Phenotypic Mutation 'sothe' (pdf version)
Allelesothe
Mutation Type intron
Chromosome19
Coordinate41,356,683 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Pik3ap1
Gene Name phosphoinositide-3-kinase adaptor protein 1
Synonym(s) BCAP, 1810044J04Rik
Chromosomal Location 41,274,218-41,385,070 bp (-)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in B cell maturation. [provided by MGI curators]
Accession Number

NCBI Refseq: NM_031376.3; MGI:1933177

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model not available
SMART Domains Protein: ENSMUSP00000052777
Gene: ENSMUSG00000025017

DomainStartEndE-ValueType
DBB 180 319 8.55e-75 SMART
SCOP:d1bd8__ 331 396 8e-5 SMART
Blast:ANK 336 365 1e-7 BLAST
low complexity region 533 552 N/A INTRINSIC
low complexity region 716 740 N/A INTRINSIC
low complexity region 802 808 N/A INTRINSIC
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) :  Chemically induced (ENU)(2) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Pik3ap1 APN 19 41375890 missense possibly damaging 0.95
IGL01697:Pik3ap1 APN 19 41324579 missense probably damaging 1.00
IGL01743:Pik3ap1 APN 19 41292828 splice site probably benign
IGL02006:Pik3ap1 APN 19 41302593 missense probably benign
IGL02507:Pik3ap1 APN 19 41282012 splice site probably benign
IGL02601:Pik3ap1 APN 19 41302442 missense probably benign 0.08
Pintail UTSW 19 41376146 missense probably benign 0.00
sooni UTSW 19 41327909 missense probably damaging 1.00
FR4449:Pik3ap1 UTSW 19 41281946 small insertion probably benign
FR4548:Pik3ap1 UTSW 19 41281945 small insertion probably benign
FR4976:Pik3ap1 UTSW 19 41281945 small insertion probably benign
R0504:Pik3ap1 UTSW 19 41287490 missense probably damaging 1.00
R0505:Pik3ap1 UTSW 19 41324564 missense probably damaging 1.00
R0736:Pik3ap1 UTSW 19 41332319 missense possibly damaging 0.56
R0926:Pik3ap1 UTSW 19 41302525 missense probably benign 0.00
R1521:Pik3ap1 UTSW 19 41321558 missense probably damaging 1.00
R1681:Pik3ap1 UTSW 19 41308529 missense probably damaging 1.00
R1779:Pik3ap1 UTSW 19 41332234 missense probably damaging 1.00
R1924:Pik3ap1 UTSW 19 41302614 missense possibly damaging 0.79
R1945:Pik3ap1 UTSW 19 41274337 missense probably benign
R2327:Pik3ap1 UTSW 19 41296389 missense probably damaging 0.99
R2891:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2892:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2893:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2894:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2918:Pik3ap1 UTSW 19 41302531 missense probably benign 0.00
R4424:Pik3ap1 UTSW 19 41375881 missense probably benign 0.00
R4654:Pik3ap1 UTSW 19 41327909 missense probably damaging 1.00
R4811:Pik3ap1 UTSW 19 41302497 missense possibly damaging 0.67
R4855:Pik3ap1 UTSW 19 41327845 missense probably benign 0.13
R4885:Pik3ap1 UTSW 19 41375926 missense probably benign 0.28
R5119:Pik3ap1 UTSW 19 41281976 missense probably benign 0.18
R5261:Pik3ap1 UTSW 19 41376106 missense probably damaging 1.00
R5274:Pik3ap1 UTSW 19 41281952 missense possibly damaging 0.67
R5655:Pik3ap1 UTSW 19 41298241 missense possibly damaging 0.65
R5862:Pik3ap1 UTSW 19 41332345 missense probably damaging 1.00
R5924:Pik3ap1 UTSW 19 41296456 missense probably damaging 1.00
R6015:Pik3ap1 UTSW 19 41328201 missense probably benign 0.22
R6018:Pik3ap1 UTSW 19 41385016 start gained probably benign
R6515:Pik3ap1 UTSW 19 41376146 missense probably benign 0.00
R6792:Pik3ap1 UTSW 19 41321626 missense probably benign 0.14
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 036402-UCD
Last Updated 2019-01-17 5:23 PM by Diantha La Vine
Record Created 2010-09-14 5:52 PM by Carrie N. Arnold
Record Posted 2011-11-10
Phenotypic Description
Figure 1.
Figure 2.

