Phenotypic Mutation 'thoth' (pdf version)
List |< first << previous [record 12 of 16] next >> last >|
Allelethoth
Mutation Type splice acceptor site (10 bp from exon)
Chromosome6
Coordinate124,873,140 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Cd4
Gene Name CD4 antigen
Synonym(s) L3T4, Ly-4
Chromosomal Location 124,864,692-124,888,221 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein of T lymphocytes that interacts with major histocompatibility complex class II antigenes and is also a receptor for the human immunodeficiency virus. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, and granulocytes. It is also expressed in specific regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013488; MGI: 88335

Mapped Yes 
Amino Acid Change
Institutional SourceAustralian Phenomics Network
Ref Sequences
Ensembl: ENSMUSP00000024044 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_Cterm 425 452 6.8e-15 PFAM
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4+ T cells - decreased
immune system
Penetrance 100% 
Alleles Listed at MGI

All alleles(24) : Targeted, knock-out(5) Targeted, other(8) Gene trapped(6) Spontaneous(2) Chemically induced(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
maat APN 6 124866684 splice acceptor site
seshat APN 6 124872977 missense possibly damaging 0.45
IGL00783:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL00784:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL01294:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01295:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01296:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01298:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01299:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01397:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01401:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01402:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01407:Cd4 APN 6 124879378 missense probably benign 0.41
craw UTSW 6 124867746 nonsense probably null
R0152:Cd4 UTSW 6 124867746 nonsense probably null
R0196:Cd4 UTSW 6 124867806 missense probably damaging 0.97
R1769:Cd4 UTSW 6 124866655 missense possibly damaging 0.71
R1992:Cd4 UTSW 6 124867688 missense possibly damaging 0.59
R2126:Cd4 UTSW 6 124870536 missense probably benign 0.01
R3237:Cd4 UTSW 6 124867670 missense probably benign 0.37
R3706:Cd4 UTSW 6 124879388 missense probably benign
R4535:Cd4 UTSW 6 124870451 missense probably benign 0.01
R5026:Cd4 UTSW 6 124866620 missense possibly damaging 0.95
R5084:Cd4 UTSW 6 124870439 missense probably damaging 1.00
R6628:Cd4 UTSW 6 124879468 missense unknown
R6772:Cd4 UTSW 6 124872458 missense probably benign 0.01
Mode of Inheritance Autosomal Recessive
Local Stock None
Repository

Australian Phenome Bank: 3686

Last Updated 2016-05-13 3:09 PM by Peter Jurek
Record Created 2010-10-05 11:07 AM by Nora G. Smart
Record Posted 2010-10-14
Phenotypic Description

The thoth phenotype was identified in a flow cytometry screen of blood from N-ethyl-N-nitrosourea (ENU)-mutagenized mice.  Homozygous thoth mice display a lack of CD4+ (cluster of differentiation 4) T cells.    

Nature of Mutation
The Cd4 gene was directly sequenced as a candidate gene due to the lack of CD4+ T cells in thoth mice.  The thoth mutation corresponds to a C to A transversion at base pair 124823158 in the Genbank genomic region (Build 37.1) for the Cd4 gene. The mutation is located within intron 3 (intron 2 from the ATG exon), ten nucleotides to the next exon. The Cd4 transcript contains 10 total exons. Multiple transcripts of the Cd4 gene are displayed on Ensembl. The thoth mutation could destroy the acceptor splice site of intron 3 and may result in skipping of exon 4, utilization of the acceptor splice site from intron 4, and an in-frame splice to exon 5 (depicted below).  
 
