Phenotypic Mutation 'gingame'

• Allele: gingame
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 41,647,895 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Trpv5
• Gene Name: transient receptor potential cation channel, subfamily V, member 5
• Synonym(s): CaT2, ECaC1
• Chromosomal Location: 41,629,107-41,657,703 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transient receptor family and the TrpV subfamily. The calcium-selective channel encoded by this gene has 6 transmembrane-spanning domains, multiple potential phosphorylation sites, an N-linked glycosylation site, and 5 ANK repeats. This protein forms homotetramers or heterotetramers and is activated by a low internal calcium level. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous mutant mice exhibit increased calcium excretion and reduced bone thickenss. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Glutamic Acid
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P69744
• SMART Domains: Protein: ENSMUSP00000031901; Gene: ENSMUSG00000036899; AA Change: V306E

Domain	Start	End	E-Value	Type
Blast:ANK	38	68	1e-7	BLAST
ANK	72	102	2.3e0	SMART
ANK	110	139	4.56e-4	SMART
ANK	156	185	1.85e-4	SMART
Blast:ANK	189	217	3e-10	BLAST
ANK	232	261	3.07e2	SMART
Pfam:Ion_trans	321	583	1.8e-19	PFAM
low complexity region	676	691	N/A	INTRINSIC
low complexity region	708	719	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000031901)
• SMART Domains: Protein: ENSMUSP00000141421; Gene: ENSMUSG00000036899; AA Change: V257E

Domain	Start	End	E-Value	Type
Blast:ANK	38	68	1e-7	BLAST
ANK	72	102	1.5e-2	SMART
ANK	110	139	2.8e-6	SMART
ANK	156	185	1.2e-6	SMART
Blast:ANK	189	217	4e-10	BLAST
transmembrane domain	274	296	N/A	INTRINSIC
Pfam:Ion_trans	335	522	2.7e-12	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	659	670	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000193503)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.114)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Sperm, gDNA
• MMRRC Submission: 036516-MU
• Last Updated: 2016-11-10 11:53 AM by Anne Murray
• Record Created: 2010-08-10 7:26 PM by Wataru Tomisato
• Record Posted: 2013-03-05
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Victoria Webster
• Authors: Wataru Tomisato, Katharina Brandl, Bruce Beutler

Accession Number

Ncbi Refseq: NM_001007572.2; MGI:2429764

Alleles Listed at MGI

All alleles(2) : Targeted(2)

Phenotypic Description

Figure 1. The gingame mouse was susceptible to low doses of DSS (1%).

The gingame phenotype was identified among ENU-mutagenized G3 mice in a screen for mutants with susceptibility to dextran sulfate sodium (DSS)-induced colitis (Figure 1).  The screen uses weight-loss as an indication of colitis. The gingame mouse were susceptible to low doses of DSS (1%) and showed bleeding, diarrhea, and severe weight loss.   Further observation determined that the gingame mice are polyuric, subsequently leading to polydipsia, an increase in uptake of the water with the DSS, and the phenotype observed in the screen.

Nature of Mutation

The gingame mutation was mapped using bulk segregation analysis (BSA) of F2 backcross offspring using C57BL/10J as the mapping strain.  The mutation showed strongest linkage with marker B10SNPSG0061 at position 67742189 bp on Chromsome 6 (synthetic LOD=5.6).  Whole genome SOLiD sequencing of a homozygous gingame mouse and validation by capillary sequencing identified an T to A transversion at base pair 426047032, 27.1 Mb from the marker of peak linkage, on Chromosome 6 in the Genbank genomic region NC_000072 encoding Trpv5.  The mutation corresponds to residue 1031 in exon 8 of 15.

1018 GAACAGACCCCAGTGAAGGAGCTGGTG

302  -E--Q--T--P--V--K--E--L--V-

The mutated nucleotide is indicated in red lettering, and results in substitution of valine (V) 306 with a glutamic acid (E) in the encoded protein.

Protein Prediction

Figure 4. Domain structure of mouse TRPV5. The six ankyrin repeats are shown in green. The six transmembrane helices are shown in yellow with the proposed pore forming region between helices 5 and 6. TRPV5 interacts with S100A10 at aa 591-595 and a TRP box is C-terminal to the last transmembrane domain. Two regions that are involved in Ca 2+ -dependent inactivation are at 643-646 and 693-723 at the C-terminus. The gingame mutation (V306E) is between the last ankyrin repeat and the first transmembrane domain (see Figure 2 ) and is denoted by an asterisk. Abbreviations: EC, extracellular; Cyt, cytoplasmic; IM, intermembrane; TRP, TRP box.

Figure 5. Schematic illustration of TRPV5 membrane topology. The gingame mutation occurs within the cytoplasmic domain, and is indicated by the red asterisk; the structures in the illustration are color coordinated with the protein domain diagram in Figure 3 . The protein is N -glycosylated on the first extracellular loop of the transmembrane domain. The majority of the TRPV5 structure has not been solved crystallographically, however, the cytoplasmic ankyrin repeat (of TRPV6, a highly homologous TRPV protein to TRPV5 (see text)) has been solved, and is represented using PyMol, based on PDB: 2RFA; ( 16 ) .

Transient receptor potential (TRP) cation channel, subfamily V, member 5 (Trpv5) belongs to the transient receptor (TC 1.A.4) family, the TRPV subfamily and the TRPV5 sub-subfamily. Like the other transient receptor potential (TRP) family members (e.g. TRPV6), the 723 amino acid Trpv5 protein (TRPV5) has large intracellular N- and C-terminal tails as well as six transmembrane (TM)-spanning domains, with a putative hydrophobic, pore-forming region between the fifth and sixth domains (aa 517-539) (1-3) (Figure 4 & 5).  Permeation of the channel by Ca²⁺ is essential for the proper functioning of TRPV5 in Ca²⁺ (re)absorption in the kidney, intestine and placenta (4).  The first 38 residues of the N-terminus are essential for TRPV5 activity as well as for efficient trafficking out of the endoplasmic reticulum (ER) and golgi (5).  Residues 64-77 in the N-terminal tail are essential for channel assembly and tetramerization (6;7).  In addition, the protein has six putative protein kinase C (PKC) phosphorylation sites as well as protein kinase A (PKA) and Ca²⁺/calmodulin-activating kinase II phosphorylation sites (8-11). PKC has been shown to upregulate TRPV5 through an alteration of channel properties (i.e. single channel open probability) and/or channel trafficking (12).  Activation of TRPV5 by PKC can inhibit caveolin-dependent endocytosis of TRPV5, causing accumulation of TRPV5 at the cell surface (12).  PKC-mediated phosphorylation (Ser299, Ser654) is essential not only for hormone-triggered phosphorylation of TRPV5, but is also necessary for tissue kallikrein-mediated TRPV5 stimulation (5;10).  Kallikrein is a kidney protease that releases kinin to stimulate Ca²⁺ reabsorption through a PKC-dependent plasma membrane accumulation of TRPV5 (10).  Activation of PKC following kallikrein application to cells regulates the balance between constitutive exocytosis and endocytosis, favoring exocytosis (13).  PKC-dependent phosphorylation of TRPV5 may also lead to an activation of motor proteins that transport TRPV5 to the plasma membrane (13).  These effects lead to an accumulation of TRPV5 at the cell surface.