The sothe phenotype was identified among ENU-mutagenized G3 mice screened for impaired T-dependent or T-independent humoral immune responses. Sothe mice failed to mount a T-independent B cell response, producing no antigen-specific IgM after immunization with NP-Ficoll (see left dot plot in Figure 1 & 2). The T-dependent B cell response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) is normal in sothe mutants (see right dot plot in Figure 1 & 2).

 

Peripheral lymphocyte subsets have not been assessed.

Nature of Mutation

SOLiD was used to sequence mice with the sothe phenotype and Pik3ap1 was selected from the SOLiD mutation list and validated.  Sequencing of Pik3ap1 in a sothe mutant identified a heterozygous A to T transversion at position 1587 of the mRNA, in exon 10 of 17 exons.

 

1572 GAAGGTAACAGTGTGAAACCGGCCAGTTGGGAG

491  -E--G--N--S--V--K--P--A--S--W--E-

 

The mutated nucleotide is indicated in red lettering, and results in substitution of lysine 496 with a premature stop in the encoded protein.

Protein Prediction

Pik3ap1 variant 1 (NM_031376.3) is 2615 bp and encodes an 811 amino acid protein that is 112 kDa (i.e. B cell adaptor protein (BCAP)).  Variant 2 (ENSMUST00000116503) is 4486 bp and encodes a shorter protein (632 aa and ~70 kDa) that does not include the first 179 aa of variant 1 (1-3). Both isoforms can be phosphorylated upon binding to the BCR co-receptor, CD19 (2). Variant 1, the canonical variant, regulates interleukin (IL)-6 (a pro-inflammatory cytokine) and IL-10 (an anti-inflammatory cytokine) production mediated by lipopolysaccharides in T cell-independent B cell immune responses (1).  However, deletion (by siRNA) of both the shorter and longer isoforms of BCAP did not change the expression of the two cytokines (1).  When the isoforms were overexpressed, it was found that variant 2 led to increased IL-6 production, while overexpression of variant 1 inhibited IL-6 (1).  Taken together, it is proposed that variant 1 acts as a negative regulator of IL-6 production. 

 

BCAP was identified by affinity purification in chicken DT40 B cells to be an adaptor that couples the B cell antigen receptor (BCR) or its co-receptor, CD19, with phosphoinositide 3-kinase (PI3K) activation by binding the N-terminal SH2 domain of the p85 regulatory subunit of PI3K (3).  It was subsequently identified in human and mouse. The 811-amino acid mouse BCAP protein is 85.1% identical to the 805-amino acid human protein and 65% homologous to the chicken sequence (4)

 

Figure 3.  The domain structure of BCAP.  BCAP has a Dof/BCAP/BANK (DBB) domain (aa 182-318), an ankyrin repeat-like sequence (aa 333-401), a coiled-coil sequence (aa 636-669), and proline-rich sequences (aa 530-552, 760-808).  Tyrosinses within YxNx (Y387), YxxV (Y513) and YxxM (Y264, Y420, Y445 and Y460) sequences are phosphorylated upon B-cell receptor activation and facilitate the binding of BCAP to Grb2, SHP-2 and BTK/Syk, respectively.  The sothe mutation encodes a premature stop codon at residue 496. This image is interactive. Other mutations found in BCAP are noted in red. Click on each mutation for more information.

BCAP shares several structural features with other adaptor proteins including BANK (B-cell scaffold protein with ankyrin repeats), an adaptor for CD40, a protein present on antigen presenting cells (see walla, a mutation in CD40 ligand) and with the Drosophila protein Dof (Downstream of FGF receptor), an adaptor that is essential in FGF-mediated signaling (5;6).    The domains of BCAP include:  an ankyrin repeat-like sequence (aa 333-401), a predicted coiled-coil forming sequence (aa 636-669), proline-rich sequences (3 in mouse; aa 530-552, 760-808) and a region designated the Dof/BCAP/BANK (DBB) domain (aa 182-318) (4;7-9) (Figure 3).

