Phenotypic Mutation 'maat'

• Allele: maat
• Mutation Type: unclassified (13 bp from exon)
• Chromosome: 6
• Coordinate: 124,843,647 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Cd4
• Gene Name: CD4 antigen
• Synonym(s): Ly-4, L3T4
• Chromosomal Location: 124,841,655-124,865,184 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein of T lymphocytes that interacts with major histocompatibility complex class II antigenes and is also a receptor for the human immunodeficiency virus. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, and granulocytes. It is also expressed in specific regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Aug 2010] ; PHENOTYPE: Mice homozygous for knock-out alleles exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Australian Phenomics Network
• Gene Model: not available
• AlphaFold: P06332
• SMART Domains: Protein: ENSMUSP00000024044; Gene: ENSMUSG00000023274

Domain	Start	End	E-Value	Type
low complexity region	6	21	N/A	INTRINSIC
IGv	37	114	7.02e-8	SMART
IG	131	206	3.63e-1	SMART
IG	212	317	3.36e0	SMART
transmembrane domain	394	416	N/A	INTRINSIC
Pfam:Tcell_CD4_C	425	452	2.2e-18	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000024044; Gene: ENSMUSG00000023274

Domain	Start	End	E-Value	Type
low complexity region	6	21	N/A	INTRINSIC
IGv	37	114	7.02e-8	SMART
IG	131	206	3.63e-1	SMART
IG	212	317	3.36e0	SMART
transmembrane domain	394	416	N/A	INTRINSIC
Pfam:Tcell_CD4_C	425	452	2.2e-18	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: None
• Last Updated: 2016-05-13 3:09 PM by Peter Jurek
• Record Created: 2010-10-14 11:29 AM by Nora G. Smart
• Record Posted: 2010-10-14
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Christopher C. Goodnow

Alleles Listed at MGI

All alleles(24) : Targeted, knock-out(5) Targeted, other(8) Gene trapped(6) Spontaneous(2) Chemically induced(3)

Repository

Australian Phenome Bank:     5111  

Phenotypic Description

The maat phenotype was identified in a flow cytometry screen of blood from N-ethyl-N-nitrosourea (ENU)-mutagenized mice.  Homozygous maat mice display reduced numbers of peripheral T cells and reduced CD4⁺ (cluster of differentiation 4) expression.    

Nature of Mutation

The Cd4 gene was directly sequenced as a candidate gene due to the reduced expression of CD4in maat mice.  The maat mutation corresponds to a T to A transversion at genomic position 124816702 (Build 37.1) for the Cd4 gene. The mutation is located within intron 8 (intron 7 from the ATG exon), thirteen nucleotides to the next exon. The Cd4 transcript contains 10 total exons. Multiple transcripts of the Cd4 gene are displayed on Ensembl. The maat mutation could affect the acceptor splice site of intron 3 and may result in skipping of exon 9, utilization of the acceptor splice site from intron 9, and an in-frame splice to exon 10 (depicted below).  

 

       <--exon 8    <--intron 8 exon 9--> exon 10--> <--exon 10

     CACCAACAG……TGTCCCTGGGCAGCGCCAGGCA……CCGGATGCAGAAGAGCCATAA

422  -H--Q--Q-               -R--Q--A-  -P--D--A--E--E--P--*  430 

      correct                 deleted         incorrect

 

The mutated nucleotide is indicated in red lettering; the acceptor splice site of intron 8 is indicated in blue lettering.

Please see the record for thoth for more information on Cd4.

Protein Prediction

Figure 1. Domain structure of CD4. The Cd4 gene encodes a 457 amino acid single-pass type I transmembrane protein that belongs to the immunoglobulin superfamily of molecules. The protein contains a large extracellular region consisting of four immunoglobulin (Ig)-like domains (D1-D4). The most N-terminal of these domains (yellow) shares considerable homology with immunoglobulin κ light-chain variable regions, while the other three domains more closely resemble the constant domains of immunoglobulin molecules. The maat mutation corresponds to a T to A transversion within intron 8 and likely results in aberrant splicing of the Cd4 transcript. Click on the image to view other mutations found in CD4. Click on each mututation for more specific information.

Putative Mechanism

The low CD4 expression levels and reduced CD4⁺ T cells in homozygous maat mice suggests that the maat mutation affects splicing and subsequent expression of the Cd4 gene.  The effect of the splicing defect on protein expression is unknown.

Primers

Primers cannot be located by automatic search.