TRPV5 and TRPV6 originate from two genes that are juxtaposed on mouse chromosome 6 and the proteins share a 75% homology; the main differences between the two proteins can be found within the N and C-termini (1;14;15). Similar to other TRPV channels, TRPV5 and TRPV6 have six-repeat ankyrin repeat domains at the N-terminal cytosolic domain (16). The crystal structure of the mouse TRPV6 ankyrin repeats has been solved [PDB #2RFA; illustrated in Figure 5; (16)].  The repeats are anti-parallel inner and outer α-helices and the helices are joined by finger loops (16).  In addition there is a twist between repeats ANK1-4 and ANK5-6 caused by conserved TRPV substitutions in the ankyrin repeat consensus (16). Only four of the ankyrin repeats in TRPV5 have been delineated (aa 72-101, 110-149, 156-185, 232-261).  The ankyrin repeats maintain the activity of the channel, the interaction of TRPV5 with other proteins or itself, and the targeting of TRPV5 to the plasma membrane (1;9;10;17;18). Ankyrin repeat 1 (aa 72-101) of TRPV5 has been implicated in channel assembly (16).  In TRPV6, the ankyrin repeat region(s) within aa 116-191 has been shown to be sufficient to enable self-interaction and functional subunit assembly (6;19). The ankyrin repeat has been proposed to initiate a molecular zippering process that proceeds past the last ankyrin repeat to create an anchor for subunit assembly (7;19). Interestingly, evidence suggests that this region in TRPV6 is involved in TRPV5 channel assembly (6;7).  A TRPV5 construct that contains only residues 11-267 (residues surrounding all four ankyrin repeats) binds calmodulin (CaM) (16).  CaM is a cytoplasmic protein that regulates the biological activities of proteins and ion transporters, often in a Ca²⁺-dependent manner, although Ca²⁺-CaM had no effect on TRPV5 activity in the 11-287 TRPV5 construct (20).  Another study found that there are CaM binding sites within the 1-327 region of the N-terminus as well as the 578-730 region of the C-terminus (21).  

Within the transmembrane domain of TRPV5 there are two important areas that are essential for the proper functioning of TRPV5.  The first is three residues within the intracellular loop between TM2 and TM3 (aa 409, 411, and 412) are essential for the initial inactivation kinetics of TRPV5 (9)(9). In addition to these essential residues, TRPV5 is Asn (N)-linked glycosylated at N358 within the extracellular loop between the first and second TM segments and is necessary for Klotho-mediated stimulation of TRPV5 (17;22). Klotho is a member of the β-glucuronidase family of enzymes that catalyze the breakdown of complex carbohydrates.  In cells that had N358 mutated to a glutamine, Ca²⁺ influx was no different than in cells that expressed the wild-type protein (17;22). However, it was found that glycosylation is necessary for accumulation of TRPV5 at the plasma membrane (17).  It is speculated that Klotho-mediated accumulation of TRPV5 is mediated by a hydrolysis of extracellular sugar (i.e. terminal 2,6-sialic acids) from TRPV5 (13;17;23).  Once the terminal sialic acids are removed, the underlying disaccharide N-acetyllactosamine (LacNAc) is exposed to galectin-1 (23).  It is binding of the galectin-1 that leads to accumulation of TRPV5 at the plasma membrane (23).                          

The C-terminus of TRPV5 has several important motifs.  Similar to other TRP family members, TRPV proteins contain a TRP box (a 6-amino acid motif) and a proline-rich sequence within a TRP domain located after the sixth TM segment (14;24). The TRP domain is a short hydrophobic segment that is necessary for phosphatidylinositol 4,5-bisphosphate (PIP₂) binding (a ubiquitously expressed phospholipid that is a regulator of channel function). The TRP box is proposed to be a coiled-coil zipper that regulates TRPV channel gating (keeping it in a closed conformation) (5;14;24;25).  There are two regions within the cytoplasmic C-terminus that are involved in Ca²⁺-dependent inactivation of TRPV5 (aa 643-646, 693-723) (26).  These sites may interact with proteins that are necessary for inactivation. C-terminal residues 596-601 are essential for channel assembly and trafficking of TRPV5 (6;19). The C-terminal PDZ (PSD95/Discs-large/ZO-1) binding motif of TRPV5 interacts with the PDZ domain of NHERF2 (Na⁺/H⁺ exchanger regulatory factor 2) functioning to link TRPV5 to cytoskeletal proteins as well as targeting and stabilizing TRPV5 at the cell membrane (18). Furthermore, TRVP5 contains a putative serum- and glucocorticoid-inducible kinase (SGK1) phosphorylation site, allowing for SGK1-dependent stimulation of activity (18).   SGK1 is transcriptionally upregulated by 1,25-dihydroxyvitamin D3 (1,25(OH)₂D3), a vitamin D metabolite that also regulates TRPV5 (through its NHERF2 interaction) and is involved in several functions within the cell including regulation of transport, hormone release, neuroexcitability, inflammation, coagulation, cell proliferation and apoptosis (18;27). SGK1 may act to increase the abundance of TRPV5 in the membrane (18).

TRPV5 can interact with several proteins to regulate its function and/or trafficking.  At aa 591-595, TRPV5 interacts with S100A10 as well as the S100A10/annexin 2 heterotetramer (comprised of a S100A10 dimer and two annexin 2 molecules) to facilitate the trafficking of TRPV5 to the plasma membrane (28).  S100A10 is a member of the S100 family that is generally localized to the cytoskeleton underlying the plasma membrane and participates in membrane trafficking and/or organization (29).  It is unclear whether the association of TRPV5 and S100A10/annexin 2 facilitates the translocation of TRPV5 to the plasma membrane or enhances channel retention (28).  Downregulation of annexin 2 in the S100A10-TRPV5 complex leads to inhibition of currents through TRPV5 (28).  Other proteins that interact with TRPV5 are BSPRY (B-box and SPRY-domain containing protein) and Rab11a (30). BSPRY associates with the C-terminus of TRPV5 (30).  Evaluation of Ca²⁺ influx via TRPV5 after BSPRY co-expression found that influx was inhibited although TRPV5 expression levels were not changed (30). Therefore, BSPRY is thought to be involved in inhibitory signaling cascades that can control the activity of TRPV5 at the cell surface (30).  The TRPV5 C-terminus (aa 595-601) interacts with the GTPase Rab11a to target TRPV5 to the plasma membrane (31).  GDP-bound Rab11a initially interacts with TRPV5 in a cytoplasmic compartment.  During GDP-GTP exchange, Rab11a does not associate with TRPV5.  Finally, the GTP-bound Rab11a mediates transport of TRPV5-containing structures to the plasma membrane (31). TRPV5 and TRPV6 can form homo- and heterotetramers through interactions at both the N- (aa 64-77) and C-termini within the ER before being trafficked to the plasma membrane (1;3;5;32).  The tetrameric TRPV5 and TRPV6 structures can also combine to form heteromultimeric channels that may have novel properties (32). The formation of a tetrameric structure between TRPV5 and TRPV6 generates a negatively charged ring of four aspartate residues (D542) that can function as a Ca²⁺ filter (1;3;4;32;33).