 

The proline-rich region at the C-terminus of BCAP facilitates interaction between BCAP and the N-terminal SH3 domains of Src protein tyrosine kinases (PTKs), PLC-γ, and Grb2 (3).  Tyrosine motifs (YxNx, YxxV, and YxxM) facilitate the binding of BCAP to Grb2, SHP-2 and BTK/Syk, respectively.  Following B cell activation, BCAP is phosphorylated at four tyrosine residues (Y264, Y420, Y,445 and Y460) within 4 respective YxxM motifs by BTK and Syk activation (1;2;4).  Interestingly, BCAP that has mutations at Y420, Y445 and Y460 can still be phosphorylated by Syk (1).  It was later found that BCAP can also be phosphorylated at its C-terminus (Y513, Y553, Y570, Y594 and Y694) by the non-receptor tyrosine kinase c-abl oncogene 1 (Abl1) (1).  Once BCAP is phosphorylated, it can bind to PI3K through its YxxM motifs, leading to subsequent Akt activation (2;10;11). The functions of the ankyrin repeats, coiled-coil domain and DBB domain of BCAP remain unknown.  However, it has been suggested that these domains are important for the subcellular localization of BCAP through interactions with other proteins (3).  In Drosophila development, the DBB domain of Dof was required for FGF-dependent signal transduction, whereas mutants lacking the ankyrin repeat or coiled-coil domain retained partial function (7).  In yeast two-hybrid assays, the DBB domain was required for Dof to interact with the Drosophila FGF receptor, Heartless, and for Dof to homodimerize (4)

 

Sothe is a lysine (K) to premature stop codon mutation at residue 496.  Residue 496 is within the C-terminus of the BCAP protein in exon 10 of 17.  Coding of a stop codon at 496 would result in translation of an incomplete BCAP protein (without coiled-coil and the C-terminal pro-rich domains) that might produce dominant negative or gain-of-function phenotypes, and unstable protein (if translated), or undergo nonsense-mediated decay.

Expression/Localization

Northern blot analysis of several mouse tissues detected Pik3ap1 mRNA in the spleen, thymus, liver and lung (3).    Furthermore, expression of Pik3ap1 has been documented in B cells (mature and pre-B cells), natural killer (NK) cells, macrophages, myeloid cells and dendritic cells (3;12;13).  BCAP is cytosolic protein that facilitates the recruitment of PI3K to the activated B cell receptor.  The protein is also detected at the plasma membrane (3;12).

Background

Figure 4. Pre-BCR and BCR signaling. Pre-BCR engagement results in the activation of SYK (spleen tyrosine kinase), which together with Src-family kinases (LYN, FYN, BLK), phosphorylates many substrates and triggering signaling pathways that are involved in both proliferation and differentiation of pre-B cells. These include activation of phosphoinositide 3 kinase (PI3K) by phosphorylating the coreceptor CD19 and/or the adaptor protein B-cell PI3K adaptor (BCAP). PI3K activation results in the generation of phosphatidylinosital-3,4,5-triphosphate (PIP3), which recruits plekstrin-homology domain signaling molecules to the membrane including the serine threonine protein kinase B (PKB) and its activating kinase 3- phosphoinositide-dependent protein kinase 1 (PDK1). Signaling through this pathway pathway suppresses recombination-activating gene 1 (RAG1) and RAG2 expression, blocks Igk (the k chain of the immunoglobin light chain) gene recombination, and induces cell proliferation. SYK also phosphorylates SH2-domain containing leukocyte protein of SLP65, resulting in the organization of a molecular complex that includes Bruton’s tyrosine kinase (BTK) and phospholipase Cγ2 (PLCγ2). This complex controls downregulation of l-5, a component of the surrogate light chain (SLC), and upregulates the expression of RAG proteins and the interferon-regulatory factor 4 (IRF4). IRF4 positively regulates Igk recombination. SLP65 also modulates PKB activity either directly or by altering the activity of SYK, CD19, or PI3K. Alternatively, SLP65 may regulate PKB activity by activating lipid phosphatases such as SH2-domain containing inositol-5 phosphate (SHIP) and altering PIP3 levels. Multiple downstream signaling pathways are activated by BCR stimulation and lead to a multitude of cellular responses. Following aggregation and localization of BCR molecules, the tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn) and by SYK . These phosphotyrosines then act as docking sites for the SH2 domains of SYK, resulting in SYK phosphorylation and activation. SYK phosphorylates a number of downstream targets including BLNK, PLC-g2 and protein kinase C β (PKCβ). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of 3′-phosphorylated phosphoinositides. One of these lipids, phosphatidylinositol-3,4,5-triphosphate (PIP3), binds selectively to the pleckstrin homology (PH) domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-g2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1 or CARD11), which are involved in NF-κB activation along with PKCβ. Image is interactive. Click to view mutations.

