to aberrant TCR signaling (48;49).  Engagement of TCRs by major histocompatibility complex (MHC) class molecules on antigen presenting cells (APCs) like DCs induces the formation of an immunological synapse composed of a complex of receptors, adhesion molecules and intracellular signaling components at the membrane.  Translocation of TCR and lipid rafts to the synapse is impaired in DOCK2-deficient T cells, although the recruitment and activity of important signaling molecules remains intact.  As a consequence, T cell proliferation, as well as the efficacy of positive and negative selection T cells undergo in the thymus during T cell maturation, are reduced (48).  The altered strength of the TCR signal during T cell development strongly affects the selection of CD4⁺ T and Vα14 NKT cells, as opposed to cytotoxic CD8⁺ T cells, as positive selection in these cell types requires a stronger TCR-MHC interaction and TCR signal (48;49).  The T cell migration and TCR signaling defects observed in Dock2 ^-/- mice contribute to the long-term survival of cardiac allografts in these animals as both the priming and activation of naïve T cells in SLO and migration of alloreactive T cells into the grafts, are impaired (51).

In addition to reduced peripheral numbers of CD4⁺ T cells, lack of DOCK2 affects the differentiation of CD4⁺ T helper (Th) cells (52). CD4⁺ T cells differentiate into functionally distinct subsets of T helper cells including Th1, Th2, Th3, Th17 and follicular helper (T_FH) cells (please see the record for sanroque) depending on the immune stimulation.  Thcells are involved in activating and directing other immune cells, and do so by producing cytokines that are specific to each subset. Interferon (IFN)-γ producing Th1 cells are important in stimulating macrophages and cytotoxic CD8⁺ T cells, whereas Th2 cells produce cytokines such as interleukin 4 (IL-4), IL-5 and IL-13 and are involved in humoral immunity and allergic responses [reviewed by Murphy2002].  Mice lacking DOCK2 develop allergic disease by favoring the differentiation of Th2 cells over Th1 cells.  This occurs due to impaired lysosomal trafficking and degradation of the IL-4 receptor leading to sustained IL-4 signaling and promotion of Th2 differentiation (52).

Dock2 ^-/-mice also have an impairment of type I IFN (IFNα/β) production by pDCs, a phenotype that appears to be independent of the pDC migration defect (53).  pDCs are a rare subtype of DC capable of producing large amounts of type I IFN in response to viral infections (54-56).  pDCs are activated upon engagement of Toll like receptors (TLR), which recognize molecular signatures of microbes including viruses [reviewed in (57)]. In particular, ssRNA and ssDNA engage TLR7 and TLR9, respectively, within acidified endosomal compartments (see records for CpG1 and rsq1).  Signaling through both of these receptors is dependent on the adaptor protein myeloid differentiation 88 (MyD88; see the record for pococurante) and interleukin receptor associated kinase 4 (IRAK-4; see the record for otiose), and in pDCs, additionally dependent on inhibitor of kappa-B kinase-α (IKK-α), osteopontin, and interferon regulator factor 7 (IRF7; see the record for inept) for type I IFN production (58;59).  DOCK2-deficient mice and pDCs displayed a lack of type I IFN production in response to TLR7 and TLR9 ligands although proinflammatory cytokine induction by TLR signaling remained intact.  DOCK2-mediated Rac activation was critical for IKK-α activation, which is thought to be involved in the phosphorylation and nuclear translocation of IRF7 (53).

Although human DOCK2 mutations have not been identified, mutations in other human DOCK genes result in clinical phenotypes.  Mutations in DOCK3 are associated with attention-deficit hyperactivity disorder (ADHD; OMIM #143465) (60).  DOCK8 is mutated in patients with an autosomal recessive form of hyper-IgE recurrent infection syndrome (HIES; OMIM #243700), a disease characterized by recurrent bacterial and viral infections, increased serum IgE, and eosinophilia (61;62).   As mentioned above, DOCK2 is highly expressed in B cell lymphoma and promotes the proliferation of lymphoma cells by activating Rac and the extracellular signal regulated kinase (ERK) (34).  DOCK2 activity may also contribute to Alzheimer’s disease (AD).  Innate immune activation of the central nervous system is associated with several neurodegenerative diseases including AD due to activated microglia that secrete a variety of molecules including proinflammatory cytokines and prostaglandins that can have neurotoxic effects [reviewed by (63)].  Microglia isolated from Dock2 ^-/- animals displayed impaired proinflammatory responses in response to TLR stimulation and decreased phagocytosis, while the number of DOCK2 ⁺ cells was significantly increased in human patients with AD.  A human mutation in RAC2 causes neutrophil immunodeficiency syndrome (OMIM 608203) (64).

