Phenotypic Mutation 'crab' (pdf version)
List |< first << previous [record 85 of 511] next >> last >|
Allelecrab
Mutation Type missense
Chromosome7
Coordinate24,899,175 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Cd79a
Gene Name CD79A antigen (immunoglobulin-associated alpha)
Synonym(s) Cd79a, Ig alpha, Iga, Igalpha, Ig-alpha, Ly54, Ly-54, mb-1
Chromosomal Location 24,897,381-24,902,197 bp (+)
MGI Phenotype Homozygotes for targeted null mutations exhibit arrested development of B cells at the pro-B cell stage due to diminished signaling of the B cell receptor.
Accession Number

NCBI RefSeq: NM_007655; MGI: 101774

Mapped Yes 
Amino Acid Change Cysteine changed to Serine
Institutional SourceBeutler Lab
Ref Sequences
C50S in Ensembl: ENSMUSP00000003469 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 35 120 9.18e-12 SMART
transmembrane domain 138 160 N/A INTRINSIC
ITAM 179 199 4.19e-4 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using Ensembl: ENSMUSP00000003469)
Phenotypic Category decrease in B cells, immune system, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance 100% 
Alleles Listed at MGI

All alleles(17) : Targeted, knock-out(3) Targeted, other(12) Gene trapped(1) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01545:Cd79a APN 7 24901266 missense probably benign 0.01
IGL03302:Cd79a APN 7 24899334 missense probably damaging 1.00
elementary UTSW 7 24899262 missense
R1692:Cd79a UTSW 7 24901456 missense probably damaging 1.00
R2038:Cd79a UTSW 7 24899357 missense probably benign 0.43
R5450:Cd79a UTSW 7 24899262 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
Repository

none

Last Updated 01/10/2017 11:57 AM by Katherine Timer
Record Created 09/21/2010 1:53 PM by Carrie N. Arnold
Record Posted 08/09/2011
Phenotypic Description

The crab phenotype was identified among ENU-mutagenized G3 mice screened for impaired T-dependent or T-independent humoral immune responsesCrab mice failed to mount B cell responses of either type, producing no antigen-specific IgG or IgM, respectively, after immunization with rSFV-encoded β-galactosidase or NP-Ficoll (see figure).  The frequency of B cells was severely reduced in the blood of crab mice.

 

Nature of Mutation

The crab mutation was mapped by bulk segregation analysis of progeny from intercrosses of (C57BL/10J x C57BL/6J-crab)F1 mice (n=26 with mutant phenotype, 67 with normal phenotype).  Based on the ratio of progeny with mutant phenotype to progeny with normal phenotype, the mutation has been classified as recessive; however, the mode of inheritance has not been formally tested.  Based on recessive inheritance, peak linkage was observed at position 7014667 bp on chromosome 7 (synthetic LOD=15.2).

 

Whole genome SOLiD sequencing of a crab mutant yielded ≥1x, ≥2x, and ≥3x coverage of coding/splicing junction nucleotides of 92.5%, 89.6%, and 86.6%, respectively.  Across chromosome 7, ≥1x, ≥2x, and ≥3x coverage was 88.5%, 84.9%, and 81.5%, respectively.  Four discrepancies from the reference sequence were identified among coding/splice junction nucleotides covered ≥3x on chromosome 7 (Bioscope high stringency filtering), of which one occurred in Cd79a, encoding a transmembrane protein known to be required for B cell receptor expression and function.  Capillary sequencing of DNA from a crab mutant confirmed the Cd79a mutation, a homozygous T to A transversion of nucleotide 159 of the Cd79a mRNA.  The mutation occurs in the second of five exons.  Two of the other three discrepancies were not re-evaluated; the remaining one was found to be false.

 

144 GAGGCCCGCCTCACCTGTGAAAACAATGGCAGG

45  -E--A--R--L--T--C--E--N--N--G--R-

 

The mutated nucleotide is indicated in red lettering, and results in a cysteine to serine substitution at amino acid 50 of Igα.

Protein Prediction
Figure 1. Crystal structure of human Immunoglobulin M. UCSF Chimera model is based on PDB 2RCJ, Perkins et al. J.Mol.Biol. 221, 1345-1366 (1991). Click on the 3D structure to view it rotate.