PI3Ks are lipid kinases that facilitate the generation of phosphoinositides (i.e. PI(3)P, PI(3,4)P2, and PI(3,4,5)P3) by the phosphorylation of inositol phospholipids (i.e. PI, PI(4)P and PI(4,5)P2, respectively) in the plasma membrane (14;15).  PI3Ks are divided into three classes of based on their structure and substrate specificity (16).  Class I PI3Ks are comprised of a regulatory (i.e. p50a, p55a, p55g, p85a or p85b) and a catalytic (i.e. p110a, p110b or p110d) subunit that get activated by tyrosine kinase receptors (15-17).  The regulatory subunit of Class I PI3Ks prevents the degradation of the catalytic subunit and regulates its activity (15).  The p85 subunit of PI3K contains Src homology 2 (SH2) domains that bind to phosphorylated tyrosines within the YxxM motifs on other proteins.  Binding of p85 to these proteins releases the inhibition of the associated catalytic subunit (11;12;15).  The Class II PI3Ks do not contain regulatory subunits; class III PI3Ks are involved in protein and vesicle trafficking.

 

The PI3K pathway is involved in apoptosis, cell growth, motility, proliferation, differentiation, metabolism and intracellular trafficking as well as in insulin-like growth factor (IGF) signaling (3;14).  In intracellular signaling pathways that promote cell survival, the class I PI3Ks generate PI(3,4,5)P3 from PI(3,4)P2 upon receptor activation.  PI(3,4,5)P3 subsequently binds the plekstrin homology (PH) domains of phosphoinositide-dependent protein kinase 1 (PDK1) and protein kinase B (PKB; a synonym for Akt).  Upon binding of PI(3,4,5)P3 to the PH domain of Akt, it translocates to the plasma membrane and is phosphorylated by PDK1 and PDK2 (17).  Phosphorylated Akt mediates cell survival and proliferation through the PI3K/AKT/mTOR pathway. Defects in PI3K-associated signaling due to mutations, amplification or rearrangement have been detected in instances cancer (14).

 

In order to facilitate PI3K-mediated cell signaling, activated Ras and/or protein adaptors within the cell orient the catalytic subunit of PI3K close to its substrate in the membrane (17).  In B cell receptor (BCR)-mediated signaling, either transmembrane (i.e. CD19) or cytosolic adaptors (i.e. TC21, Cbl, Gab, B-cell linker (BLNK (see busy) or SLP-65), and B-cell adaptor for PI3K (BCAP)) are tyrosine phosphorylated on their YxxM motifs by protein tyrosine kinases (i.e. Btk, Syk and/or Lyn) and subsequently associate with PI3K to amplify and integrate several signaling pathways (3;9;12;15;17;18).  Upon activation of BCR-mediated signaling, Syk initiates BCAP phosphorylation, while Btk sustains it.  Lyn negatively regulates BCAP phosphorylation by initiating the phosphorylation of immunoreceptor tyrosine-based inhibition motifs (ITIMS) on inhibitory receptor proteins CD22 and PIRB (3;19).  BCAP and CD19 have a complementary role in P13K activation:  upon BCAP binding to PI3K, there is an upregulation in PI3K activity and PI3K translocates to CD19-bearing lipid rafts rich in PI(4,5)P2 (10;13)

 

BCAP in macrophages

PI3K-associated intracellular signaling has been detected in several cells of the immune system including macrophages, innate immune cells that phagocytize apoptotic and damaged cells.  To examine BCAP expression and function in macrophages a BCAP deficient mouse has been generated and characterized (9;11).  Although, the amount of macrophages was only slightly decreased in the spleen (9), it was determined that BCAP is essential for the survival of the cell (11).  Furthermore, retroviral transduction of wild-type BCAP in BCAP deficient macrophages rescued the proapoptotic phenotype that was observed upon the loss of BCAP (11).

 

BCAP in NK cells

In natural killer (NK) cells, a type of cell in the innate immune system that mediates the apoptosis of target cells, PI3K-mediated signaling is essential for maintaining apoptosis resistance as well as the mobilization of cytolytic granules (i.e. perforin and granzyme B) that assist in the lysis of target cells (12).  Studies on the role of BCAP in NK cells found that BCAP expression is essential for NK cell maturation, function and survival (12).  Mature NK cells from BCAP deficient mice were more resistant to apoptosis and are present at a higher frequency than in the wild-type mouse.  In addition, the BCAP deficient NK cells had a potentiated Interferon-gamma (IFN-γ) response (an essential activating cytokine of NK cells) and a large percentage of the BCAP deficient  cells appeared to be expressing markers distinguishing them as self-recognizing cells (i.e. Ly49I, a receptor that recognize MHC class I molecules) (11;12).  Studies with the BCAP deficient mouse indicate that BCAP could function as either a negative or positive regulator of NK-mediated intracellular signaling.   The increased IFN-γ production, cytolytic function and enhanced viral clearance responses indicate that BCAP is a negative regulator of NK-associated signaling.  However, Akt signaling was also suppressed in the BCAP deficient NK cells indicating that BCAP could act as a positive regulator in NK-mediated function (12).