       <--exon 3  <--intron 3 exon 4-->  exon 5--> <--exon 10
    TTAATTAGAG……TTCGATTTGCAGGAGGTTCGC……TGACCTTC……CTCATCTGA
 70 -L--I--R--              G--G--S-   V--T--F-……-L--I--*  403
     correct                deleted          correct
 
The mutated nucleotide is indicated in red lettering; the acceptor splice site of intron 3 is indicated in blue lettering.
Protein Prediction
Figure 1. Domain structure of CD4. The Cd4 gene encodes a 457 amino acid single-pass type I transmembrane protein that belongs to the immunoglobulin superfamily of molecules. The protein contains a large extracellular region consisting of four immunoglobulin (Ig)-like domains (D1-D4). The most N-terminal of these domains (yellow) shares considerable homology with immunoglobulin κ light-chain variable regions, while the other three domains more closely resemble the constant domains of immunoglobulin molecules. The thoth mutation corresponds to a C to A transversion within intron 3 and likely results in aberrant splicing of the Cd4 transcript. Click on the image to view other mutations found in CD4. Click on each mututation for more specific information.

The Cd4 gene encodes a 457 amino acid single-pass type I transmembrane protein that belongs to the immunoglobulin superfamily of molecules (Figure 1) (1-4).  CD4 is a co-receptor for the T cell receptor (TCR) and both molecules coordinately engage major histocompatibility complex (MHC) class II molecules in antigen presenting cells (APCs) (5;6).  In humans, CD4 is a primary receptor used by the human immunodeficiency virus (HIV) (7-9), and also human herpes virus 7 (10).  The protein contains a large extracellular region consisting of four immunoglobulin (Ig)-like domains (D1-D4).  The most N-terminal of these domains of roughly 100 amino acids shares considerable homology with immunoglobulin κ light-chain variable (V) regions (1), while the other three domains more closely resemble the constant domains of immunoglobulin molecules (4;11).  Similar to classical immunoglobulin domains, D1-D4 contain disulfide bonds between amino acids 42 and 112, 159 and 188, and 328 and 370 (12).  The extracellular domain of the protein is followed by a transmembrane domain at amino acids 395-417, and finally by a short cytoplasmic region (1-4). The mouse and human proteins are 55% identical.

 

Figure 2. Crystal structures of the human D1 and D2 domains. D1 is composed of nine β strands, while D2 has seven β strands.  D1 is composed of two β sheets with strands B, D and E in one and A, C, C’, C”, F and G in another. The last strand of D1 runs continuously into the first strand of D2. The structure of D2 most closely resembles immunoglobulin constant domains with one β sheet of the β sandwich containing strands A, B and E, and the other sheet containing  strands C, C’, F and G. UCSF Chimera model is based on PDB 1CDH, Ryu et al. Structure. 2, 59-74 (1994). Click on the 3D structure to view it rotate.

The D1 domain is used by the human CD4 molecule to bind to the HIV gp120 envelope glycoprotein.  The HIV binding site on the human CD4 molecule has been extensively mapped with most residues involved located between amino acids 46-89 (numbering includes the CD4 signal peptide)(11).  In this region, human CD4 differs significantly from mouse and rat CD4.  A chimaeric CD4 molecule replacing this region of rat CD4 with amino acids 58-87 from human CD4 confers full HIV infectivity in human cells (13). Crystal structures of the human D1 and D2 domains (Figure 2) (PDB IDs 1CDH;3CD4) show that primary sites for HIV interaction are on loops that protrude from the variable-like D1 domain similar to immunologic complementarity-determining regions (CDRs) that can recognize specific molecules.  The D2 domain is closely associated with D1, but has an immunoglobulin constant domain topology although some features are variable-like (11;14).   Both the D1 and D2 domains form β sandwiches with immunoglobulin-strand topology.  D1 is composed of nine β strands, while D2 has seven β strands.  The last strand of D1 runs continuously into the first strand of D2.  D1 is composed of two β sheets with strands B, D and E in one and A, C, C’, C”, F and G in another according to the standard immunoglobulin designations for secondary structural elements.  The topology is quite comparable to variable immunoglobulin domains although the N-terminal half of the A strand is missing in the CD4 D1 domain.  By contrast, the loops between strands in D1 are divergent.  In particular, the loops between strands C and C’ and between F and G are shortened, and the loop between strands C’ and C” is lengthened.  The latter is important for HIV gp120 binding and is contained within the region that has been shown to be important for HIV infection and binding (13).  The structure of D2 most closely resembles immunoglobulin constant domains.  Following standard immunoglobulin nomenclature, one β sheet of the β sandwich contains strands A, B and E, and the other sheet has strands C, C’, F and G.  However, details of the folding are divergent from constant domains, partially due to the relatively smaller size of D2 and consequently shorter strand lengths.  In addition, strand C’ which corresponds sequentially to the D strand of normal constant domains, joins the β sheet consisting of strand C, F, and G, rather than being hydrogen-bonded to strand E in the other sheet.  Finally, D2 has its disulfide bond between strands in the same sheet (C and F) rather than between sheets as is the case for most immunoglobulin domains (11;14).