The gingame mutation results in a substitution of valine (V) 306 with a glutamic acid (E).  V306 is within the intracellular N-terminal tail of TRPV5, between the last ankyrin repeat and the first TM domain.

Expression/Localization

RT-PCR, Northern blot, and dot blot analyses detected Trpv5 in kidney, pancreas, testis, prostate, placenta, brain, intestine (including duodenum, jejunum, colon, and rectum), as well as in mammary, sweat, pituitary, and salivary glands (1;15;32;34-37).  The most abundant expression was noted in kidney, duodenum, jejunum, and pancreas (pancreatic islets); lower abundance was observed in testis, prostate, placenta, brain, colon, rectum, trachea, esophagus, and stomach; there was no signal in the ileum or the distal segments of the large intestine (15;36). In addition, Trpv5 was detected in the spinal cord, whole brain, cerebral cortex, caudate nucleus, occipital lobe, putamen, substantia nigra, temporal lobe, and hippocampus in the nervous system (36).  Trpv5 is also expressed in mouse osteoclasts at the ruffled border membrane, the cellular domain that facilitates removal of bone matrix (3;38;39). In the rat intestine, Trpv5 mRNA is expressed in nodose ganglion neurons that express cholecystokinin (CCK) 1 (i.e. interneurons that mediate feedforward inhibition and behavioral fear responses) (40).

Further analysis determined that in the kidney, the TRPV5 protein is localized at the apical domain of kidney distal convoluted and connecting tubular cells (1;13;32;39).  In the intestine, TRPV5 is localized to the apical region of enterocytes (brush border membrane) in the mucosa of the small and large intestine (1;2;41).

TRPV5 forms a heterotetramer with TRPV6 and the proteins are co-expressed in the epithelia of organs that mediate transcellular Ca²⁺ transport such as duodenum, jejunum, colon and kidney (37;42).  They are also co-expressed in other tissues such as pancreas, prostate, mammary gland, sweat gland, and salivary gland (37).  Although they are co-expressed in these tissues, expression levels vary between the two proteins (43).  For example, TRPV5 is the major isoform in the kidney, while TRPV6 is highly expressed in the intestine (1;43).

Background

Ca²⁺ is essential for several processes throughout the body including muscle contraction, bone formation, and neuronal function.  To maintain Ca²⁺ balance, three organ systems work together: the gastrointestinal tract, bone and kidney. More specifically, Ca²⁺ is absorbed by the gastrointestinal tract (~90% through the small intestine; ~10% in the colon), filtered and reabsorbed in the kidney, and stored and released from the bone as needed (1;3;44).  Changes in the rates of renal and intestinal epithelia transport as well as the storage and release from the bone regulate Ca²⁺ balance in the body (3;39).  The efficiency of intestinal Ca²⁺ absorption regulates the availability of dietary Ca²⁺.  An alteration in the vitamin D endocrine system as well as the lipid composition and fluidity of intestinal membranes can increase the intestinal Ca²⁺ absorption rates when dietary Ca²⁺ levels are low (1).  Changes in intestinal Ca²⁺ absorption rates can be observed in several physiological processes including growth, pregnancy and lactation (an increase); a decrease in Ca²⁺ absorption is observed with age (1).  Impaired neural excitability, arrhythmia and altered bone formation can be observed when there is a failure to maintain Ca²⁺ levels in the plasma (3).

The Paracellular and Transcellular Pathways

In the intestine, Ca²⁺ can be absorbed by two mechanisms: a metabolically driven, saturable transport (i.e. the transcellular pathway) or a passive, non-saturable route (i.e. the paracellular pathway) (1).  Factors such as hormones and nutrients regulate both mechanisms (1).  For example, the transcellular pathway is regulated mainly by a vitamin D metabolite 1,25(OH)₂D3 that binds to the nuclear vitamin D receptor, leading to the activation of gene transcription (1).  Under normal conditions, ~90% of Ca²⁺ transport occurs along concentration and electrical gradients via the paracellular pathway through junctional complexes between cells in the jejunum and ileum of the small intestine (1;3;45).  When the demand for Ca²⁺ increases (e.g. during laction, pregnancy, or when dietary Ca²⁺ is low), Ca²⁺ absorption occurs predominantly (~80%) via the transcellular route in enterocytes of the duodenum (3;45).  In the transcellular pathway, Ca²⁺ enters the cell through Ca²⁺ channels (e.g. TRPV5). These channels are involved in regulating several cell functions such as contraction, secretion, gene expression, transepithelial ion transport, osmoregulation, and transduction of painful stimuli (9).  Within the cell of the kidney and intestine, Ca²⁺ is bound to calbindins, carrier proteins that facilitate the diffusion of Ca²⁺ to the basolateral membrane.  Calbindin D is the carrier protein in the enterocyte (calbindin-D_9K in the mouse duodenum) that mediates Ca²⁺ transport either through diffusion or vesicle transport (3;39;45). At the basolateral membrane, the Ca²⁺ is transported into the interstitial fluid by ion exchangers and pumps such as the plasma membrane ATPase (PMCA1b) and the Na⁺/ Ca²⁺ exchanger (NCX1) (3;39;44;45).

The TRP channels

The TRP ion channel family has seven subfamilies: TRP Canonical (TRPC), TRP Melastatin (TRPM), TRP Ankyrin (TRPA), TRP Mucolipin (TRPML), TRP Polycystin (TRPP), TRP NOPMC (TRPN), and TRP Vanilloid (TRPV) (2;3;45;46).  Vertebrates have at least one receptor from each subfamily except for TRPN (47).  These receptor subfamilies respond to several external stimuli such as light (i.e. phototransduction), chemicals and temperature as well as mechanical and osmotic pressures (2;32;48-50).  TRP channels have roles in diverse processes including olfaction, nociception, speech, regulation of blood circulation, pain signal transduction, gut motility, mineral absorption and fluid balance epithelial Ca²⁺ transport, development of airway and bladder hypersensitivities, and cell survival, growth and death (48). The TRP channels function by facilitating the transmembrane flow of cations (i.e. Na⁺ and Ca²⁺) down electrochemical gradients to depolarize the cell as well as to mediate signal transduction (45;47).

