Phenotypic Mutation 'deer'

• Allele: deer
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 124,134,697 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Mc1r
• Gene Name: melanocortin 1 receptor
• Synonym(s): e, Mshra, extension recessive yellow, Mcr1
• Chromosomal Location: 124,133,846-124,137,483 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mutant alleles at this locus extend or restrict the amount of black pigment (eumelanin) in hair with the opposite effect on yellow pigment (phaeomelanin). Some variants affect pain sensitivity. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: Q01727
• SMART Domains: Protein: ENSMUSP00000095929; Gene: ENSMUSG00000074037; AA Change: Y150C

Domain	Start	End	E-Value	Type
Pfam:7tm_4	43	188	1.3e-13	PFAM
Pfam:7TM_GPCR_Srsx	47	311	1e-7	PFAM
Pfam:7tm_1	53	296	2.7e-31	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000098324)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Unknown
• Penetrance: 100%
• Mode of Inheritance: Unknown
• Local Stock: Sperm, gDNA
• Last Updated: 2016-05-13 3:09 PM by Stephen Lyon
• Record Created: 2011-01-04 6:29 PM by Amanda L. Blasius
• Record Posted: 2011-07-21
• Science Writers: Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Amanda L. Blasius and Bruce Beutler

Accession Number

Genbank: NM_008559; MGI: 99456

Alleles Listed at MGI

All alleles(10) : Targeted, knock-out(2) Spontaneous(6) Chemically induced(2) 

Repository

none

Phenotypic Description

The index mouse was identified among ENU-mutagenized G3 mice by its tan colored fur (Figure 1).  The coat color fades gradually from darker tan on the dorsal surface to ligher tan on the ventral surface.

Nature of Mutation

The candidate gene Mc1r was sequenced, and an A to G transition was identified at position 877 of the Mc1r transcript, within the only exon.

861 TTCTATGCGCTGCGTTATCACAGCATCGTGACG

145 -F--Y--A--L--R--Y--H--S--I--V--T-

The mutated nucleotide is indicated in red lettering, and results in substitution of tyrosine 150 with cysteine.

Protein Prediction

The melanocortin 1 receptor (Mc1r) is one of five members of the melanocortin receptor (MCR) subfamily of G protein-coupled receptors (GPCRs).  MCRs are activated by several structurally related peptide hormones, including α-melanocyte-stimulating hormone (α-MSH) and adrenocorticotropic hormone (ACTH), all of which are generated through multiple cleavages of a single precursor protein, proopiomelanocortin (POMC).  With the exeption of Mc2r, which displays a strong selectivity for ACTH, the MCRs each bind with different affinities to several melanocortin ligands.  In some cases, MCRs also bind to endogenous antagonist proteins that modulate signaling through the receptor.  The five MCRs are 39% to 61% identical to each other at the amino acid level.  Mc1r is approximately 44% identical to Mc3r, Mc4r, and Mc5r, and 38% identical to Mc2r (referring to mouse sequences).  76.8% identity exists between mouse (315 amino acids) and human (317 amino acids) Mc1r.

Figure 2. GPCR activation cycle. In the receptor inactive state (top), the α subunit and the βγ complex of the G protein are associated. Upon agonist binding (right), the receptor undergoes a confirmational change that activates its GEF activity, and it catalyzes the exchange of GDP for GTP on the Gα subunit. GTP-bound Gα and the βγ complex dissociate and activate downstream signaling (bottom). Hydrolysis of GTP to GDP, which may be stimulated by RGS proteins, leads to reassociation of Gα and βγ subunits and termination of G protein signaling (left).

GPCRs recruit and regulate the activity of heterotrimeric G proteins, which consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex [reviewed in (1)] (Figure 2).  In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated.  Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit.  GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex.  Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels.  Gα signaling is terminated upon GTP hydrolysis, an activity intrinsic to Gα and which may be stimulated by GTPase activating proteins (GAPs) such as regulators of G protein signaling (RGS) proteins.  The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle.  Ligand-induced phosphorylation of the GPCR by G protein coupled receptor kinases (GRKs) leads to sequestration of the receptor from the cell surface thereby downregulating signaling.

Figure 3. Domain structure and topography of mouse Mc1r. Residues of known importance are noted. The deer mutation causes substitution of tyrosine 150 with cysteine.

Like other GPCRs, Mc1r is an integral membrane protein with an extracellular N terminus, seven transmembrane domains, and an intracellular C terminus (Figure 3).  Aside from this structural topology, GPCRs do not share significant overall sequence similarity.  The greater than 1,000 GPCRs are divided into six classes based on the presence of a few key residues conserved within each class (2).  Mc1r is a member of the largest class of GPCRs, Class A, also known as rhodopsin-like receptors.  Class A receptors share a conserved Asp-Arg-Tyr motif on the cytoplasmic side of transmembrane segment 3; most receptors of Class A also have a disulfide bridge connecting the second and third extracellular loops, and a palmitoylated cysteine in the C-terminal tail (2).  Based on phylogenetic analysis, Class A receptors are classified into nineteen subgroups (A1-A19), with Mc1r belonging to Class A13, which includes cannabinoid receptors, lysophosphatidic acid receptors, and sphingosine 1-phosphate receptors (3). 