Putative Mechanism

The frazz mutation is likely to cause defects in splicing in the Dock2 gene, but the nature of the aberrant Dock2 transcripts in frazz mice has yet to be determined.  Frazz mice display defects in T-dependent antigen response that could be due to defects in conventional B-2 cells, T cells, or both as the migration and function of both of these cell types are compromised in DOCK2 deficient animals.  During a T cell-dependent humoral immune response, CD4⁺ T helper cell subsets including T_FH, Th1 and Th2 cells migrate to the T-B borders of SLO, and interact with cognate antigen-specific B cells through the pairing of T cell and B cell surface ligands and receptors such as CD40 with its ligand (see the record for walla).  This interaction results in the secretion by T helper cells of certain cytokines known to promote B cell survival, proliferation, and antibody production (65;66).  Mice that fail to mount a robust IgG response may possess mutations in genes required for B or CD4⁺ T cell development or activation, isotype class switching, or terminal differentiation.

DOCK2-deficient mice are reported to have an absence of marginal zone B cells (29) that, along with peritoneal B-1 cells, are known to mediate T-independent B cell responses (67;68).  Furthermore, Rac2 ^-/- animals display aberrant T-independent and T-dependent antibody responses, as well as reduced numbers of both marginal zone B and B-1 cells (41).  Antibody responses have not specifically been examined in Dock2 ^-/- mice, but it is possible that frazz mice may have suboptimal T-independent responses, although normal responses have been observed in some animals.  The presence or absence of B-1 cells has not been reported in DOCK2-deficient animals.  Marginal zone B cell deficiency and aberrant antibody responses can be found in other mouse strains deficientin signaling molecules involved in cytoskeletal changes including Pyk2 (protein tyrosine kinase 2 beta) (69) and Lsc/p115 RhoGEF (70).

Primers

Primers cannot be located by automatic search.

Genotyping

Frazz genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.

 

Primers

Frazz(F): 5’- GCCTCCTGGAAATGCACAAATGTC -3’

Frazz(R): 5’- TCAGACCTTGAAATGCCACTGCC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               8

 

Primers for sequencing

Frazz_seq(F): 5'- TGTCAAGGTCATCTGACAGGC -3'

Frazz_seq(R): 5'- GCATGGCTTCCAGAAACTTC -3'

 

The following sequence of 418 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome 11, bases 34,148,348 to 34,148,765) is amplified:

 

tcagaccttg aaatgccact gccagggccc tgccagacct gatgtttaag gtttcagtgg
atgggtagca tggcttccag aaacttctac tcctttctgt ctttcagctt ttacaagtct
aattatgtgc aaaagttcca ctactccagg cctgtgcgca ggggcaaggt agacccagag
aacgagtttg ctgtgagtat aatcccctcc tcagccatct tcagcaacca gaacacacct
ctgccaacca caggtggggg cagcttgatc cagagccagg gagtgaatac tacatggaca
tcccagatag ggtgacaagt ctactgggtc ttctcatttt ttgaggtttg taagatgtaa
gagggctgcc tgtcagatga ccttgacagc caaggacatt tgtgcatttc caggaggc

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References

  1. Cote, J. F. and Vuori, K. (2002) Identification of an evolutionarily conserved superfamily of DOCK180-related proteins with guanine nucleotide exchange activity, J Cell Sci. 115, 4901-4913.

  2. Meller, N., Irani-Tehrani, M., Kiosses, W. B., Del Pozo, M. A., and Schwartz, M. A. (2002) Zizimin1, a novel Cdc42 activator, reveals a new GEF domain for Rho proteins, Nat. Cell Biol. 4, 639-647.

  3. Meller, N., Merlot, S., and Guda, C. (2005) CZH proteins: a new family of Rho-GEFs, J Cell Sci. 118, 4937-4946.

  4. Cote, J. F. and Vuori, K. (2007) GEF what? Dock180 and related proteins help Rac to polarize cells in new ways, Trends Cell Biol. 17, 383-393.