TRP channels can be activated through the activation of phospholipase C (PLC) by G protein-coupled receptors and receptor tyrosine kinases.  Activation of PLC leads to hydrolysis of PIP₂, producing diacylglycerol (DAG) and inositol (1,4,5) triphosphate (IP₃).  Strong evidence supports roles for PIP₂ hydrolysis and DAG production in modulating TRP channel activity.  On the other hand, the function of TRP channels as “store-operated calcium entry” channels activated by IP₃-mediated release of intracellular Ca²⁺ stores remains controversial  (47). The TRP channels can also be activated by ligands that range from exogenous small organic molecules (e.g. capsaicin), endogenous lipids or products of lipid metabolism (e.g. DAG), purine nucleotides and their metabolites (e.g. adenosine diphosphoribose (ADP-ribose)), to inorganic ions (e.g. Ca²⁺ and Mg²⁺) (47).  A third mechanism is one of direct TRP channel activation by temperature changes, mechanical stimuli, coupling to IP₃ receptors, cell swelling, channel phosphorylation through protein kinases A, C, and G (PKA, PKC, and PKG, respectively), and Ca²⁺/Calmodulin signaling (47).

Figure 6. TRPV5 function and regulation in active calcium reabsorption in the distal convoluted tubule of the kidney. After gene transcription and translation into protein, TRPV5 channels are assembled into functional tetrameric channels at the apical plasma membrane. Through the Golgi apparatus these channels reach the plasma membrane, where they allow the influx of Ca 2+ . Following Ca 2+ entry through TRPV5, Ca 2+ bound to calbindin-D 28K diffuses to the basolateral side, where it is extruded into the blood compartment through NCX1 and to a lesser extent PMCA1b. Shortly after the arrival of TRPV5 in the plasma membrane, the channels are internalized through dynamin- and clathrin-dependent processes. Internalized TRPV5 first appears in small vesicles after which they enter recycling endosomes or are degraded. Several factors regulate the expression and function of TRPV5 (see Table 1 and the text for details about factors shown in this figure).

TRPV5

The TRPV subfamily has six receptors in mammals (TRPV1—TRPV6), one receptor in C. elegans (Osm-9) and one in Drosophila (Nan) (48;51). The TRPV subfamily members are all Ca²⁺ entry channels that are stimulated by different physical and chemical stimuli (e.g. TRPV1 is gated by capsaicin and heat; TRPV2, heat; TRPV3, heat; TRPV4, cell swelling)  (52).  TRPV5 and TRPV6 are homologous to each other and are the most Ca²⁺ sensitive of the TRP channels (3;45).  TRPV5 and TRPV6 are unique among the other TRP channels in that they are constitutively open, they are more selective for Ca²⁺ than Na⁺, and the current-voltage relationship of the channels shows inward rectification as opposed to outward rectification (1;9;10).

TRPV5 is predominantly involved in the transcellular transport of Ca²⁺ in the distal tubules and loops of Henle in the kidney (3;38;45;53;54).  Once within the cell, the transfer of the Ca²⁺ to the basolateral membrane occurs through an association with calbindin D_28K, and PMCA1b and NCX1 extrude the Ca²⁺ from the tubule cells [Figure 6; (10;45)].   TRPV5, along with TRPV6, is also involved in transcellular intestinal Ca²⁺ reabsorption (2;38;41;53-55).

Regulation

The regulation of TRPV5 can occur at several levels including: alterations at the gene level, trafficking to the cell membrane, the protein abundance at the cell surface, and the channel activity [Table 1; (31)].  TRPV5 can be regulated by dietary conditions (i.e. by Ca²⁺ levels) as well as by hormones (2;41;55;56).  Klotho is a β-glucuronidase that can hydrolyze the extracellular glycan residues on TRPV5 (as mentioned above in Protein Prediction). The modification of the sugar moiety on TRPV5 leads to trapping of the channel in the plasma membrane, leading to maintenance of channel activity and Ca²⁺ permeability (3;10;17;23).  Other hormones such as 1,25(OH)₂D3, parathyroid hormone (PTH), testosterone, and estrogen lead to changes in transcription of Trpv5 (1;3;10;57).  PTH can also stimulate the activation of the protein kinase A (PKA) pathway and subsequent TRPV5-mediated Ca²⁺ transport upon PTH-dependent phosphorylation of TRPV5 (3).  Another role of PTH in TRPV5 regulation is that of inhibiting caveolin-mediated endocytosis of TRPV5, leading to an increase in TRPV5 at the cell surface (3). 

Accessory proteins can regulate TRPV5 activity by either directing TRPV5 trafficking to the plasma membrane (e.g. NHERF2 (Na⁺/H⁺ exchanger regulatory factor 2), NHERF4, Rab11a, WNK4 (with no lysine kinase 4)) or by altering the conformation of the channel at the plasma membrane (10).  BSPRY (B-box and SPRY-domain containing protein), calbindin-D_28K, and FK506-binding protein 52 modulate TRPV5 activity at the plasma membrane (10). 

Alterations in PLC/PKC-dependent signaling as well as in the intra- and extracellular pH can modulate TRPV5 levels at the plasma membrane (10;58-60).

In experimental settings, TRPV5 can be regulated by the dye ruthenium red, which prevents PTH-stimulated Ca²⁺ transport as well as leads to decreased expression of calbindin-D_28K and NCX1; TRVP5 expression was not changed (9;39).

Table 1. Regulation of TRPV5 [adapted from (57)]

	Factor	TRPV5-associated Function	Reference
Hormones	1,25(OH)2D3	Increases gene expression; stimulates TRPV5-dependent Ca2+ transport via activation of the PKA pathway and stimulation of β-glucuronidase release	(32;41;43;50;55;61;62)
	Parathyroid hormone (PTH)	Increases expression of the channel at transcript level; stimulates TRPV5-dependent Ca2+ transport via activation of the PKA pathway and stimulation of β-glucuronidase release; inhibits caveolin-mediated endocytosis	(12;41;50;55;63)
	Estrogen	Increases gene expression	(64)
	Testosterone	Decreases gene expression	(65)
	Insulin	Decreases gene expression	(66)
Accessory proteins	NHERF4 and NHERF2	Directs trafficking to the plasma membrane	(10;18;67)
	Rab11a	Directs trafficking to the plasma membrane and/or cell surface stability	(31;49;68)
	SGK1 (see woolly for SGK3)	Increases activity	(18)
	WNK4	Directs trafficking to the plasma membrane	(67)
	S100SA10-annexin 2	Increases plasma membrane abundance and/or cell surface stability; directs trafficking to the plasma membrane	(28;49;68)
	Clathrin	Increases plasma membrane abundance; mediates TRPV5 internalization	(49)
	Caveolin	Increases plasma membrane abundance	(12)
	BSPRY	Decreases activity	(10;30)
	Calbindin-D28K	Modulates activity at the plasma membrane	(10;69)
	Calmodulin	Ca2+-dependent inactivation	(21;70)
	FK506-binding protein 52 (FKBP52)	Modulates activity at the plasma membrane and  trafficking to the plasma membrane through interaction with dynein	(8;10;13)
	PIP2	Increases activity	(25;71)
	80K-H (Ca2+ sensor)	Increases activity	(68;72)
	Tissue Kallikrein /bradykinin	Increases plasma membrane retention via activation of the bradykinin/DAG/PKC pathway	(10;13;49)
Systemic factors	Klotho-mediated modification of N-linked glycosylation	Increases plasma membrane retention	(13;17;23;49)
	PLC/DAG/PKC signaling (see Untied, Tilcara, and queen)	Increases plasma membrane retention; increases activity	(10;12;73)
	Intra- and extracellular pH	Increases plasma membrane retention; regulates trafficking to the plasma membrane; increases activity	(10;58-60)
	Dietary Ca2+	Decreases activity	(26;32;43;62;74)
	Mg2+	Decreases activity: blocks channel in a voltage-dependent manner	(9;58;71;75)