 

Figure 3. Crystal structure of human CD4 D1 and D2 complexed to  class II MHC. CD4 N-terminal domain is directed toward the two membrane-proximal domains of pMHCII. The C terminus of the CD4 molecule points away from pMHCII.  There are three major binding elements on the N-terminal domain of CD4: Phe 68, the C” strand, and the short α-helical segment between β strands D and E. The backbones of CD4 Lys 71, Leu 69 and pMHCII Ser 144–Gln 146 segments meet to form a twisted, anti-parallel mini β sheet that helps bring the Phe 68 at the beginning of the C” strand into the contact site.  The helical region between β strands D and E of the CD4 N-terminal domain and residues of the pMHCII α2 domain could potentially interact through a series of salt bridges and hydrogen bonds. UCSF Chimera model is based on PDB 1JL4, Wang et al. Proc. Natl. Acad. Sci. USA. 98, 10799-10804 (2001). Click on the 3D structure to view it rotate.

Mutagenesis studies have suggested that residues in the membrane distal D1-D2 module also bind, albeit weakly, to predominantly nonpolymorphic residues of MHC class II moleculesoutside the peptide-binding groove, which interacts with the TCR.(5;15;16).  A crystal structure of human CD4 D1 and D2 in complex with the murine class II molecule I-Ak shows that the CD4 N-terminal immunoglobulin variable region-like domain is directed toward and reaching into the two membrane-proximal domains of the MHC class II molecule (Figure 3, PDB ID 1JL4).  The C terminus of the CD4 molecule points away from the MHC class II protein (pMHCII) so that D2 makes no contact.  There are three major binding elements on the N-terminal domain of CD4: Phe 68, the C” strand, and the short α-helical segment between β strands D and E. These structural elements are located at the ‘‘top corner’’ of the domain, encompassing the C’C” loop.  The aromatic ring of Phe 68 at the beginning of the C” strand is inserted into a site surrounded by a conserved group of hydrophobic pMHCII residues, The second major CD4–MHC class II interaction is between the middle portions of the CD4 C” strand and the pMHCII β2 domain D strand. The backbones of CD4 Lys 71, Leu 69 and pMHCII Ser 144–Gln 146 segments meet to form a twisted, anti-parallel mini β sheet that helps bring the Phe 68 at the beginning of the C” strand into the contact site.  The third interaction site involves the helical region between β strands D and E of the CD4 N-terminal domain and residues of the pMHCII α2 domain. A group of charged and other hydrophilic residues in the contact area for both interacting partners could potentially form a series of salt bridges and hydrogen bonds between the two molecules (17).  The same elements CD4 uses to bind MHC class II molecules, including the key Phe 43 residue, are used to bind to to HIV gp120 (15;18).  Interestingly, this residue is not conserved in mouse CD4.

 

Figure 4. Crystal structure of CD4 D3 and D4. The large D3 domain is structurally homologous to the D1 domain while the smaller D4 fragment resembles D2.  As in the D1-D2 module, the G strand of D3 extends directly into the A strand of D4.  However, the C to C’ and F to G loops of D3 are not shortened as they are in D1. UCSF Chimera model is based on PDB 1CID, Brady et al. Science. 260, 979-983 (1993). Click on the 3D structure to view it rotate.
Figure 5. Crystal structure of the human CD4 extracellular region. The  rod-like structure has a flexible hinge at the D2 to D3 junction and a dimeric association through the D4 domains suggests that CD4 can form dimers or even oligomers. The interface between D2 and D3 is formed by the connecting strand along with the AB loop of D2 and the FG loop of D3, which are more extended than the D4 or D1 equivalents.  UCSF Chimera model is based on PDB 1WIQ, Wu et al. Nature. 387, 527-530 (1997). Click on the 3D structure to view it rotate.