  5. Brugnera, E., Haney, L., Grimsley, C., Lu, M., Walk, S. F., Tosello-Trampont, A. C., Macara, I. G., Madhani, H., Fink, G. R., and Ravichandran, K. S. (2002) Unconventional Rac-GEF activity is mediated through the Dock180-ELMO complex, Nat. Cell Biol. 4, 574-582.

  6. Miyamoto, Y., Yamauchi, J., Sanbe, A., and Tanoue, A. (2007) Dock6, a Dock-C subfamily guanine nucleotide exchanger, has the dual specificity for Rac1 and Cdc42 and regulates neurite outgrowth, Exp. Cell Res. 313, 791-804.

  7. Rossman, K. L., Der, C. J., and Sondek, J. (2005) GEF means go: turning on RHO GTPases with guanine nucleotide-exchange factors, Nat. Rev. Mol. Cell Biol. 6, 167-180.

  8. Watabe-Uchida, M., John, K. A., Janas, J. A., Newey, S. E., and Van, A. L. (2006) The Rac activator DOCK7 regulates neuronal polarity through local phosphorylation of stathmin/Op18, Neuron 51, 727-739.

  9. Namekata, K., Enokido, Y., Iwasawa, K., and Kimura, H. (2004) MOCA induces membrane spreading by activating Rac1, J Biol. Chem. 279, 14331-14337.

  10. Meller, N., Irani-Tehrani, M., Ratnikov, B. I., Paschal, B. M., and Schwartz, M. A. (2004) The novel Cdc42 guanine nucleotide exchange factor, zizimin1, dimerizes via the Cdc42-binding CZH2 domain, J Biol. Chem. 279, 37470-37476.

  11. Yang, J., Zhang, Z., Roe, S. M., Marshall, C. J., and Barford, D. (2009) Activation of Rho GTPases by DOCK Exchange Factors is Mediated by a Nucleotide Sensor. Science. 325, 1398-1402.

  12. Merithew, E. and Lambright, D. G. (2002) Calculating the potential of C2 domains for membrane binding, Dev. Cell 2, 132-133.

  13. Cote, J. F., Motoyama, A. B., Bush, J. A., and Vuori, K. (2005) A novel and evolutionarily conserved PtdIns(3,4,5)P3-binding domain is necessary for DOCK180 signalling, Nat. Cell Biol. 7, 797-807.

  14. Kunisaki, Y., Nishikimi, A., Tanaka, Y., Takii, R., Noda, M., Inayoshi, A., Watanabe, K., Sanematsu, F., Sasazuki, T., Sasaki, T., and Fukui, Y. (2006) DOCK2 is a Rac Activator that Regulates Motility and Polarity during Neutrophil Chemotaxis. J. Cell Biol.. 174, 647-652.

  15. Kanai, A., Ihara, S., Ohdaira, T., Shinohara-Kanda, A., Iwamatsu, A., and Fukui, Y. (2008) Identification of DOCK4 and its Splicing Variant as PIP3 Binding Proteins. IUBMB Life. 60, 467-472.

  16. Meller, N., Westbrook, M. J., Shannon, J. D., Guda, C., and Schwartz, M. A. (2008) Function of the N-terminus of zizimin1: autoinhibition and membrane targeting, Biochem. J 409, 525-533.

  17. Premkumar, L., Bobkov, A. A., Patel, M., Jaroszewski, L., Bankston, L. A., Stec, B., Vuori, K., Cote, J. F., and Liddington, R. C. (2010) Structural Basis of Membrane Targeting by the Dock180 Family of Rho Family Guanine Exchange Factors (Rho-GEFs). J. Biol. Chem.. 285, 13211-13222.

  18. Sanui, T., Inayoshi, A., Noda, M., Iwata, E., Stein, J. V., Sasazuki, T., and Fukui, Y. (2003) DOCK2 Regulates Rac Activation and Cytoskeletal Reorganization through Interaction with ELMO1. Blood. 102, 2948-2950.

  19. Grimsley, C. M., Kinchen, J. M., Tosello-Trampont, A. C., Brugnera, E., Haney, L. B., Lu, M., Chen, Q., Klingele, D., Hengartner, M. O., and Ravichandran, K. S. (2004) Dock180 and ELMO1 Proteins Cooperate to Promote Evolutionarily Conserved Rac-Dependent Cell Migration. J. Biol. Chem.. 279, 6087-6097.