TRPV5 animal models

The Trpv5 knockout mouse (Trpv5^-/-) had no obvious phenotype, the pups thrived to adulthood and were the same size and weight as wild-type mice (76).  Analysis of urine and serum samples collected from the knockout mice found that the loss of Trpv5 led to polyuria and hypercalciuria as a result of a diminished rate of renal Ca²⁺ reabsorption (especially along the distal convulution, the primary expression site of TRPV5); serum Ca²⁺ levels were normal (3;45;61;76).  Polyuria is a mechanism to reduce the possibility of Ca²⁺ precipitation (76).  Also, there were increased levels of 1,25(OH)₂D3 in the serum and urine acidification (restrains formation of Ca²⁺ oxalate stones in the kidneys)  (3;61;76).  As a result of the hypercalciuria and/or prolonged elevated 1,25(OH)₂D3 levels, the mice have disturbances in bone structure including reduced trabecular and cortical bone thickness (45;76). The Trpv5^-/- mice show a compensatory upregulation of TRPV6 protein expression in the intestine (but not in the kidney), leading to Ca²⁺ hyperabsorption to alleviate the diminished Ca²⁺ levels caused by impaired Ca²⁺ reabsorption in the kidney (2;13;39;56;61;76).  The TRPV5 knockout mice also displayed a decrease in calbindin-D_28K and NCX1 mRNA levels, indicating that TRPV5 and/or Ca²⁺ influx via TRPV5 can control the transcription of other Ca²⁺ transport genes (76). 

Putative Mechanism

The gingame mutation is a T1031A mutation in Trpv5 that results in a V306E amino acid change at the N-terminus of TRPV5.  The N-terminus of TRPV5 is essential for channel assembly, activity, targeting to the plasma membrane and interactions with other TRPV5 molecules to form a homotetrameric complex.  Residue 306 is within a region of the N-terminus that interacts with CaM.  It is possible that a change from the nonpolar valine to a negatively charged glutamic acid residue could alter the ability of CaM to bind to the N-terminus.  However, studies have shown that mutations within the N-terminal CaM-binding motif do not alter the activity of TRPV5 (21). In addition to being within a CaM-binding motif, a mutation at V306 may lead to misfolding of the protein.  The polyuria and polydipsia phenotype mimics that of the Trpv5^-/- mouse (76).

Primers

Primers cannot be located by automatic search.

Genotyping

Gingame genotyping is performed by amplifying the region containing the mutation using PCR followed by sequencing of the amplified region to detect the nucleotide change.  The following primers were used for PCR amplification and sequencing:

Primers for PCR amplification

Gingame (F): 5’-GCAAATGAGCAATGGCTTCTCGAATC-3'

Gingame (R): 5'-TGGAGACAACATCATCATCCC-3'

Primers for sequencing

Gingame_seq (F): 5’-GAATCTTTCTACAGTAGTTCAGTCC-3’

Gingame_seq (R): 5’-GAATTACCTGTAGTGATTTCTGTTCC-3'

PCR program

1) 94°C        2:00

2) 94°C        0:30

3) 57°C        0:30

4) 72°C        1:00

5) repeat steps (2-4) 29x

6) 72°C        7:00

7) 4°C            ∞

The following sequence of 560 nucleotides (from Genbank genomic region: NC_000072.5 of the linear genomic sequence of Trpv5) is amplified; sense strand shown:

9448                              gca aatgagcaat ggcttctcga atctttctac     

9481 agtagttcag tcccctaact actactcatc tattatagac tcaatgttgt tgtatgcgct     

9541 gtgattactt ctgtaatact tctatagcac taccacaaag cctaccatgt aatagaaatg     

9601 aataatttct tatcaaggaa ataagtgctt ggatgatggt gatgatagtt gctgccctgt     

9661 cacctggaat gcagttcaaa cctcaacact gcaaattgtg ttgttcattc tatattgctc     

9721 tttatttctg acaggctcga cagattctag aacagacccc agtgaaggag ctggtgagcc     

9781 tgaagtggaa gaaatatgga cagccttatt tctgcctcct gggtgctctg tacatcttct     

9841 acatggtctg cttcaccaca tgctgtgttt accgccccct caagttccga gatgccaacc     

9901 gtacacatgt tcgagataac accatcatgg aacagaaatc actacaggta attcttcttc     

9961 aaagggatga aagggaatgg tgtcatggga tgatgatgtt gtctcca

PCR primer binding sites are underlined. Sequencing primer binding sites are highlighted; overlapping sequences with the PCR primers are highlighted and underlined; the mutated nucleotide is highlighted in red (T>A on sense strand; A>T on Chr. + strand).

References

  1. Perez, A. V., Picotto, G., Carpentieri, A. R., Rivoira, M. A., Peralta Lopez, M. E., and Tolosa de Talamoni, N. G. (2008) Minireview on Regulation of Intestinal Calcium Absorption. Emphasis on Molecular Mechanisms of Transcellular Pathway. Digestion. 77, 22-34.

  2. Holzer, P. (2011) TRP Channels in the Digestive System. Curr Pharm Biotechnol. 12, 24-34.

  3. Dimke, H., Hoenderop, J. G., and Bindels, R. J. (2011) Molecular Basis of Epithelial Ca2+ and Mg2+ Transport: Insights from the TRP Channel Family. J Physiol. 589, 1535-1542.

  4. Nilius, B., Vennekens, R., Prenen, J., Hoenderop, J. G., Droogmans, G., and Bindels, R. J. (2001) The Single Pore Residue Asp542 Determines Ca2+ Permeation and Mg2+ Block of the Epithelial Ca2+ Channel. J Biol Chem. 276, 1020-1025.

  5. de Groot, T., van der Hagen, E. A., Verkaart, S., te Boekhorst, V. A., Bindels, R. J., and Hoenderop, J. G. (2011) Role of the Transient Receptor Potential Vanilloid 5 (TRPV5) Protein N Terminus in Channel Activity, Tetramerization, and Trafficking. J Biol Chem. 286, 32132-32139.