The rat CD4 D3 and D4 domains have structures very similar to those of D1 and D2 (19;20).  The large D3 domain is structurally homologous to the D1 domain while the smaller D4 fragment resembles D2 (Figure 4, PDB ID 1CID).  As in the D1-D2 module, the G strand of D3 extends directly into the A strand of D4.  However, the C to C’ and F to G loops of D3 are not shortened as they are in D1.  Both D3 and D4 in the rat molecule lack intersheet disulfide bonds.  The crystal structure of the entire human CD4 extracellular region shows the molecule as having an extended rod-like structure with a flexible hinge at the D2 to D3 junction and a dimeric association through the D4 domains suggesting that CD4 can form dimers or even oligomers (Figure 5, PDB ID 1WIQ).  The interface between D2 and D3 is formed by the connecting strand along with the AB loop of D2 and the FG loop of D3, which are more extended than the D4 or D1 equivalents.  This interface contains four conserved hydrophobic residues (Leu 134, Leu 202, Leu 225 and Leu 308), and a hydrogen bond between Gln 137 and Gly 306.  The D4 dimerization interface involves residues from the F and G strands and the CC’ loops making direct contact.  At the center of the interface is a pair of conserved glutamine residues (Gln 349), one from each D4 domain (21).  Although this crystal structure suggests that dimerization occurs through the D4 domains, numerous biochemical and modeling studies have suggested that D1 (22-24), D2 (25;26), D3 (27) and the cytoplasmic tail (28) of CD4 may also stabilize or mediate dimerization.  The D3 domain of human CD4 binds to surface-associated protein disulfide isomerase (PDI), which is necessary for HIV entry into the cell [for review see (29)].

 

The cytoplasmic tail of CD4 associates with lymphocyte protein tyrosine kinase (Lck; see the record for iconoclast), a protein that is critical for TCR signaling.  This association is mediated by noncovalent bonds coordinated by a zinc (Zn2+) ion between two cysteines in the N-terminal domain of Lck and two cysteines in the cytoplasmic tail of CD4 (Cys 444 and Cys 446 for mouse CD4) (30-34).  The structure of human CD4-Lck-Zn2+ was determined using nuclear magnetic resonance (NMR) spectroscopy.  Lck folds to form an N-terminal helix, followed by a β hairpin that forms the scaffold for Zn2+ coordination.  An N-terminal helix in CD4 (amino acids 430-439 in the mouse sequence) packs with the Lck helix, while C-terminal residues containing the cysteine motif loop across the Lck hairpin completing the tetrahedral metal coordination (34).  These two cysteines also appear to be important for CD4 dimer formation (28).  The CD4 cytoplasmic tail was also found to interact with ACP33 (acidic cluster protein 3; also known as maspardin) using a yeast two-hybrid assay and coimmunoprecipitation.  The last two conserved hydrophobic amino acids at the C terminus of CD4 are required for this interaction (35).  A dileucine motif in the cytoplasmic domain is required for CD4 interaction with the HIV protein Nef and subsequent endocytosis (36).  Phosphorylation of the CD4 cytoplasmic domain at Ser 432, as well as the presence of surrounding hydrophobic amino acids, is required for phorbol ester-induced internalization (37;38).  Phosphorylation at this site disrupts the binding of Lck to CD4, promoting CD4 endocytosis (39;40).  Both the extracellular and cytoplasmic regions of CD4 appear to associate with various tetraspanins (41), which are membrane scaffolding proteins. 

 

CD4 undergoes N-glycosylation of various residues in its extracellular region, and is also palmitoylated on Cys 418 and Cys 421 (42).  In mouse, a brain-specific isoform has been described missing the first 240 amino acids (2-4)

 

The thoth mutation likely results in aberrant splicing of the Cd4 transcript.  If exon 4 is skipped as described above, a major portion of the D1 domain (amino acids 73-126) would be missing from the protein.  The effect of the splicing mutation on protein expression is unknown.  