  20. Hiramoto, K., Negishi, M., and Katoh, H. (2006) Dock4 is Regulated by RhoG and Promotes Rac-Dependent Cell Migration. Exp. Cell Res.. 312, 4205-4216.

  21. Komander, D., Patel, M., Laurin, M., Fradet, N., Pelletier, A., Barford, D., and Cote, J. F. (2008) An Alpha-Helical Extension of the ELMO1 Pleckstrin Homology Domain Mediates Direct Interaction to DOCK180 and is Critical in Rac Signaling. Mol. Biol. Cell. 19, 4837-4851.

  22. Lu, M., Kinchen, J. M., Rossman, K. L., Grimsley, C., deBakker, C., Brugnera, E., Tosello-Trampont, A. C., Haney, L. B., Klingele, D., Sondek, J., Hengartner, M. O., and Ravichandran, K. S. (2004) PH Domain of ELMO Functions in Trans to Regulate Rac Activation Via Dock180. Nat. Struct. Mol. Biol.. 11, 756-762.

  23. Lu, M., Kinchen, J. M., Rossman, K. L., Grimsley, C., Hall, M., Sondek, J., Hengartner, M. O., Yajnik, V., and Ravichandran, K. S. (2005) A Steric-Inhibition Model for Regulation of Nucleotide Exchange Via the Dock180 Family of GEFs. Curr. Biol.. 15, 371-377.

  24. Janardhan, A., Swigut, T., Hill, B., Myers, M. P., and Skowronski, J. (2004) HIV-1 Nef Binds the DOCK2-ELMO1 Complex to Activate Rac and Inhibit Lymphocyte Chemotaxis. PLoS Biol.. 2, E6.

  25. Kobayashi, S., Shirai, T., Kiyokawa, E., Mochizuki, N., Matsuda, M., and Fukui, Y. (2001) Membrane Recruitment of DOCK180 by Binding to PtdIns(3,4,5)P3. Biochem. J.. 354, 73-78.

  26. Nishikimi, A., Fukuhara, H., Su, W., Hongu, T., Takasuga, S., Mihara, H., Cao, Q., Sanematsu, F., Kanai, M., Hasegawa, H., Tanaka, Y., Shibasaki, M., Kanaho, Y., Sasaki, T., Frohman, M. A., and Fukui, Y. (2009) Sequential Regulation of DOCK2 Dynamics by Two Phospholipids during Neutrophil Chemotaxis. Science. 324, 384-387.

  27. Nishihara, H., Maeda, M., Oda, A., Tsuda, M., Sawa, H., Nagashima, K., and Tanaka, S. (2002) DOCK2 Associates with CrkL and Regulates Rac1 in Human Leukemia Cell Lines. Blood. 100, 3968-3974.

  28. Nishihara, H., Kobayashi, S., Hashimoto, Y., Ohba, F., Mochizuki, N., Kurata, T., Nagashima, K., and Matsuda, M. (1999) Non-Adherent Cell-Specific Expression of DOCK2, a Member of the Human CDM-Family Proteins. Biochim. Biophys. Acta. 1452, 179-187.

  29. Fukui, Y., Hashimoto, O., Sanui, T., Oono, T., Koga, H., Abe, M., Inayoshi, A., Noda, M., Oike, M., Shirai, T., and Sasazuki, T. (2001) Haematopoietic Cell-Specific CDM Family Protein DOCK2 is Essential for Lymphocyte Migration. Nature. 412, 826-831.

  30. Kikuchi, T., Kubonishi, S., Shibakura, M., Namba, N., Matsui, T., Fukui, Y., Tanimoto, M., and Katayama, Y. (2008) Dock2 Participates in Bone Marrow Lympho-Hematopoiesis. Biochem. Biophys. Res. Commun.. 367, 90-96.

  31. Cimino, P. J., Sokal, I., Leverenz, J., Fukui, Y., and Montine, T. J. (2009) DOCK2 is a Microglial Specific Regulator of Central Nervous System Innate Immunity found in Normal and Alzheimer's Disease Brain. Am. J. Pathol.. 175, 1622-1630.

  32. Katoh, H., and Negishi, M. (2003) RhoG Activates Rac1 by Direct Interaction with the Dock180-Binding Protein Elmo. Nature. 424, 461-464.

