Phenotypic Mutation 'maat' (pdf version)
List |< first << previous [record 14 of 16] next >> last >|
Allelemaat
Mutation Type splice acceptor site (13 bp from exon)
Chromosome6
Coordinate124,866,684 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Cd4
Gene Name CD4 antigen
Synonym(s) L3T4, Ly-4
Chromosomal Location 124,864,692-124,888,221 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein of T lymphocytes that interacts with major histocompatibility complex class II antigenes and is also a receptor for the human immunodeficiency virus. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, and granulocytes. It is also expressed in specific regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Accession Number
Mapped Yes 
Amino Acid Change
Institutional SourceAustralian Phenomics Network
Ref Sequences
Ensembl: ENSMUSP00000024044 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_Cterm 425 452 6.8e-15 PFAM
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4+ T cells - decreased
immune system
Penetrance 100% 
Alleles Listed at MGI

All alleles(24) : Targeted, knock-out(5) Targeted, other(8) Gene trapped(6) Spontaneous(2) Chemically induced(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
seshat APN 6 124872977 missense possibly damaging 0.45
thoth APN 6 124873140 splice acceptor site
IGL00783:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL00784:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL01294:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01295:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01296:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01298:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01299:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01397:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01401:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01402:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01407:Cd4 APN 6 124879378 missense probably benign 0.41
craw UTSW 6 124867746 nonsense probably null
R0152:Cd4 UTSW 6 124867746 nonsense probably null
R0196:Cd4 UTSW 6 124867806 missense probably damaging 0.97
R1769:Cd4 UTSW 6 124866655 missense possibly damaging 0.71
R1992:Cd4 UTSW 6 124867688 missense possibly damaging 0.59
R2126:Cd4 UTSW 6 124870536 missense probably benign 0.01
R3237:Cd4 UTSW 6 124867670 missense probably benign 0.37
R3706:Cd4 UTSW 6 124879388 missense probably benign
R4535:Cd4 UTSW 6 124870451 missense probably benign 0.01
R5026:Cd4 UTSW 6 124866620 missense possibly damaging 0.95
R5084:Cd4 UTSW 6 124870439 missense probably damaging 1.00
R6628:Cd4 UTSW 6 124879468 missense unknown
R6772:Cd4 UTSW 6 124872458 missense probably benign 0.01
Mode of Inheritance Autosomal Recessive
Local Stock None
Repository

Australian Phenome Bank:     5111  

Last Updated 2016-05-13 3:09 PM by Peter Jurek
Record Created 2010-10-14 11:29 AM by Nora G. Smart
Record Posted 2010-10-14
Phenotypic Description

The maat phenotype was identified in a flow cytometry screen of blood from N-ethyl-N-nitrosourea (ENU)-mutagenized mice.  Homozygous maat mice display reduced numbers of peripheral T cells and reduced CD4+ (cluster of differentiation 4) expression.    

Nature of Mutation

The Cd4 gene was directly sequenced as a candidate gene due to the reduced expression of CD4in maat mice.  The maat mutation corresponds to a T to A transversion at genomic position 124816702 (Build 37.1) for the Cd4 gene. The mutation is located within intron 8 (intron 7 from the ATG exon), thirteen nucleotides to the next exon. The Cd4 transcript contains 10 total exons. Multiple transcripts of the Cd4 gene are displayed on Ensembl. The maat mutation could affect the acceptor splice site of intron 3 and may result in skipping of exon 9, utilization of the acceptor splice site from intron 9, and an in-frame splice to exon 10 (depicted below).  

 

       <--exon 8    <--intron 8 exon 9--> exon 10--> <--exon 10

     CACCAACAG……TGTCCCTGGGCAGCGCCAGGCA……CCGGATGCAGAAGAGCCATAA
422  -H--Q--Q-               -R--Q--A-  -P--D--A--E--E--P--*  430 

      correct                 deleted         incorrect

 

The mutated nucleotide is indicated in red lettering; the acceptor splice site of intron 8 is indicated in blue lettering.

Please see the record for thoth for more information on Cd4.

Protein Prediction
Figure 1. Domain structure of CD4. The Cd4 gene encodes a 457 amino acid single-pass type I transmembrane protein that belongs to the immunoglobulin superfamily of molecules. The protein contains a large extracellular region consisting of four immunoglobulin (Ig)-like domains (D1-D4). The most N-terminal of these domains (yellow) shares considerable homology with immunoglobulin κ light-chain variable regions, while the other three domains more closely resemble the constant domains of immunoglobulin molecules. The maat mutation corresponds to a T to A transversion within intron 8 and likely results in aberrant splicing of the Cd4 transcript. Click on the image to view other mutations found in CD4. Click on each mututation for more specific information.

 

Putative Mechanism

The low CD4 expression levels and reduced CD4+ T cells in homozygous maat mice suggests that the maat mutation affects splicing and subsequent expression of the Cd4 gene.  The effect of the splicing defect on protein expression is unknown.

Primers Primers cannot be located by automatic search.
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsChristopher C. Goodnow
List |< first << previous [record 14 of 16] next >> last >|
Edit History
2011-01-04 2:52 PM (current)
2010-11-15 1:09 PM
2010-10-27 3:58 PM
2010-10-14 2:19 PM
2010-10-14 1:09 PM
2010-10-14 1:08 PM
2010-10-14 12:31 PM
2010-10-14 11:29 AM