Expression/Localization

CD4 is a glycoprotein expressed on the surface of thymocytes, T helper (Th) cells, regulatory T cells (Tregs), monocytes, macrophages, dendritic cells, and hematopoietic cells (43-45).  Additionally, CD4 mRNA is expressed in B cells and granulocytes (4). Two different CD4 mRNAs have been reported in both mouse and human with the smaller mRNA expressed specifically in the brain (1-4).  In mouse, only the smaller mRNA species is expressed in brain specifically in the cortex and striatum, while both human mRNAs are found in human brain.  The levels of brain-specific mouse mRNA rise significantly on postnatal day eleven (4).

 

The association with Lck recruits CD4 to specialized lipid microdomains called lipid rafts that are preferentially associated on cell microvilli (42;46).  Palmitoylation of CD4 also contributes to its enrichment in lipid rafts (42).  Interestingly, CD4 dimers do not appear to localize to lipid rafts, although they can be found in tetraspanin-enriched microdomains on the cell surface (28).  The cell surface expression of human CD4 is downmodulated upon HIV infection due to its removal from the plasma membrane by the HIV Nef protein, which increases clathrin-dependent endocytosis of CD4 and targets it for lysosomal degradation (36;47-49).  Cell surface expression is further downmodulated by the sequestering of CD4 by HIV-1 envelope polyprotein gp160 (the precursor to gp120) in the endoplasmic reticulum (50), and the HIV-1 protein Vpu, which acts by targeting newly-synthesized CD4 in the ER for degradation by cytosolic proteasomes (51;52).

Background
Figure 6. The CD4 N-terminal immunoglobulin variable region-like domain is directed toward the MHC class II molecule while the cytoplasmic tail associates with lymphocyte protein tyrosine kinase, a protein that is critical for TCR signaling. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

CD4 is a co-receptor that assists the TCR during T cell activation following an interaction with an antigen presenting cell carrying a MHC class II molecule  (Figure 6) (5;6).  CD4 was discovered in the late 1970s following the development of the OKT4 monoclonal antibody (53).  A similar monoclonal antibody recognizing mouse CD4 was described in 1983 (44).  Signaling through the T cell receptor (TCR) plays a critical role at multiple stages of thymocyte differentiation, T-cell activation, and homeostasis [reviewed in (54;55)].  This signaling depends on the phosphorylation of immunoreceptor tyrosine-based activation motifs (ITAMS) present on the CD3 (see the record for tumormouse) and ζ chains of the TCR complex [reviewed in (56;57)].  This is achieved by recruiting the tyrosine kinases Lck and Fyn to the receptor complex.  Lck recruitment depends on its association with CD4 or CD8, which recognizes MHC class I molecules (30;31).  Thus, the colocalization of CD4 and the TCR with the same MHC class II molecule brings Lck to the site of immune recognition, and the association of Lck with the TCR is necessary for efficient antigen-induced T cell activation (58;59).  Additional data suggest that CD4 may function to initiate or augment the early stages of T cell activation rather than stabilizing the TCR-MHC interaction (60).  Many studies implicate CD4 dimerization as critical for efficient binding to MHC class II molecules and T cell activation (27;61-64)

 

Figure 7. CD4 in T cell development.