 

BCAP in B cells

Upon an induction of BCR-mediated signaling, there is a concomitant stimulation of growth arrest and apoptosis in immature B cells with a promotion of survival and proliferation of mature B cells (Figure 4) (18). Phosphorylated PI3K-associated adaptor proteins, including BCAP, recruit enzymes such as phospholipase C-gamma 2 (PLC-γ2) (see queen) and PI3K to facilitate B-cell proliferation, differentiation and activation via the PI3K pathway (9;17;20;21). It has been proposed that BCAP can mediate PI3K activation in two ways:  (i) PI3K-BCAP binding upregulates PI3K enzymatic activity, or (ii) BCAP is associated with a CD19-mediated translocation of PI3K (2).  This study also suggested that there is another unidentified molecule that can assist in the translocation of PI3K upon BCR activation (2).

 

Cell Survival & Maturation

BCAP deficient mature splenic B cells undergo activation-induced apoptosis more readily than cells that express BCAP (2;8;12;18).  After B cell receptor engagement in the BCAP deficient B cells, expression of cell survival molecules (i.e. Bcl-xL) was not induced (8).  Furthermore, maturation and/or survival of a B cell subset (peritoneal B1) was not promoted; marginal zone (MZ) B cell numbers were similar to wild-type (9). MZ B cells are present in the marginal zone of the spleen while B1 cells are localized in an anatomical environment; both cell types are involved in T-cell independent (TI) innate immunity (21).  In BCAP deficient mice, the ability of both TI (to type II antigens derived from polysaccharides) and T cell-dependent (TD) B cells (B2 B cells), to respond to their specific antigens, was examined.  It was found that the production of immunoglobins was reduced (i.e. IgM and IgG3) for both the TI and TD-specific antigens upon the loss of BCAP (9).  Even with the reduction in IgM and IgG3, the BCAP deficient mice were able to respond to TD antigens, their response to TI antigens was reduced.  These findings  indicate that BCAP is not involved in the formation and/or activation of memory B cells (9).

 

In addition to a role in B cell survival, BCAP is essential for the cell to enter the cell cycle and proliferate (8;12).  After BCR activation in the BCAP deficient cells, there was not an up-regulation of cyclin D2 or Cdk4, two proteins essential for cell cycle progression (8)

 

Although PI3K signaling occurs in both NK and B cells, examination of the role of BCAP in the maturation of these cells found that it may be playing an opposite role in the two cell types.  In the BCAP deficient mouse, NK cells were more mature, while the B cells were less mature (11).  In BCAP deficient B cells, there was a reduction in peripheral B cell populations (9;12).  Flow cytometry of B cells from the bone marrow of BCAP deficient mice found that, in comparison to wild-type mice, there was a reduction in the number of pre-B cells (9).  Furthermore, there was also a reduction in total number of B cells and pre-B cells in the spleen; those that were present were the immature form (9). Taken together, these findings indicate that development of B cells is blocked beyond the immature B cell stage without the expression of BCAP (9)

 

BCR-mediated signaling

The Akt pathway is essential for B-cell proliferation and survival (18).  In mature B cells, Akt, PDK1 and BTK (a cytoplasmic tyrosine kinase) all contain a pleckstrin homology domain specific for PI(3,4,5)P3 that, upon binding to PI3K, localizes to the plasma membrane (15).  In a BCAP deficient B cell, generation of PI(3,4,5)P3 and subsequent Akt activation were inhibited (2;3).  In another study, B cells from BCAP deficient mice activated Akt, although they had survival defects, suggesting that another molecule (possibly CD19) could rescue BCAP/PI3K-associated function  (9;10). The increase in BCR-induced apoptosis can be linked to the loss in Akt activation. 