  6. Chang, Q., Gyftogianni, E., van de Graaf, S. F., Hoefs, S., Weidema, F. A., Bindels, R. J., and Hoenderop, J. G. (2004) Molecular Determinants in TRPV5 Channel Assembly. J Biol Chem. 279, 54304-54311.

  7. van de Graaf, S. F., Hoenderop, J. G., and Bindels, R. J. (2006) Regulation of TRPV5 and TRPV6 by Associated Proteins. Am J Physiol Renal Physiol. 290, F1295-302.

  8. Gkika, D., Topala, C. N., Hoenderop, J. G., and Bindels, R. J. (2006) The Immunophilin FKBP52 Inhibits the Activity of the Epithelial Ca2+ Channel TRPV5. Am J Physiol Renal Physiol. 290, F1253-9.

  9. Nilius, B., Prenen, J., Hoenderop, J. G., Vennekens, R., Hoefs, S., Weidema, A. F., Droogmans, G., and Bindels, R. J. (2002) Fast and Slow Inactivation Kinetics of the Ca2+ Channels ECaC1 and ECaC2 (TRPV5 and TRPV6). Role of the Intracellular Loop Located between Transmembrane Segments 2 and 3. J Biol Chem. 277, 30852-30858.

  10. Topala, C. N., Bindels, R. J., and Hoenderop, J. G. (2007) Regulation of the Epithelial Calcium Channel TRPV5 by Extracellular Factors. Curr Opin Nephrol Hypertens. 16, 319-324.

  11. Heise, N., Palme, D., Misovic, M., Koka, S., Rudner, J., Lang, F., Salih, H. R., Huber, S. M., and Henke, G. (2010) Non-Selective Cation Channel-Mediated Ca2+-Entry and Activation of Ca2+/calmodulin-Dependent Kinase II Contribute to G2/M Cell Cycle Arrest and Survival of Irradiated Leukemia Cells. Cell Physiol Biochem. 26, 597-608.

  12. Cha, S. K., Wu, T., and Huang, C. L. (2008) Protein Kinase C Inhibits Caveolae-Mediated Endocytosis of TRPV5. Am J Physiol Renal Physiol. 294, F1212-21.

  13. Gkika, D., Topala, C. N., Chang, Q., Picard, N., Thebault, S., Houillier, P., Hoenderop, J. G., and Bindels, R. J. (2006) Tissue Kallikrein Stimulates Ca(2+) Reabsorption Via PKC-Dependent Plasma Membrane Accumulation of TRPV5. EMBO J. 25, 4707-4716.

  14. Montell, C. (2005) The TRP Superfamily of Cation Channels. Sci STKE. 2005, re3.

  15. Muller, D., Hoenderop, J. G., Meij, I. C., van den Heuvel, L. P., Knoers, N. V., den Hollander, A. I., Eggert, P., Garcia-Nieto, V., Claverie-Martin, F., and Bindels, R. J. (2000) Molecular Cloning, Tissue Distribution, and Chromosomal Mapping of the Human Epithelial Ca2+ Channel (ECAC1). Genomics. 67, 48-53.

  16. Phelps, C. B., Huang, R. J., Lishko, P. V., Wang, R. R., and Gaudet, R. (2008) Structural Analyses of the Ankyrin Repeat Domain of TRPV6 and Related TRPV Ion Channels. Biochemistry. 47, 2476-2484.

  17. Chang, Q., Hoefs, S., van der Kemp, A. W., Topala, C. N., Bindels, R. J., and Hoenderop, J. G. (2005) The Beta-Glucuronidase Klotho Hydrolyzes and Activates the TRPV5 Channel. Science. 310, 490-493.

  18. Palmada, M., Poppendieck, S., Embark, H. M., van de Graaf, S. F., Boehmer, C., Bindels, R. J., and Lang, F. (2005) Requirement of PDZ Domains for the Stimulation of the Epithelial Ca2+ Channel TRPV5 by the NHE Regulating Factor NHERF2 and the Serum and Glucocorticoid Inducible Kinase SGK1. Cell Physiol Biochem. 15, 175-182.

  19. Erler, I., Hirnet, D., Wissenbach, U., Flockerzi, V., and Niemeyer, B. A. (2004) Ca2+-Selective Transient Receptor Potential V Channel Architecture and Function Require a Specific Ankyrin Repeat. J Biol Chem. 279, 34456-34463.

  20. Holakovska, B., Grycova, L., Bily, J., and Teisinger, J. (2011) Characterization of Calmodulin Binding Domains in TRPV2 and TRPV5 C-Tails. Amino Acids. 40, 741-748.

  21. Lambers, T. T., Weidema, A. F., Nilius, B., Hoenderop, J. G., and Bindels, R. J. (2004) Regulation of the Mouse Epithelial Ca2(+) Channel TRPV6 by the Ca(2+)-Sensor Calmodulin. J Biol Chem. 279, 28855-28861.

  22. Cohen, D. M. (2006) Regulation of TRP Channels by N-Linked Glycosylation. Semin Cell Dev Biol. 17, 630-637.

  23. Cha, S. K., Ortega, B., Kurosu, H., Rosenblatt, K. P., Kuro-O, M., and Huang, C. L. (2008) Removal of Sialic Acid Involving Klotho Causes Cell-Surface Retention of TRPV5 Channel Via Binding to Galectin-1. Proc Natl Acad Sci U S A. 105, 9805-9810.

  24. Valente, P., Garcia-Sanz, N., Gomis, A., Fernandez-Carvajal, A., Fernandez-Ballester, G., Viana, F., Belmonte, C., and Ferrer-Montiel, A. (2008) Identification of Molecular Determinants of Channel Gating in the Transient Receptor Potential Box of Vanilloid Receptor I. FASEB J. 22, 3298-3309.

  25. Rohacs, T., Lopes, C. M., Michailidis, I., and Logothetis, D. E. (2005) PI(4,5)P2 Regulates the Activation and Desensitization of TRPM8 Channels through the TRP Domain. Nat Neurosci. 8, 626-634.

  26. Nilius, B., Weidema, F., Prenen, J., Hoenderop, J. G., Vennekens, R., Hoefs, S., Droogmans, G., and Bindels, R. J. (2003) The Carboxyl Terminus of the Epithelial Ca(2+) Channel ECaC1 is Involved in Ca(2+)-Dependent Inactivation. Pflugers Arch. 445, 584-588.

  27. Lang, F., Strutz-Seebohm, N., Seebohm, G., and Lang, U. E. (2010) Significance of SGK1 in the Regulation of Neuronal Function. J Physiol. 588, 3349-3354.

  28. van de Graaf, S. F., Hoenderop, J. G., Gkika, D., Lamers, D., Prenen, J., Rescher, U., Gerke, V., Staub, O., Nilius, B., and Bindels, R. J. (2003) Functional Expression of the Epithelial Ca(2+) Channels (TRPV5 and TRPV6) Requires Association of the S100A10-Annexin 2 Complex. EMBO J. 22, 1478-1487.