B cell antigen receptors (BCR) consist of two functional components [reviewed in (1)].  The antigen binding component is a membrane bound form of immunoglobulin (mIg), which consists of two transmembrane spanning heavy (H) chains and two associated light (L) chains (Figure 1).  A heterodimer of Igα and Igβ constitutes the signaling component of the BCR (2-4).  Because the cytoplasmic portion of mIg H chains is very short (three amino acids for IgM and IgD), BCR signaling depends on the interactions of the cytoplasmic domains of Igα and Igβ with downstream signaling molecules.  The Igα/Igβ heterodimer associates noncovalently with all mIg isotypes (IgM, IgD, IgG, IgA, and IgE) (5), and is found in each BCR complex in a 1:1 stoichiometry with mIg (6).

 

 

Figure 2. Domain structure of Igα. The crab mutation is a cysteine to serine substitution at amino acid 50.

Igα and Igβ are type I transmembrane glycoproteins of approximately 34 kD and 40 kD in mice, respectively.  Igα consists of 220 and 226 amino acids in mice and humans, respectively, and are 69% identical in these species (Figure 2).  However, human Igα is 13 kD larger than the mouse protein due to heavier glycosylation on six versus two glycosylation sites (1;7;8).  Igβ consists of 228 and 229 amino acids in mice and humans, respectively, and are 68% identical.  The level of glycosylation of Igα and Igβ has been observed to vary between B cells of different lymphoid organs, resulting in molecular weight variations (9).  Also, glycosylation of Igα is increased when associated with mIgD relative to mIgM (10-12).

 

The cytoplasmic tails of Igα and Igβ are 61 and 48 amino acids in length, respectively, and each contains a single immunoreceptor tyrosine-based activation motif (ITAM) (13), a conserved domain containing two tyrosines that upon phosphorylation act as a binding site for SH2 domain-containing effectors (D/ExxxxxxxD/ExxYxxL/IxxxxxxxYxxL/I).  BCR activation results in the phosphorylation of ITAM tyrosines in both Igα and Igβ by membrane-localized Src family kinases, which are subsequently recruited to the receptor through binding of the phosphorylated ITAMs to Src SH2 domains, thereby amplifying signaling (14).  ITAM phosphorylation occurs largely on the membrane-proximal tyrosine (15), but doubly phosphorylated ITAMs also occur and serve as a binding site for the tandem SH2 domains of Syk, which initiates several signaling pathways (16;17) (see Background).

 

One side of the helical transmembrane segment of mIgs is highly conserved between isotypes and interacts closely with the transmembrane segment of the Igα/Igβ heterodimer, although it remains unknown whether contact between mIg and Igα/Igβ is through Igα or Igβ.  Igα contains a negatively charged amino acid (glutamic acid) at the fifth position of the transmembrane segment that was hypothesized to interact directly with positively charged transmembrane residues in mIg (1;2).  However, mIgM contains several polar but no charged amino acids in its transmembrane domain, and mutation of the central YS to VV abolished association with the Igα/Igβ heterodimer (18).  More recent studies using fluorescence resonance energy transfer (FRET) indicated that the cytoplasmic domain of Igβ lies physically closer to mIg than Igα (19).  Since Igβ contains a polar amino acid (glutamine) in its transmembrane region, polar interactions may mediate association between mIg and Igβ.

 

 

Figure 3. Crystal structure of murine Ig-beta. The intrachain disulfide bond is indicated. The cysteine corresponding to the crab mutation in Ig-alpha is shown in green. UCSF Chimera model is based on PDB 3KHQ, Radaev et al. Structure. 18, 934-943 (2010). Click on the 3D structure to view it rotate.