CD4 is an important marker during T cell development (Figure 4).  Development of αβ thymocytes into mature T cells occurs in the thymus through a differentiation program characterized by the expression of certain cell-surface markers including CD4, CD8, CD44 and CD25 [reviewed in (55)].  The most immature stage of thymocyte development is known as the double negative (DN) stage due to the lack of expression of CD4 and CD8.  Differentiation proceeds through several stages known as DN1-4 that differentiate in the following order: CD44+CD25- (DN1) to CD44+CD25+ (DN2) to CD44-CD25+ (DN3) to CD44-CD25- (DN4).  The DN3 stage is the first critical checkpoint during thymocyte development.  Progression and expansion past DN3 requires surface expression of the product of a productive chromosomally rearranged TCRβ chain, which pairs with an invariant pre-TCRα chain and then forms a complex with CD3 and TCRζ.  This complex, known as the pre-TCR, produces a TCR-like signal that requires Lck and Fyn and is necessary for continued survival (65;66).  Interestingly, this stage does not require CD4 or CD8 (67).  After progressing through the DN4 stage, αβ thymocytes express both CD4 and CD8 and are known as double positive (DP) cells.  Progression past this state to single positive CD4 or CD8 cells requires a TCR signal that occurs through a newly rearranged TCRα chain and the previously expressed TCRβ chain.  The strength of interaction of the final TCRαβ receptor to self-MHC molecules expressed on stromal or APCs in the thymus determines whether or not thymocytes are positively selected and survive to become a single positive (SP) CD4 or CD8 T cell.  Strong interactions and increased TCR signaling likely represents autoreactivity and results in negative selection, while moderate interactions indicates usefulness of the TCR and results in positive selection.  Cells that are unable to effectively bind MHC are eliminated.  Interestingly, CD4 associates more strongly with Lck than does CD8 and fusing the transmembrane/cytoplasmic domains of CD4 to the extracellular domain of CD8 diverted a transgenic MHC-I-restricted TCR into the CD4 lineage suggesting that the TCR signal in CD4+ T cells is different and stronger than the one in CD8+ T cells (68).  Increasing Lck activity in transgenic mice is sufficient to promote CD4 commitment and, conversely, decreasing Lck activity can promote CD8 commitment (69;70).  CD4+ cells become several distinct subsets of T cells including T helper cell subsets Th1, Th2, Th3, Th17 and follicular helper (TFH) cells (please see the record for sanroque), as well as Tregs.  Th cells are involved in activating and directing other immune cells such as B cells, macrophages, and neutrophils by producing specific cytokines, while Tregs are important for suppressing autoimmune responses(71), and express the transcription factor FOXP3  (see the record for crusty) (72)

 

Despite the apparent importance of CD4 both in T cell development and activation, CD4 knockout mice mostly have an intact immune system with a normal number of T cells and B cells and early resistance to multiple pathogens (73-77).  CD4-deficient mice are able to develop appropriate antibodies in response to viral infections such as vesicular stomatitis virus (VSV).  Although no CD4+ cells are present in these animals, a significant population of CD4-CD8- (DN) TCR+ cells persist and develop T helper ability suggesting that CD4 is not absolutely necessary for positive selection or effector function of MHC class II-restricted cells (73;74;78).  The development of other immune cells including CD8+ T cells is unaltered in CD4-deficient mice.  However, these mice do have decreased helper cell activity including reduced production of critical cytokines such as interleukin-2 (IL-2), and CD8+ T cells have expanded in the periphery to occupy the compartment otherwise occupied by CD4+ T cells (73).  Although CD4-deficient mice are able to clear initial infection by multiple pathogens, these animals display an increased susceptibility over time (75-77).  This is due to a reduced ability to generate memory cytotoxic (CD8+) T cells (75;77;79).  Examination of clonal T cell populations in animals lacking CD4 also demonstrated that CD4 is needed to broaden the TCR repertoire by potentiating productive TCR signaling and clonal expansion in response to engagement with low-affinity antigens (80).  A spontaneous mouse mutant in Cd4 was found to have a deletion in exon 8 that encodes the transmembrane portion of the molecule.  These mice also lack CD4+ T cells, but display soluble CD4 in their sera and reduced antibody production against T-dependent antigens (81).  Mice lacking both CD4 and CD8 are immunocompromised (82), but still contain significant numbers of αβ cytotoxic T cells (83)

 