The roles of particular residues and regions of Mc1r have been investigated by sequence analysis and site-directed mutagenesis studies [reviewed in (4)].  (Residue numbers correspond to the human Mc1r sequence.)  Both the N terminus and the extracellular loops contribute minimally to ligand binding.  Mutations of Glu269 and Thr272 in extracellular loop 3, or Ser6 in the N terminus, have been reported to lower the binding affinity for agonists (5).  The extracellular loops also appear to be important for stabilization of Mc1r structure through disulfide bonding between several highly conserved cysteine residues.  These include Cys267 and Cys275, residues that are conserved in all MCRs, and are thought to link transmembrane helices 6 and 7 (6-8).  Another cysteine at position 273 may be a binding site for Zn(II), which acts as a partial agonist and as an enhancer for α-MSH activation of Mc1r (7).  Cys273 and Cys35 in the N terminal tail are also conserved in all MCRs, and mutation to Gly or Ala inactivates the receptor (6;9).  Interestingly, the N terminus of Mc1r does not contain a membrane localization signal sequence.  This is supported by the finding that deletion of the first 27 amino acids of Mc1r did not affect ligand binding or expression levels in transfected cells (10), and that cleavage of the N terminus is not observed when tracked using a Flag epitope fused to the Mc1r N terminus (11).

The intracellular loops and intracellular C terminal tail of Mc1r interact with the G protein Gs (12).  At least eight naturally occurring mutations are found in intracellular loop 2, five of which cause loss of function and result in a red hair phenotype in humans (13).  Several red hair-causing intracellular loop 2 mutations showed reduced cell surface expression due to retention of the mutant proteins in the endoplasmic reticulum (ER) and cis-Golgi compartments (14); trafficking of Mc1r thus appears to depend critically on the integrity of intracellular loop 2.  The Asp-Arg-Tyr motif characteristic of Class A GPCRs is located at the interface between transmembrane helix 3 and intracellular loop 2; mutation of the Arg within this motif causes red hair in humans (15). 

The C terminus of Mc1r is also important for proper cell surface expression of the receptor.  Deletion of the last five amino acids of the C terminus abolished cell surface expression, although intracellular expression remained (9;16).  Mutation of Cys315, the third to last residue in the C terminus, resulted in lack of response to α-MSH despite ligand binding (6;16).  As mentioned above, C terminal tail cysteine residues are often palmitoylated in Class A GPCRs (17), and mutation of Cys315 in Mc1r may impair receptor stability at the membrane or trafficking by preventing palmitoylation.  Finally, the C terminus may be phosphorylated by GRKs, leading to desensitization or internalization of the receptor (18).

Figure 4. 3D model of melanocortin-4 receptor. The crystal structure of MC1R has not been reported. The tyrosine corresponding to the deer mutation in Mc1r is indicated. UCSF Chimera model is based on PDB 2IQR. Click on the 3D structure to view it rotate.

Residues near the extracellular side of transmembrane domains in Mc1r harbor the main ligand binding site of the receptor.  Modeling and mutagenesis studies suggest that a charged region containing Glu94, Asp117, and Asp121 (located in transmembrane helices 2 and 3) interacts with the Arg residue of the His-Phe-Arg-Trp pharmacophore core common to all of the natural melanocortins (19;20).  In addition, aromatic residues including Phe175, Phe 196, and Phe257 (located in transmembrane helices 4, 5, and 6) interact with aromatic residues in the ligand.  Based on biophysical data and molecular dynamics simulations obtained from studies of multiple GPCRs, a model of GPCR activation has been proposed (21;22).  The ‘global toggle switch model’ proposes that during receptor activation a vertical see-saw movement occurs in which transmembrane helix 6 (and perhaps helices 5 and 7) pivots around a point anchored by highly conserved proline residues.  This results in an inward movement of the extracellular portions of the transmembrane helices (towards the receptor center) brought about by ligand or small molecule agonist binding, and an outward movement of the intracellular portions of the transmembrane helices (away from the receptor center) that permits G protein binding.  The global switch that occurs during activation is mediated by an allosteric conformational change mediated by ‘micro-switches’ consisting of single residues that adopt a distinct conformation upon activation, and a hydrogen bond network between conserved polar residues and water molecules.

The crystal structure of Mc1r has not been reported (Figure 4).  Two- and three-dimensional models of Mc1r (23-26) have been computer-generated, based on the electron microscopy structure of bacteriorhodopsin (27) or the crystal structure of rhodopsin (28).

The deer mutation is a tyrosine to cysteine substitution of residue 150 of Mc1r, located in the second intracellular loop that is commonly mutated in red-haired humans.

Expression/Localization

Mc1r expression is confined to the skin, where it is found largely in melanocytes (29;30), and also in keratinocytes, fibroblasts, endothelial cells, and some immune cell types (31).