Based on its amino acid sequence, the extracellular N-terminus of Igα (aa 29 to 137 in mice) was predicted to form a C2-set Ig-like fold (20), while that of Igβ would form a V-type Ig fold (21).  Consistent with these hypotheses, the extracellular domains of Igα and Igβ each contain features that are highly conserved in Ig superfamily proteins, including two cysteine residues that form an intrachain disulfide bond (Cys50 and Cys101 in Igα; Cys65 and Cys120 in Igβ), as well as several other conserved residues (22;23).  The predicted Ig fold of Igβ was confirmed by X-ray crystallographic analysis, which demonstrated an I-type rather than a V-type fold (Figure 3; PDB ID 3KHQ) (24).  The overall structure of Igα was predicted to be analogous to that of Igβ.  Igα and Igβ each contain an additional extracellular cysteine residue (Cys113 and Cys135, respectively); these form an interchain disulfide bond that mediates heterodimerization of the proteins (24;25).  The function of the extracellular domains of Igα/Igβ in BCR signaling is not well understood.  They contribute to interactions with mIg (3;24;26), and may be required for transport of mIgM to the cell surface (27).

 

The crab mutation lies in the extracellular domain and affects one of the cysteine residues involved in intrachain disulfide bonding.

 

Expression/Localization

Expression of Igα mRNA and protein is restricted to cells of the B lineage, including B lineage progenitors, pre-B, and mature B cells (4;22).  Both resting and activated B cells express Igα.

Background
Figure 4. BCR Signaling. In resting B cells (inset), BCRs are dispersed as monomers with one Igα/β heterodimer in a “closed” position. Upon stimulation, receptors translocate into lipid rafts and aggregate to form caps. The tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn), causing them to take an open conformation and serve as docking sites for the adapter protein BLNK and the SH2 domains of SYK. SYK phosphorylates a number of downstream targets including BLNK, PLC-γ2 and protein kinase C β (PKCβ). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of 3′-phosphorylated phosphoinositides. One of these lipids, phosphatidylinositol-3,4,5-triphosphate (PIP3), binds selectively to the pleckstrin homology (PH) domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-γ2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of phosphatidylinositol-4,5-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). Soluble IP3 and membrane-bound DAG initiate downstream signal transduction pathways involving calcium (Ca2+) mobilization and PKC, respectively. The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1 or CARD11), which are involved in NF-κB activation along with PKCβ. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

B cells induce numerous responses to microbial infections, including antigen internalization, proliferation, T cell-independent antibody production, and the T cell-dependent antibody response.  These responses are initiated upon antigen binding by the BCR, which rapidly recruits a signaling complex through interactions with Src family kinases (SFK) and the tyrosine kinase Syk.  These kinases recruit and activate other molecules, notably BLNK (see busy) and Pik3ap1 (also called BCAP) (see Sothe) followed by PI-3K and Btk, that lead to activation of PLC-γ2 (see queen), which hydrolyzes phosphatidylinositol-4,5-bisphosphate (PIP2) to diacylglycerol (DAG) and inositol-1,4,5-triphosphate (IP3).  Ultimately, through activation of IP3 receptors on the endoplasmic reticulum, IP3 triggers a large influx of Ca2+ to the cytoplasm.  Sustained elevation of cytosolic Ca2+ regulates the activity of transcription factors including NF-AT and NF-κB (see xander and panr2) (Figure 4).  BCR engagement also activates pathways regulated by PKCβ (see Untied), PI-3K, and Ras/MAPK, which further modulate B cell responses [see (28;29) for reviews of B cell antigen receptor signaling].  Signal transduction following antigen binding to the BCR absolutely requires Igα and Igβ.  Below, the functions of Igα and Ig β in proximal BCR signaling are described.

 

BCRs on resting B cells are dispersed, likely as monomers, in the absence of antigen (19).  BCR engagement triggers receptor translocation into lipid rafts (30;31), and aggregation into microclusters that move together along actin filaments to form a central synapse at one pole of the cell, termed ‘capping’ (32).  Following these events, the ITAMs located on the cytoplasmic tails of Igα and Igβ become phosphorylated by SFKs, which are enriched in lipid rafts as a result of their myristoylation and/or palmitoylation.  Four SFKs (Lyn, Fyn, Blk, Lck) are the earliest activated kinases upon BCR ligation [(33); reviewed in (34)].  Lyn and Fyn, but not Src, were shown to interact directly with the resting BCR through binding to Igα (35;36).  Lyn is believed to be primarily responsible for phosphorylating the ITAMs of Igα/Igβ (34;37)