CD4 is a primary receptor used by the HIV-1 virus to gain entry into host cells such as macrophages or T cells.  However, viral infection also requires the presence of another surface receptor on the host cell, either the chemokine receptor CCR5 for a macrophage or CXCR4 for a T cell (84-87).  Indeed, only mice that are transgenic for both human CD4 and CXCR4 or human CD4 and CCR5 are susceptible to HIV infection (88-90).  The binding of the HIV gp120 protein to the CD4 changes gp120 conformation allowing HIV-1 to bind to these receptors.  This is mediated by CD4-associated PDI, which is able to reduce structure-stabilizing disulfide bonds in gp120.  A structural change of another viral glycoprotein gp41 allows HIV-1 to insert a fusion peptide into the host cell that allows the outer membrane of the virus to fuse with the cell membrane (29).  HIV infection leads to a progressive reduction in the number of T cells possessing CD4 receptors due to downmodulation of cell surface CD4 as described above (Expression and Localization).  This results in immunodeficiency in infected patients leading to the development of AIDS (acquired immune deficiency syndrome) (91).  Elevated levels of the truncated soluble form of CD4 (sCD4) have been reported in HIV-positive individuals.  This may be due to a feedback mechanism to inhibit HIV replication as sCD4 is able to inhibit the binding of gp120 to cell surface CD4 (92;93).

 

In humans, polymorphism of a CD4 epitope renders the molecule unrecognizable by the classical OKT4 antibody.  Although humans carrying this polymorphism display normal T cell development and immune function in general, deficiency of the T4 epitope in the homozygous state may predispose humans to systemic lupus erythematosus (SLE) with lymphadenopathy as a particular clinical feature (see OMIM 152700) (94).  SLE is a complex, multisystemic autoimmune disorder with multiple causes.  The connection between SLE and CD4 is highlighted by diminished autoimmune disease in a mouse model of lupus lacking CD4 (95).  Many experimental autoimmune diseases appear to be mediated by cytokine-producing CD4+ Th cells.  The lack of CD4 limits disease development in other mouse autoimmune models including experimental allergic encephalomyelitis (EAE) (96), and scurfy mice (97), which have a mutation in Foxp3.  Although Tregs are also CD4+ cells, presumably the lack of Th cells in this model compensates for the lack of Tregs.

 

As mentioned above (Protein Prediction), CD4 associates with a protein known as ACP33 or maspardin.  Mutation of the gene encoding this protein in humans causes Mast syndrome (OMIM 248900), a 'complicated' form of autosomal recessive hereditary spastic paraplegia (SPG21) associated in more advanced cases with dementia and other CNS abnormalities (98).  Truncation of the last two amino acids of CD4, which abrogated its binding to maspardin, enhanced TCR-induced T cell activation, suggesting that ACP33 is a negative regulator of CD4 activity. The CD4-ACP33 complex also associates with Lck although there is no direct interaction between ACP33 and Lck, indicating that ACP33 and LCK interact independently and simultaneously with CD4 (35).

Putative Mechanism

The thoth mutation impairs the splicing of the Cd4 gene. The mutation results in lack of CD4 recognized by antibody on the surface of T cells. Thus, thoth animals lack CD4+ T cells. 

 

Antibodies used to study CD4 bind to extracellular epitopes (44), and it is likely that the thoth splicing mutation will directly affect the ability of these antibodies to bind to a variant CD4 molecule even if it is appropriately expressed on the cell surface as the extracellular structure will probably be altered.  The lack of antibody binding may explain the lack of CD4+ T cells in thoth animals.  Alternatively, the splicing mutation may completely disrupt CD4 expression.  Even if an aberrant CD4 molecule was expressed, it is unlikely to be functional as residues involved in binding to MHC class II molecules would be missing.  It is possible that a small amount of correct splicing occurs in mice homozygous for the thoth allele.  

Primers Primers cannot be located by automatic search.
Genotyping

Genotyping protocols are from the Australian PhenomeBank. 

Thoth

References

 

Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsChristopher C. Goodnow
List |< first << previous [record 12 of 16] next >> last >|
Edit History
2011-03-02 2:45 PM (current)
2011-01-04 2:55 PM
2010-11-15 1:13 PM
2010-11-15 1:12 PM
2010-11-15 1:08 PM
2010-11-15 1:07 PM
2010-11-01 12:36 PM
2010-11-01 12:35 PM
2010-11-01 12:33 PM
2010-11-01 10:38 AM
2010-11-01 10:38 AM
2010-10-27 3:57 PM
2010-10-14 12:28 PM
2010-10-14 11:12 AM
2010-10-14 11:11 AM
2010-10-14 9:42 AM
2010-10-14 9:41 AM
2010-10-14 9:39 AM