  33.deBakker, C. D., Haney, L. B., Kinchen, J. M., Grimsley, C., Lu, M., Klingele, D., Hsu, P. K., Chou, B. K., Cheng, L. C., Blangy, A., Sondek, J., Hengartner, M. O., Wu, Y. C., and Ravichandran, K. S. (2004) Phagocytosis of Apoptotic Cells is Regulated by a UNC-73/TRIO-MIG-2/RhoG Signaling Module and Armadillo Repeats of CED-12/ELMO. Curr. Biol.. 14, 2208-2216.

  34. Wang, L., Nishihara, H., Kimura, T., Kato, Y., Tanino, M., Nishio, M., Obara, M., Endo, T., Koike, T., and Tanaka, S. (2010) DOCK2 Regulates Cell Proliferation through Rac and ERK Activation in B Cell Lymphoma. Biochem. Biophys. Res. Commun.. 395, 111-115.

  35. Jaffe, A. B. and Hall, A. (2005) Rho GTPases: biochemistry and biology, Annu. Rev. Cell Dev. Biol. 21, 247-269.

  36. Hasegawa, H., Kiyokawa, E., Tanaka, S., Nagashima, K., Gotoh, N., Shibuya, M., Kurata, T., and Matsuda, M. (1996) DOCK180, a Major CRK-Binding Protein, Alters Cell Morphology upon Translocation to the Cell Membrane. Mol. Cell. Biol.. 16, 1770-1776.

  37. Wu, Y. C., and Horvitz, H. R. (1998) C. Elegans Phagocytosis and Cell-Migration Protein CED-5 is Similar to Human DOCK180. Nature. 392, 501-504.

  38. Erickson, M. R., Galletta, B. J., and Abmayr, S. M. (1997) Drosophila Myoblast City Encodes a Conserved Protein that is Essential for Myoblast Fusion, Dorsal Closure, and Cytoskeletal Organization. J. Cell Biol.. 138, 589-603.

  39. Reif, K., and Cyster, J. (2002) The CDM Protein DOCK2 in Lymphocyte Migration. Trends Cell Biol.. 12, 368-373.

  40. Roberts, A. W., Kim, C., Zhen, L., Lowe, J. B., Kapur, R., Petryniak, B., Spaetti, A., Pollock, J. D., Borneo, J. B., Bradford, G. B., Atkinson, S. J., Dinauer, M. C., and Williams, D. A. (1999) Deficiency of the Hematopoietic Cell-Specific Rho Family GTPase Rac2 is Characterized by Abnormalities in Neutrophil Function and Host Defense. Immunity. 10, 183-196.

  41. Croker, B. A., Tarlinton, D. M., Cluse, L. A., Tuxen, A. J., Light, A., Yang, F. C., Williams, D. A., and Roberts, A. W. (2002) The Rac2 Guanosine Triphosphatase Regulates B Lymphocyte Antigen Receptor Responses and Chemotaxis and is Required for Establishment of B-1a and Marginal Zone B Lymphocytes. J. Immunol.. 168, 3376-3386.

  42. Croker, B. A., Handman, E., Hayball, J. D., Baldwin, T. M., Voigt, V., Cluse, L. A., Yang, F. C., Williams, D. A., and Roberts, A. W. (2002) Rac2-Deficient Mice Display Perturbed T-Cell Distribution and Chemotaxis, but Only Minor Abnormalities in T(H)1 Responses. Immunol. Cell Biol.. 80, 231-240.

  43. Walmsley, M. J., Ooi, S. K., Reynolds, L. F., Smith, S. H., Ruf, S., Mathiot, A., Vanes, L., Williams, D. A., Cancro, M. P., and Tybulewicz, V. L. (2003) Critical Roles for Rac1 and Rac2 GTPases in B Cell Development and Signaling. Science. 302, 459-462.

  44. Benvenuti, F., Hugues, S., Walmsley, M., Ruf, S., Fetler, L., Popoff, M., Tybulewicz, V. L., and Amigorena, S. (2004) Requirement of Rac1 and Rac2 Expression by Mature Dendritic Cells for T Cell Priming. Science. 305, 1150-1153.

  45. Gotoh, K., Tanaka, Y., Nishikimi, A., Inayoshi, A., Enjoji, M., Takayanagi, R., Sasazuki, T., and Fukui, Y. (2008) Differential Requirement for DOCK2 in Migration of Plasmacytoid Dendritic Cells Versus Myeloid Dendritic Cells. Blood. 111, 2973-2976.