 

Once phosphorylated on both tyrosines, the Igα/Igβ ITAMs serve as docking sites for the adapter protein BLNK (38)and the two SH2 domains of Syk, which is then activated by SFK-dependent trans-phosphorylation (39-42).  Syk-deficient B cells are deficient in downstream BCR signaling responses, but display normal SFK activation and Igα/Igβ phosphorylation, indicating that Syk is essential for transmitting signals from the BCR to distal signaling molecules (43).  Syk phosphorylates a number of targets including BLNK, PLC-γ2, and PKCβ.  BLNK serves as a scaffold to bring together several important signaling molecules (44;45).  In particular, phosphorylated BLNK provides docking sites for the tyrosine kinase Btk as well as PLC-γ2, resulting in phosphorylation and activation of PLC-γ2 by Btk (46;47).

 

In addition to phosphorylation of tyrosines within the Igα and Igβ ITAMs, BCR aggregation also results in phosphorylation of a non-ITAM tyrosine at the tip of the Igα cytoplasmic domain (Y204) (38;48).  This non-ITAM phosphotyrosine binds to the C-terminal SH2 domain of BLNK (38;49), and has been proposed to recruit BLNK to the BCR where it can be phosphorylated by ITAM-bound Syk (50).  Both Igα ITAM tyrosines and Y204 are necessary for chicken B cell development in the absence of Igβ (51).  In mice, Igα Y204 is required for T cell-independent B cell activation, proliferation, and antibody production, but not BCR capping, antigen internalization, antigen presentation, or T cell-dependent antibody production (52).  B cells from Cd79aY204F/Y204F mice exhibited normal levels of BCR-induced Syk phosphorylation, but reduced BLNK phosphorylation, calcium flux, and NF-κB, JNK, and ERK activation.  These findings suggest that phosphorylation of Igα Y204 promotes T cell-independent B cell responses in a manner dependent on BLNK phosphorylation.  Several other non-ITAM tyrosines in the cytoplasmic tail of Igα, which are not phosphorylated, mediate BCR internalization in a manner independent of BCR signaling (53;54).

 

BCR signaling is essential for progression through the early stages of B cell development.  Signaling-competent Igα and Igβ have been detected in a complex with the ER chaperone calnexin on the surface of mouse progenitor B (pro-B) cells, which do not yet express the Ig heavy chain (55;56).  In this context, Igα and Igβ were proposed to promote V(D)J recombination (see maladaptive).  However, pro-B cells from Igα- and Igβ-deficient mice initiated and completed V(D)J recombination as well wild type cells (57).  Despite normal V(D)J recombination, these cells failed to express the pre-BCR (a complex composed of the recombined mIgM heavy chain, the surrogate light chains λ5 and VpreB, and the Igα/Igβ heterodimer) on the cell surface, and B cell development was blocked at the pro-B cell stage (57;58).  Similarly, mutations of Igα in humans cause agammaglobulinemia leading to recurrent infections (OMIM #613501); a block in B cell development is observed at the pro-B cell stage (59;60).  In contrast, pro-B cells in mice expressing chimeric receptors with the extracellular domain of mIgM and the cytoplasmic domain of either Igβ or Igα on a Rag1-/- background transitioned to the pre-B cell stage and generated immature B cells (61;62).  In addition, targeting the cytoplasmic domains of the Igα/Igβ heterodimer to the cell surface in the absence of any other BCR extracellular domains in pro-B cells lacking μ heavy chain expression was sufficient to generate immature B cells (63).  Thus, basal signals generated by membrane-localized Igα/Igβ cytoplasmic domains are necessary and sufficient to support B cell differentiation.

 

In mature B cells, signaling through Igα/Igβ is required for cell survival.  Cre-mediated deletion of the Igα locus in mature B cells resulted in apoptosis within a period of two weeks (64), a situation that also results from Ig heavy chain inactivation in mature B cells (65).  Interestingly, when the BCR was altered to express two Igα cytoplasmic domains, mutant B cells developed to maturity but were anergic to T-independent and T-dependent antigens in vivo (66).

