Phenotypic Mutation 'kenny'

• Allele: kenny
• Mutation Type: nonsense
• Chromosome: 7
• Gene: Muc2
• Gene Name: mucin 2
• Synonym(s): 2010015E03Rik
• Chromosomal Location: 141,276,583-141,308,428 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016] ; PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Serine changed to Stop codon
• Institutional Source: Australian Phenomics Network
• Ref Sequences:
  S1281* in Ensembl: ENSMUSP00000026590
• Gene Model: not available
• AlphaFold: no structure available at present
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.100)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: None
• Last Updated: 2018-04-25 11:21 AM by Anne Murray
• Record Created: 2010-10-14 12:39 PM by Nora G. Smart
• Record Posted: 2010-10-14
• Science Writers: Nora G. Smart
• Illustrators: Diantha La Vine
• Authors: Christopher C. Goodnow

Accession Number

Ensembl: ENSMUST00000026590; MGI: 1339364 

Alleles Listed at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(2) Chemically induced(4)

Repository

Australian Phenome Bank: 2441

Phenotypic Description

The kenny phenotype was identified amongst the G3 progeny of an ENU-treated C57BL/6 founder by their visible phenotype of spontaneous watery diarrhoea and high incidence of rectal bleeding and prolapse, suggestive of ulcerative colitis. 

Nature of Mutation

The kenny mutation corresponds to a C to A transversion at position 3842 of the Muc2 transcript ENSMUST00000026590 in exon 31 of 48 total exons.

3826 ACTCCTTCAACTATCTCACCTACAACTTCAACA

1276 -T--P--S--T--I--S--P--T--T--S--T-

The mutated nucleotide is indicated in red lettering, and causes a premature stop codon at serine 1281 of the MUC2 protein (amino acid 1394 according to Uniprot Q80Z19).

Protein Prediction

Figure 1.  Domain structure of Mucin2. The kenny mutation causes a serine to premature stop in the TR2 domain of the MUC2 protein. S=Signal sequence; D=D domains (homology to VWF mediates trimerization); CR=Cystein-rich domain; TR= Tandem repeat domain (heavily O glycosylated); GDPH=GDPH autocatalytic proteolytic site; B=B domain (homology to VWF); C= C domain (homology to VWF); CK= Cysteine-knot domain (homology to VWF mediates dimerization). This image is interactive. Click on the image to view other mutations found in Mucin2 (red). Click on the mutations for more specific information.

The kenny mutation prematurely truncates the MUC2 protein following the third VWF-like domain and first cysteine-rich (CR) domain (Figure 1).  This would truncate most of the protein and likely leads to nonsense-mediated protein decay. The effects of the mutation on protein expression are unknown.

For more information about Muc2, please see the record for Schlendrian.

Putative Mechanism

Due to the premature truncation of the MUC2 protein, the kenny mutation is likely to represent a null allele. However, the possibility remains that truncated MUC2 is expressed, in which case it will undergo aberrant oligomerization due to the lack of critical domains important for this function.  Aberrantly oligomerized MUC2 has been shown to accumulate in the endoplasmic reticulum (ER), which leads to ER stress, triggering of the unfolded protein response (UPR), subsequent inflammation and goblet cell apoptosis (1).  

Primers

Primers cannot be located by automatic search.

References

1. Heazlewood, C. K., Cook, M. C., Eri, R., Price, G. R., Tauro, S. B., Taupin, D., Thornton, D. J., Png, C. W., Crockford, T. L., Cornall, R. J., Adams, R., Kato, M., Nelms, K. A., Hong, N. A., Florin, T. H., Goodnow, C. C., and McGuckin, M. A. (2008) Aberrant Mucin Assembly in Mice Causes Endoplasmic Reticulum Stress and Spontaneous Inflammation Resembling Ulcerative Colitis. PLoS Med. 5, e54.