  46. Nombela-Arrieta, C., Lacalle, R. A., Montoya, M. C., Kunisaki, Y., Megias, D., Marques, M., Carrera, A. C., Manes, S., Fukui, Y., Martinez-A, C., and Stein, J. V. (2004) Differential Requirements for DOCK2 and Phosphoinositide-3-Kinase Gamma during T and B Lymphocyte Homing. Immunity. 21, 429-441.

  47. Stein, J. V., and Nombela-Arrieta, C. (2005) Chemokine Control of Lymphocyte Trafficking: A General Overview. Immunology. 116, 1-12.

  48. Sanui, T., Inayoshi, A., Noda, M., Iwata, E., Oike, M., Sasazuki, T., and Fukui, Y. (2003) DOCK2 is Essential for Antigen-Induced Translocation of TCR and Lipid Rafts, but Not PKC-Theta and LFA-1, in T Cells. Immunity. 19, 119-129.

  49. Kunisaki, Y., Tanaka, Y., Sanui, T., Inayoshi, A., Noda, M., Nakayama, T., Harada, M., Taniguchi, M., Sasazuki, T., and Fukui, Y. (2006) DOCK2 is Required in T Cell Precursors for Development of Valpha14 NK T Cells. J. Immunol.. 176, 4640-4645.

  50. Lei, Y., Liu, C., Saito, F., Fukui, Y., and Takahama, Y. (2009) Role of DOCK2 and DOCK180 in Fetal Thymus Colonization. Eur. J. Immunol.. 39, 2695-2702.

  51. Jiang, H., Pan, F., Erickson, L. M., Jang, M. S., Sanui, T., Kunisaki, Y., Sasazuki, T., Kobayashi, M., and Fukui, Y. (2005) Deletion of DOCK2, a Regulator of the Actin Cytoskeleton in Lymphocytes, Suppresses Cardiac Allograft Rejection. J. Exp. Med.. 202, 1121-1130.

  52. Tanaka, Y., Hamano, S., Gotoh, K., Murata, Y., Kunisaki, Y., Nishikimi, A., Takii, R., Kawaguchi, M., Inayoshi, A., Masuko, S., Himeno, K., Sasazuki, T., and Fukui, Y. (2007) T Helper Type 2 Differentiation and Intracellular Trafficking of the Interleukin 4 Receptor-Alpha Subunit Controlled by the Rac Activator Dock2. Nat. Immunol.. 8, 1067-1075.

  53. Gotoh, K., Tanaka, Y., Nishikimi, A., Nakamura, R., Yamada, H., Maeda, N., Ishikawa, T., Hoshino, K., Uruno, T., Cao, Q., Higashi, S., Kawaguchi, Y., Enjoji, M., Takayanagi, R., Kaisho, T., Yoshikai, Y., and Fukui, Y. (2010) Selective Control of Type I IFN Induction by the Rac Activator DOCK2 during TLR-Mediated Plasmacytoid Dendritic Cell Activation. J. Exp. Med.. .

  54. Siegal, F. P., Kadowaki, N., Shodell, M., Fitzgerald-Bocarsly, P. A., Shah, K., Ho, S., Antonenko, S., and Liu, Y. J. (1999) The Nature of the Principal Type 1 Interferon-Producing Cells in Human Blood. Science. 284, 1835-1837.

  55. Liu, Y. J. (2005) IPC: Professional Type 1 Interferon-Producing Cells and Plasmacytoid Dendritic Cell Precursors. Annu. Rev. Immunol.. 23, 275-306.

  56. Swiecki, M., and Colonna, M. (2010) Unraveling the Functions of Plasmacytoid Dendritic Cells during Viral Infections, Autoimmunity, and Tolerance. Immunol. Rev.. 234, 142-162.

  57. Kawai, T., and Akira, S. (2007) TLR Signaling. Semin. Immunol.. 19, 24-32.

  58. Kawai, T., Sato, S., Ishii, K. J., Coban, C., Hemmi, H., Yamamoto, M., Terai, K., Matsuda, M., Inoue, J., Uematsu, S., Takeuchi, O., and Akira, S. (2004) Interferon-Alpha Induction through Toll-Like Receptors Involves a Direct Interaction of IRF7 with MyD88 and TRAF6. Nat. Immunol.. 5, 1061-1068.