 

In BCAP deficient B cells, there was also a decrease in the BCR-induced activation of c-Jun N-terminal kinase (Jnk), a member of the mitogen-activated protein kinase (MAPK) family  (3;18).  Jnk is a pro- and anti-apoptotic kinase that can be stimulated by stress, pathogens and mitogens in a cell-type specific manner (22). The reduction in Jnk activity could be attributed to the changes observed in PI3K activation in these cells because the production of PI(3,4,5)P3 is essential for the activation of Vav, a PH domain-containing protein, that is coupled to the Jnk pathway.  It is speculated that in B cells, upon activation of the BCAP-mediated signaling, Jnk is preventing apoptosis.

 

In addition to mediating PI3K activation, BCAP also regulates PLCγ2 activation through a phosphorylation-independent mechanism in B cells.  The BCAP regulation is either through aiding its recruitment to the membrane or promoting a conformational change in PLCγ2 (8;9).  PLCγ2 mediates protein kinase C (PKC, see Tilcara and untied) activation and calcium influx into the cell upon the generation of diacylglycerol (DAG) and IP3, respectively, from Pl-4,5-P2 (8).  It is proposed that changes in the amount of PLCγ2, upon the loss of BCAP expression, alters transcription of the c-Rel subunit of NF-κB, a subunit that promotes the transcription of anti-apoptotic and cell-cycle-regulating genes (8). Mice deficient in either BCAP or c-Rel have similar defects in the proliferation and/or survival of mature B cells due to the loss of NF-κB and NF-κB target gene expression (9;12).  Interestingly, when c-Rel was reintroduced into BCAP deficient mice, there was a restoration in B-cell development and B-cell growth (21).  It was speculated that, upon the loss of BCAP expression, it is the change in NF-κB activity (via loss of c-Rel expression) that leads to the changes in B cell survival (8;21).

Putative Mechanism

The A1587T sothe mutation in exon 10 of Pik3ap1 leads to a K496* amino acid change in the BCAP protein sequence.  A premature stop codon at residue 496 would lead to the coding of a truncated protein and the loss of coding of the coiled-coil and pro-rich domains of BCAP.  These domains are thought to be essential for protein-protein interactions with other proteins to facilitate intracellular signaling pathways, such as PI3K/Akt, NF-kB and Jnk. Characterization of the sothe mice found that, similar to the BCAP deficient mice, the sothe mice are able to mount a T-dependent B cell response,  and that they have a reduction in T-cell independent B cell responses (9).  Similarity between sothe and BCAP deficient phenotypes is consistent with a strongly hypomorphic or null effect of K496*.

Primers Primers cannot be located by automatic search.
Genotyping

Sothe genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the nucleotide change.  The following primers were used for PCR amplification:

 

Primers for PCR amplification

Sothe(F):  5’-TGAGCAAATGGCACAGAAGATACCC -3’

Sothe(R):  5’- TTCCTGCTGAGGCTCTCAGAAGAC-3’

 

 

Primers for sequencing

Sothe(F):  5’-GGCACAGAAGATACCCCAAGG -3’

Sothe(R):  5’-GGCCACACTTACCTTTAGAAATG -3’

 

PCR program

1) 94°C        2:00

2) 94°C        0:30

3) 57°C        0:30

4) 72°C        1:00

5) repeat steps (2-4) 29x

6) 72°C        7:00

7) 4°C           

 

The following sequence of 422 nucleotides (from Genbank genomic region: NC_000085.5 of the linear genomic sequence of Pik3ap1) is amplified:

 

82261                                              tgagcaaat ggcacagaag    

82321 ataccccaag ggaagccttt ggtcacaggt tgttactttg gcaacagaga acattcgctc    

82381 ggtcttacca ccttcaggca ggcaatttcc cggaccacgg ttctgtactc agtccccctt    

82441 ctctgtgttt caggtaacag tgtgaaaccg gccagttggg agagagaaca acaccatccc    

82501 tatggggagg aactttatca cattgtggat gaagatgaga ccttctctgt ggacctagcc    

82561 aacaggcccc ctgtccctgt gcccaggcca gaggccagcg ctcctggccc tcccccaccg    

82621 cctgacaatg agccatacat ttctaaaggt aagtgtggcc agggatggtg ctcagcaggg    

82681 cggggggagg gctggggggg tcttctgaga gcctcagcag gaa

 

Sense strand shown.  PCR primer binding sites are underlined; Sequencing primer binding sites are italicized; the mutated nucleotide is highlighted in red (A>T sense strand; T>A on Chr. + strand).

References
Science Writers Anne Murray
Illustrators Victoria Webster
AuthorsCarrie Arnold and Elaine Pirie