 

The distinct phenotypes of mice expressing either cytoplasmically truncated Igα or Igβ demonstrated that although Igα and Igβ are covalently linked and function together to transmit BCR signals, they are not equivalent in their signaling roles.  In mice expressing Igβ truncated after the third amino acid of the cytoplasmic domain, B cell development proceeds up through the immature B stage (67).  In contrast, B cell progression is impaired before the pre-B stage (50% reduction of pre-B cells) and severely impaired beyond it (80% reduction of immature B cells) in mice with a deletion of 40 of the 61 amino acids of the Igα cytoplasmic domain (68).  Furthermore, a negative regulatory role of the Igα cytoplasmic domain was suggested by the observation of increased tyrosine phosphorylation and calcium flux in B cells with cytoplasmically truncated Igα (69;70).  Phosphorylation of serine and threonine residues in the Igα tail has been implicated in such negative signaling (71).

 

As further support that Igα and Igβ mediate different signals, several BCR signaling proteins were found to associate differentially with either Igα or Igβ.  In particular, the cytoplasmic tail of Igα preferentially or exclusively bound to the tyrosine kinases Lyn, Fyn, and Syk over Igβ (72;73).  Igα also bound preferentially to PI-3K and to p52Shc, an adapter that couples BCR signaling to Ras activation.  Consistent with these data, tyrosine kinase activity was strongly activated in B cells expressing a fusion protein containing the CD8α extracellular domain and the Igα cytoplasmic domain, but not the Igβ cytoplasmic domain (74).  Similar data were obtained with a fusion of Igα to a mutant form of mIgM defective for association with either Igα or Igβ (75).  Distinct patterns of calcium signaling have also been observed in response to signaling from Igα or Igβ (76).

Putative Mechanism

The phenotype of crab mice is consistent with a loss of function of Igα.  It is likely that mutation of Cys50, which prevents the formation of an intrachain disulfide bond conserved among Ig superfamily proteins, severely disrupts the folding of the protein.

Primers Primers cannot be located by automatic search.
Genotyping

Crab genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers

Crab (F): 5’- ATTGGTACGGCTCCACTCCTGATG -3’

Crab (R): 5’-TGATCCCTTCTGCTGTGATGATGC -3’

 

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7)  4°C              ∞

 

Primers for sequencing

Crab_seq(F): 5’- GCTCCACTCCTGATGTGAAG -3’

Crab_seq(R): 5’- TTCCCCCATGTCCAGGAAG -3’

 

The following sequence of 663 nucleotides (from Genbank genomic region NC_000073.5 for linear genomic sequence of Cd79a, sense strand) is amplified:

 

1486                                                  attgg tacggctcca

1501 ctcctgatgt gaaggggtct gggctagagc aatcatctcc atctccaggc tctgacccat

1561 ctgtctcctc tcctctctcc acaggtcccg gatgccaggc cctgcgggta gaagggggtc

1621 caccatccct gacggtgaac ttgggcgagg aggcccgcct cacctgtgaa aacaatggca

1681 ggaaccctaa tatcacatgg tggttcagcc ttcagtctaa catcacatgg cccccagtgc

1741 cactgggtcc tggccagggt accacaggcc agctgttctt ccccgaagta aacaagaacc

1801 acaggggctt gtactggtgc caagtgatag aaaacaacat attaaaacgc tcctgtggta

1861 cttacctccg cgtgcgcagt gagtagggag ggcgctggcc tccttgcgtt ccctgctccc

1921 tctttcttcc aaaacattag gagcagagct agctcctccc tcctggacct gccaccagcc

1981 acagagatgg tggcttcagg gctccctgac ctcgcaaggg tcagggctgg gagaagaagg

2041 gacaccagaa tgctgagcag caccctgtct tcacagatcc agtccctagg cccttcctgg

2101 acatggggga aggtaccaag aaccgcatca tcacagcaga agggatca

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.

References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsCarrie Arnold, Elaine Pirie, Bruce Beutler
List |< first << previous [record 85 of 511] next >> last >|
Edit History
08/10/2011 11:53 AM (current)
08/10/2011 11:52 AM
08/09/2011 3:11 PM