  29. Thiel, C., Osborn, M., and Gerke, V. (1992) The Tight Association of the Tyrosine Kinase Substrate Annexin II with the Submembranous Cytoskeleton Depends on Intact p11- and Ca(2+)-Binding Sites. J Cell Sci. 103 ( Pt 3), 733-742.

  30. van de Graaf, S. F., van der Kemp, A. W., van den Berg, D., van Oorschot, M., Hoenderop, J. G., and Bindels, R. J. (2006) Identification of BSPRY as a Novel Auxiliary Protein Inhibiting TRPV5 Activity. J Am Soc Nephrol. 17, 26-30.

  31. van de Graaf, S. F., Chang, Q., Mensenkamp, A. R., Hoenderop, J. G., and Bindels, R. J. (2006) Direct Interaction with Rab11a Targets the Epithelial Ca2+ Channels TRPV5 and TRPV6 to the Plasma Membrane. Mol Cell Biol. 26, 303-312.

  32. Hoenderop, J. G., Voets, T., Hoefs, S., Weidema, F., Prenen, J., Nilius, B., and Bindels, R. J. (2003) Homo- and Heterotetrameric Architecture of the Epithelial Ca2+ Channels TRPV5 and TRPV6. EMBO J. 22, 776-785.

  33. Voets, T., Janssens, A., Droogmans, G., and Nilius, B. (2004) Outer Pore Architecture of a Ca2+-Selective TRP Channel. J Biol Chem. 279, 15223-15230.

  34. Hoenderop, J. G., Vennekens, R., Muller, D., Prenen, J., Droogmans, G., Bindels, R. J., and Nilius, B. (2001) Function and Expression of the Epithelial Ca(2+) Channel Family: Comparison of Mammalian ECaC1 and 2. J Physiol. 537, 747-761.

  35. Weber, K., Erben, R. G., Rump, A., and Adamski, J. (2001) Gene Structure and Regulation of the Murine Epithelial Calcium Channels ECaC1 and 2. Biochem Biophys Res Commun. 289, 1287-1294.

  36. Peng, J. B., Chen, X. Z., Berger, U. V., Weremowicz, S., Morton, C. C., Vassilev, P. M., Brown, E. M., and Hediger, M. A. (2000) Human Calcium Transport Protein CaT1. Biochem Biophys Res Commun. 278, 326-332.

  37. Hoenderop, J. G., Nilius, B., and Bindels, R. J. (2003) Epithelial Calcium Channels: From Identification to Function and Regulation. Pflugers Arch. 446, 304-308.

  38. van der Eerden, B. C., Hoenderop, J. G., de Vries, T. J., Schoenmaker, T., Buurman, C. J., Uitterlinden, A. G., Pols, H. A., Bindels, R. J., and van Leeuwen, J. P. (2005) The Epithelial Ca2+ Channel TRPV5 is Essential for Proper Osteoclastic Bone Resorption. Proc Natl Acad Sci U S A. 102, 17507-17512.

  39. Nijenhuis, T., van der Eerden, B. C., Hoenderop, J. G., Weinans, H., van Leeuwen, J. P., and Bindels, R. J. (2008) Bone Resorption Inhibitor Alendronate Normalizes the Reduced Bone Thickness of TRPV5(-/-) Mice. J Bone Miner Res. 23, 1815-1824.

  40. Zhao, H., and Simasko, S. M. (2010) Role of Transient Receptor Potential Channels in Cholecystokinin-Induced Activation of Cultured Vagal Afferent Neurons. Endocrinology. 151, 5237-5246.

  41. Nijenhuis, T., Hoenderop, J. G., and Bindels, R. J. (2005) TRPV5 and TRPV6 in Ca(2+) (Re)Absorption: Regulating Ca(2+) Entry at the Gate. Pflugers Arch. 451, 181-192.

  42. Hoenderop, J. G., Nilius, B., and Bindels, R. J. (2002) ECaC: The Gatekeeper of Transepithelial Ca2+ Transport. Biochim Biophys Acta. 1600, 6-11.

  43. Van Cromphaut, S. J., Dewerchin, M., Hoenderop, J. G., Stockmans, I., Van Herck, E., Kato, S., Bindels, R. J., Collen, D., Carmeliet, P., Bouillon, R., and Carmeliet, G. (2001) Duodenal Calcium Absorption in Vitamin D Receptor-Knockout Mice: Functional and Molecular Aspects. Proc Natl Acad Sci U S A. 98, 13324-13329.

  44. Hoenderop, J. G., and Bindels, R. J. (2008) Calciotropic and Magnesiotropic TRP Channels. Physiology (Bethesda). 23, 32-40.

  45. Vesey, D. A. (2010) Transport Pathways for Cadmium in the Intestine and Kidney Proximal Tubule: Focus on the Interaction with Essential Metals. Toxicol Lett. 198, 13-19.

  46. Pedersen, S. F., Owsianik, G., and Nilius, B. (2005) TRP Channels: An Overview. Cell Calcium. 38, 233-252.

  47. Ramsey, I. S., Delling, M., and Clapham, D. E. (2006) An Introduction to TRP Channels. Annu Rev Physiol. 68, 619-647.

  48. Alawi, K., and Keeble, J. (2010) The Paradoxical Role of the Transient Receptor Potential Vanilloid 1 Receptor in Inflammation. Pharmacol Ther. 125, 181-195.

  49. van de Graaf, S. F., Rescher, U., Hoenderop, J. G., Verkaart, S., Bindels, R. J., and Gerke, V. (2008) TRPV5 is Internalized Via Clathrin-Dependent Endocytosis to Enter a Ca2+-Controlled Recycling Pathway. J Biol Chem. 283, 4077-4086.

  50. Holzer, P. (2011) Transient Receptor Potential (TRP) Channels as Drug Targets for Diseases of the Digestive System. Pharmacol Ther. 131, 142-170.

  51. Kim, J., Chung, Y. D., Park, D. Y., Choi, S., Shin, D. W., Soh, H., Lee, H. W., Son, W., Yim, J., Park, C. S., Kernan, M. J., and Kim, C. (2003) A TRPV Family Ion Channel Required for Hearing in Drosophila. Nature. 424, 81-84.

  52. Nilius, B., Vriens, J., Prenen, J., Droogmans, G., and Voets, T. (2004) TRPV4 Calcium Entry Channel: A Paradigm for Gating Diversity. Am J Physiol Cell Physiol. 286, C195-205.

  53. van Abel, M., Hoenderop, J. G., and Bindels, R. J. (2005) The Epithelial Calcium Channels TRPV5 and TRPV6: Regulation and Implications for Disease. Naunyn Schmiedebergs Arch Pharmacol. 371, 295-306.

  54. Hoenderop, J. G., Nilius, B., and Bindels, R. J. (2005) Calcium Absorption Across Epithelia. Physiol Rev. 85, 373-422.

