Phenotypic Mutation 'dew' (pdf version)
Alleledew
Mutation Type nonsense
Chromosome11
Coordinate34,248,636 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Dock2
Gene Name dedicator of cyto-kinesis 2
Synonym(s) CED-5, MBC, Hch
Chromosomal Location 34,226,815-34,783,892 bp (-)
MGI Phenotype Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells.
Accession Number

NCBI RefSeq: NM_033374; MGI: 2149010

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
Q1439* in Ensembl: ENSMUST00000093193 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Blast:C2 425 542 2e-33 BLAST
low complexity region 582 597 N/A INTRINSIC
Pfam:Ded_cyto 1430 1614 2.4e-35 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Phenotypic Category decrease in CD4+ T cells, decrease in CD8+ T cells, T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All alleles(18) : Targeted(4) Gene trapped(11) Spontaneous(1) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense probably damaging 1.00
IGL00469:Dock2 APN 11 34229603 unclassified noncoding transcript
IGL01061:Dock2 APN 11 34705826 missense probably damaging 1.00
IGL01319:Dock2 APN 11 34698790 missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense probably damaging 0.97
IGL01601:Dock2 APN 11 34239528 unclassified probably null
IGL01800:Dock2 APN 11 34756273 missense probably damaging 1.00
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.01
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense probably damaging 0.98
IGL01830:Dock2 APN 11 34691917 nonsense probably null
IGL01835:Dock2 APN 11 34310435 missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.02
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.28
IGL01989:Dock2 APN 11 34268053 missense probably benign
IGL02081:Dock2 APN 11 34254355 missense probably benign
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.01
IGL02170:Dock2 APN 11 34267949 unclassified probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense probably damaging 0.98
IGL02389:Dock2 APN 11 34698740 unclassified noncoding transcript
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 unclassified probably null
IGL02929:Dock2 APN 11 34268048 missense probably damaging 1.00
IGL02951:Dock2 APN 11 34310448 unclassified noncoding transcript
IGL02999:Dock2 APN 11 34692259 missense probably damaging 0.99
IGL03165:Dock2 APN 11 34687533 missense probably damaging 0.99
Arches UTSW 11 34689760 missense probably damaging 1.00
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
denali UTSW 11 34229472 critical splice donor site probably null
frazz UTSW 11 34248572 critical splice donor site
frizz UTSW 11 34258184 splice acceptor site
liaoning UTSW 11 34708793 missense probably damaging 1.00
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
JAX1:Dock2 UTSW 11 34229472 critical splice donor site probably null
JAX1:Dock2 UTSW 11 34438327 missense probably damaging 1.00
JAX1:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R0006:Dock2 UTSW 11 34312453 splice site noncoding transcript
R0012:Dock2 UTSW 11 34783795 missense possibly damaging 0.51
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 splice site noncoding transcript
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.30
R0538:Dock2 UTSW 11 34704718 splice site noncoding transcript
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably damaging 0.99
R0722:Dock2 UTSW 11 34464970 splice acceptor site noncoding transcript
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.78
R1121:Dock2 UTSW 11 34756291 splice acceptor site noncoding transcript
R1171:Dock2 UTSW 11 34695241 missense probably damaging 1.00
R1387:Dock2 UTSW 11 34273309 splice acceptor site
R1435:Dock2 UTSW 11 34718836 splice donor site noncoding transcript
R1445:Dock2 UTSW 11 34239705 missense probably benign
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense probably damaging 0.99
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1616:Dock2 UTSW 11 34363848 splice donor site
R1629:Dock2 UTSW 11 34262480 splice acceptor site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.25
R1924:Dock2 UTSW 11 34464934 missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34727470 splice acceptor site noncoding transcript
R2045:Dock2 UTSW 11 34294106 splice donor site
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.16
R2098:Dock2 UTSW 11 34719005 missense probably damaging 0.99
R2129:Dock2 UTSW 11 34727415 missense probably damaging 1.00
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2185:Dock2 UTSW 11 34227740 splice acceptor site noncoding transcript
R2230:Dock2 UTSW 11 34294323 missense probably damaging 0.99
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 unclassified noncoding transcript
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 unclassified probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
R6155:Dock2 UTSW 11 34294123 missense probably benign 0.06
R6156:Dock2 UTSW 11 34247789 missense possibly damaging 0.51
R6173:Dock2 UTSW 11 34262388 missense probably null 0.80
R6182:Dock2 UTSW 11 34229476 missense probably damaging 0.97
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.08
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0022:Dock2 UTSW 11 34261564 splice acceptor site probably benign
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm
MMRRC Submission 036803-MU
Last Updated 03/21/2017 3:07 PM by Katherine Timer
Record Created 10/11/2010 7:39 PM by Carrie N. Arnold
Record Posted 01/29/2013
Other Mutations in This Stock Stock #: I2505 Run Code: SLD00273
Validation Efficiency: 113/115