  59. Shinohara, M. L., Lu, L., Bu, J., Werneck, M. B., Kobayashi, K. S., Glimcher, L. H., and Cantor, H. (2006) Osteopontin Expression is Essential for Interferon-Alpha Production by Plasmacytoid Dendritic Cells. Nat. Immunol. 7, 498-506.

  60. de Silva, M. G., Elliott, K., Dahl, H. H., Fitzpatrick, E., Wilcox, S., Delatycki, M., Williamson, R., Efron, D., Lynch, M., and Forrest, S. (2003) Disruption of a novel member of a sodium/hydrogen exchanger family and DOCK3 is associated with an attention deficit hyperactivity disorder-like phenotype, J Med. Genet 40, 733-740.

  61. Engelhardt, K. R., McGhee, S., Winkler, S., Sassi, A., Woellner, C., Lopez-Herrera, G., Chen, A., Kim, H. S., Lloret, M. G., Schulze, I., Ehl, S., Thiel, J., Pfeifer, D., Veelken, H., Niehues, T., Siepermann, K., Weinspach, S., Reisli, I., Keles, S., Genel, F., Kutukculer, N., Camcioglu, Y., Somer, A., Karakoc-Aydiner, E., Barlan, I., Gennery, A., Metin, A., Degerliyurt, A., Pietrogrande, M. C., Yeganeh, M., Baz, Z., Al-Tamemi, S., Klein, C., Puck, J. M., Holland, S. M., McCabe, E. R., Grimbacher, B., and Chatila, T. A. (2009) Large Deletions and Point Mutations Involving the Dedicator of Cytokinesis 8 (DOCK8) in the Autosomal-Recessive Form of Hyper-IgE Syndrome. J. Allergy Clin. Immunol.. 124, 1289-302.e4.

  62. Zhang, Q., Davis, J. C., Lamborn, I. T., Freeman, A. F., Jing, H., Favreau, A. J., Matthews, H. F., Davis, J., Turner, M. L., Uzel, G., Holland, S. M., and Su, H. C. (2009) Combined Immunodeficiency Associated with DOCK8 Mutations. N. Engl. J. Med.. 361, 2046-2055.

  63. Zipp, F., and Aktas, O. (2006) The Brain as a Target of Inflammation: Common Pathways Link Inflammatory and Neurodegenerative Diseases. Trends Neurosci.. 29, 518-527.

  64. Ambruso, D. R., Knall, C., Abell, A. N., Panepinto, J., Kurkchubasche, A., Thurman, G., Gonzalez-Aller, C., Hiester, A., deBoer, M., Harbeck, R. J., Oyer, R., Johnson, G. L., and Roos, D. (2000) Human Neutrophil Immunodeficiency Syndrome is Associated with an Inhibitory Rac2 Mutation. Proc. Natl. Acad. Sci. U. S. A.. 97, 4654-4659.

  65. MacLennan, I. C., Toellner, K. M., Cunningham, A. F., Serre, K., Sze, D. M., Zuniga, E., Cook, M. C., and Vinuesa, C. G. (2003) Extrafollicular Antibody Responses. Immunol. Rev.. 194, 8-18.

  66. King, C., Tangye, S. G., and Mackay, C. R. (2008) T Follicular Helper (TFH) Cells in Normal and Dysregulated Immune Responses. Annu. Rev. Immunol.. 26, 741-766.

  67. Vos, Q., Lees, A., Wu, Z. Q., Snapper, C. M., and Mond, J. J. (2000) B-Cell Activation by T-Cell-Independent Type 2 Antigens as an Integral Part of the Humoral Immune Response to Pathogenic Microorganisms. Immunol. Rev.. 176, 154-170.

  68. Alugupalli, K. R. (2008) A Distinct Role for B1b Lymphocytes in T Cell-Independent Immunity. Curr. Top. Microbiol. Immunol.. 319, 105-130.

  69. Guinamard, R., Okigaki, M., Schlessinger, J., and Ravetch, J. V. (2000) Absence of Marginal Zone B Cells in Pyk-2-Deficient Mice Defines their Role in the Humoral Response. Nat. Immunol.. 1, 31-36.

  70. Girkontaite, I., Missy, K., Sakk, V., Harenberg, A., Tedford, K., Potzel, T., Pfeffer, K., and Fischer, K. D. (2001) Lsc is Required for Marginal Zone B Cells, Regulation of Lymphocyte Motility and Immune Responses. Nat. Immunol.. 2, 855-862.