  55. Schoeber, J. P., Hoenderop, J. G., and Bindels, R. J. (2007) Concerted Action of Associated Proteins in the Regulation of TRPV5 and TRPV6. Biochem Soc Trans. 35, 115-119.

  56. Suzuki, Y., Landowski, C. P., and Hediger, M. A. (2008) Mechanisms and Regulation of Epithelial Ca2+ Absorption in Health and Disease. Annu Rev Physiol. 70, 257-271.

  57. Boros, S., Bindels, R. J., and Hoenderop, J. G. (2009) Active Ca(2+) Reabsorption in the Connecting Tubule. Pflugers Arch. 458, 99-109.

  58. Bonny, O., Rubin, A., Huang, C. L., Frawley, W. H., Pak, C. Y., and Moe, O. W. (2008) Mechanism of Urinary Calcium Regulation by Urinary Magnesium and pH. J Am Soc Nephrol. 19, 1530-1537.

  59. Yeh, B. I., Sun, T. J., Lee, J. Z., Chen, H. H., and Huang, C. L. (2003) Mechanism and Molecular Determinant for Regulation of Rabbit Transient Receptor Potential Type 5 (TRPV5) Channel by Extracellular pH. J Biol Chem. 278, 51044-51052.

  60. Lambers, T. T., Oancea, E., de Groot, T., Topala, C. N., Hoenderop, J. G., and Bindels, R. J. (2007) Extracellular pH Dynamically Controls Cell Surface Delivery of Functional TRPV5 Channels. Mol Cell Biol. 27, 1486-1494.

  61. Renkema, K. Y., Nijenhuis, T., van der Eerden, B. C., van der Kemp, A. W., Weinans, H., van Leeuwen, J. P., Bindels, R. J., and Hoenderop, J. G. (2005) Hypervitaminosis D Mediates Compensatory Ca2+ Hyperabsorption in TRPV5 Knockout Mice. J Am Soc Nephrol. 16, 3188-3195.

  62. Hoenderop, J. G., Dardenne, O., Van Abel, M., Van Der Kemp, A. W., Van Os, C. H., St -Arnaud, R., and Bindels, R. J. (2002) Modulation of Renal Ca2+ Transport Protein Genes by Dietary Ca2+ and 1,25-Dihydroxyvitamin D3 in 25-Hydroxyvitamin D3-1alpha-Hydroxylase Knockout Mice. FASEB J. 16, 1398-1406.

  63. van Abel, M., Hoenderop, J. G., van der Kemp, A. W., Friedlaender, M. M., van Leeuwen, J. P., and Bindels, R. J. (2005) Coordinated Control of Renal Ca(2+) Transport Proteins by Parathyroid Hormone. Kidney Int. 68, 1708-1721.

  64. Van Abel, M., Hoenderop, J. G., Dardenne, O., St Arnaud, R., Van Os, C. H., Van Leeuwen, H. J., and Bindels, R. J. (2002) 1,25-Dihydroxyvitamin D(3)-Independent Stimulatory Effect of Estrogen on the Expression of ECaC1 in the Kidney. J Am Soc Nephrol. 13, 2102-2109.

  65. Hsu, Y. J., Dimke, H., Schoeber, J. P., Hsu, S. C., Lin, S. H., Chu, P., Hoenderop, J. G., and Bindels, R. J. (2010) Testosterone Increases Urinary Calcium Excretion and Inhibits Expression of Renal Calcium Transport Proteins. Kidney Int. 77, 601-608.

  66. Lee, C. T., Lien, Y. H., Lai, L. W., Chen, J. B., Lin, C. R., and Chen, H. C. (2006) Increased Renal Calcium and Magnesium Transporter Abundance in Streptozotocin-Induced Diabetes Mellitus. Kidney Int. 69, 1786-1791.

  67. Jing, H., Na, T., Zhang, W., Wu, G., Liu, C., and Peng, J. B. (2011) Concerted Actions of NHERF2 and WNK4 in Regulating TRPV5. Biochem Biophys Res Commun. 404, 979-984.

  68. Thebault, S., Hoenderop, J. G., and Bindels, R. J. (2006) Epithelial Ca2+ and Mg2+ Channels in Kidney Disease. Adv Chronic Kidney Dis. 13, 110-117.

  69. Lambers, T. T., Mahieu, F., Oancea, E., Hoofd, L., de Lange, F., Mensenkamp, A. R., Voets, T., Nilius, B., Clapham, D. E., Hoenderop, J. G., and Bindels, R. J. (2006) Calbindin-D28K Dynamically Controls TRPV5-Mediated Ca2+ Transport. EMBO J. 25, 2978-2988.

  70. de Groot, T., Kovalevskaya, N. V., Verkaart, S., Schilderink, N., Felici, M., van der Hagen, E. A., Bindels, R. J., Vuister, G. W., and Hoenderop, J. G. (2011) Molecular Mechanisms of Calmodulin Action on TRPV5 and Modulation by Parathyroid Hormone. Mol Cell Biol. 31, 2845-2853.

  71. Lee, J., Cha, S. K., Sun, T. J., and Huang, C. L. (2005) PIP2 Activates TRPV5 and Releases its Inhibition by Intracellular Mg2+. J Gen Physiol. 126, 439-451.

  72. Gkika, D., Mahieu, F., Nilius, B., Hoenderop, J. G., and Bindels, R. J. (2004) 80K-H as a New Ca2+ Sensor Regulating the Activity of the Epithelial Ca2+ Channel Transient Receptor Potential Cation Channel V5 (TRPV5). J Biol Chem. 279, 26351-26357.

  73. Thyagarajan, B., Benn, B. S., Christakos, S., and Rohacs, T. (2009) Phospholipase C-Mediated Regulation of Transient Receptor Potential Vanilloid 6 Channels: Implications in Active Intestinal Ca2+ Transport. Mol Pharmacol. 75, 608-616.

  74. Nilius, B., Prenen, J., Vennekens, R., Hoenderop, J. G., Bindels, R. J., and Droogmans, G. (2001) Modulation of the Epithelial Calcium Channel, ECaC, by Intracellular Ca2+. Cell Calcium. 29, 417-428.

  75. Nilius, B., Vennekens, R., Prenen, J., Hoenderop, J. G., Bindels, R. J., and Droogmans, G. (2000) Whole-Cell and Single Channel Monovalent Cation Currents through the Novel Rabbit Epithelial Ca2+ Channel ECaC. J Physiol. 527 Pt 2, 239-248.

  76. Hoenderop, J. G., van Leeuwen, J. P., van der Eerden, B. C., Kersten, F. F., van der Kemp, A. W., Merillat, A. M., Waarsing, J. H., Rossier, B. C., Vallon, V., Hummler, E., and Bindels, R. J. (2003) Renal Ca2+ Wasting, Hyperabsorption, and Reduced Bone Thickness in Mice Lacking TRPV5. J Clin Invest. 112, 1906-1914.