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
Rnf219 T to A 14: 104,503,449 probably benign Het
Rxrb T to C 17: 34,033,549 noncoding transcript Het
Zfp738 C to T 13: 67,673,067 V64I probably benign Het
Phenotypic Description
Figure 1. The dew mouse was identified in a T-dependent Humoral Response Screen of N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice (red dots).

Figure 2. The dew mice (V7590, V7597, V7592, and V7594) do not exhibit a T-dependent IgG response.

Figure 3. CD4+ and CD8+ T cells are depleted in the dew mice (green bars). Other hematopoietic cell types are not significantly affected.

The dew mutation was identified in a T-dependent Humoral Response Screen of N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice (Figure 1).  The dew mice lack a T-dependent IgG response (Figure 2); the T-independent IgM response is normal. Fluorescence activated cell sorting (FACS) analysis determined that CD4+ and CD8+ T cells are depleted in the dew mice (Figure 3). 

Nature of Mutation

Whole genome sequencing of a homozygous dew mouse using the SOLiD technique identified a C to T transition at base pair 34148636 on Chromosome 11 in the GenBank genomic region NC_000077 encoding Dock2. The mutation corresponds to residue 4367 of the mRNA sequence NM_033374 in exon 43 (of 52).

 

4380 ACAAGTCTAATTATGTGCAAAAGTTCCACTACTCC

1433 Y--K--S--N--Y--V--Q--K--F--H--Y--S-

 

The mutated nucleotide is indicated in red lettering and results in substitution of glutamine (Q) 1439 for a premature stop codon.

Protein Prediction
Figure 5. Domain structure of mouse DOCK2, a member of the DOCK A subfamily. DOCK A proteins contain an N-terminal SH3 domain. SH3-containing DOCK proteins have been shown to interact physically with the scaffolding proteins engulfment and cell motility protein 1 (ELMO1) and ELMO2, significantly promoting Rac activation. DHR-1 domain shares weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac. The dew mutation results in substitution of glutamine (Q) 1439 for a premature stop codon. Click on the image to view other mutations found in DOCK2. Click on each mututation for more specific information.

The dew mutation results in a coding of a premature stop codon at amino acid 1439 within the catalytic DOCK homology region 2 (DHR-2), a domain essential for the interaction of Dock2 with GTPases [Figure 5(1;2)].

 

For more information on Dock2, see the record for frazz.

Primers Primers cannot be located by automatic search.
Genotyping
Figure. DNA sequencing trace of the Chr. + strand.
Dew genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 
 
Primers
Dew(F): 5’- AGAAGACCCAGTAGACTTGTCACCC -3’
Dew(R): 5’- AATGCCAGAATTGCAAATGCCCAG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for sequencing
Dew_seq(F): 5'- AGTAGACTTGTCACCCTATCTGG -3'
 

The following sequence of 415 nucleotides is amplified (Chr. 11: 34248432-34248846, GRCm38.; NC_000077):

 

agaagaccca gtagacttgt caccctatct gggatgtcca tgtagtattc actccctggc
tctggatcaa gctgccccca cctgtggttg gcagaggtgt gttctggttg ctgaagatgg
ctgaggaggg gattatactc acagcaaact cgttctctgg gtctaccttg cccctgcgca
caggcctgga gtagtggaac ttttgcacat aattagactt gtaaaagctg aaagacagaa
aggagtagaa gtttctggaa gccatgctac ccatccactg aaaccttaaa catcaggtct
ggcagggccc tggcagtggc atttcaaggt ctgagttggg gcttcataaa aagtgatttg
cacagggttg cagggtgatt tagaagccac cctgggcatt tgcaattctg gcatt

 

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated nucleotide is indicated in red (G>A on Chr. + strand; C>T on sense strand).

References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsCarrie Arnold, Elaine Pirie, Ming Zeng and Bruce Beutler