Background

Melanogenesis

Pigmentation of mammalian hair, skin, and eyes is determined by the quantity and type of melanin synthesized in melanocytes, within specialized lysosome-related organelles called melanosomes.  Melansomes are transported along microtubule and actin filaments to the ends of melanocyte dendrites for export to neighboring keratinocytes, where melanin then accumulates in the perinuclear area in the form of supranuclear caps believed to protect DNA from ultraviolet radiation (32).  Multiple proteins are required for proper melansome biogenesis, including Oca2 (see quicksilver), Slc45a2 (see cardigan), and components of the BLOC-1 (see salt and pepper and minnie), BLOC-2 (see pam gray, toffee, stamper-coat), and AP-3 complexes (see bullet gray); proteins required for melanosome transport include Rab27a (see concrete), melanophilin (see koala), and myosin Va (see new gray).  Mice with homozygous mutations of these proteins are typically hypopigmented.

Distinct from melanosome biogenesis and transport is the process of melanin synthesis itself, or melanogenesis, which occurs within melanosomes to produce two types of melanin with differing chemical compositions and colors (33): eumelanin (black to brown) and pheomelanin (yellow to reddish brown).  Eumelanin is a heterogeneous polymer consisting of 5,6-dihydroxyindole (DHI)- and 5,6-dihydroxyindole-2-carboxylic acid (DHICA)-derived units joined together through as yet unknown molecular bonds (34;35).  Pheomelanin consists of sulfur-containing benzothiazine and benzothiazole derivatives (36).  The quantity and the ratio of eumelanin to pheomelanin within melanosomes specifies the color of hair, skin, and eyes (37).  Thus, 99% of the melanin in black, brown, light brown, and blond human hair consists of eumelanin, with lighter hair containing a fraction of the eumelanin found in black hair.  Only red hair contains significant amounts of pheomelanin; in this case pheomelanin and eumelanin are found in comparable amounts, with eumelanin present at approximately 30% of the level in black hair.  In mice, eumelanin and pheomelanin give hair a black or yellow color, respectively.  The agouti phenotype of wild type mice results from a transient switch by melanocytes from eumelanin to pheomelanin production early in the hair growth cycle to produce a yellow band close to the tip of otherwise black hairs.  Although human hair does not have the banded appearance of agouti mouse hair, homologues of many mouse pigmentation genes exist in humans and affect pigmentation.

The genetics of pigmentation has been extensively studied in mice, and at least 375 genes are known to affect mouse coat color [reviewed in (38)].  Of these, less than twenty are directly involved in melanin production or regulation of the eumelanin:pheomelanin ratio.  The biochemical pathway for melanin synthesis begins with dopaquinone, which is produced from tyrosine by the product of the Tyrosinase (Tyr) gene (Figure 5B).  Both eumelanin and pheomelanin derive from dopaquinone, making tyrosinase the key determinant of total melanin production.  While pheomelanin production proceeds spontaneously after dopaquinone production (as long as cysteine is present), the enzymes dopachrome tautomerase (Dct) and Tyrp1 are further required for eumelanin production.

Mc1r regulates pigment type switching

Pigment type switching between eumelanogenesis and pheomelanogenesis is controlled by the pigment type switching pathway that has at its head the melanocortin-1 receptor [reviewed in (39)].  When activated in both humans (40) and mice, Mc1r promotes cAMP production that leads to induction of a transcriptional program for eumelanogenesis.  In its inactive state, cAMP levels remain low and pheomelanogenesis is favored.  Thus, a truncation mutant of mouse Mc1r, extension, results in yellow fur, whereas a constitutively active mutant called somber produces black fur (41).  In humans, loss of function and null mutations in MC1R cause red hair and fair skin; most instances of red hair are believed to be caused by such mutations (13;42).  Polymorphisms of human MC1R, many associated with red hair, have been identified as low-penetrance risk factors for melanoma, although the role of MC1R in melanoma development remains unclear and controversial (43).  Mc1r gene expression is induced by multiple stimuli, including α-MSH and ACTH (44;45), and by UV radiation through the induction of α-MSH (46), growth factors (bFGF, endothelin-1) and cytokines (interleukin-1) (47-49) produced by melanocytes and/or keratinocytes.

Mouse and human Mc1r in vitro exhibit a high level of activity even in the absence of agonists (50).  These findings are consistent with the observation in vivo that black nonagouti (a/a) mice lacking POMC are just as black as nonagouti mice expressing POMC (51), and that agouti (A/A) mice lacking POMC are only slightly more yellow than when they express POMC (52).  Thus, intrinsic signaling from Mc1r in mice is sufficient to drive eumelanogenesis resulting in a dark coat; pheomelanogenesis requires the reduction of intrinsic Mc1r signaling by the antagonist agouti signaling protein (see below).  In contrast, humans with rare mutations of POMC have red hair (53), suggesting that agonist-dependent signaling from human MC1R is necessary to drive eumelanogenesis.

Figure 5. Mc1r signaling. (A) (Left) α-MSH activates MC1R, leading to GDP/GTP exchange on the G-protein heterotrimer. The GTP-bound Gα subunit is released and activates adenylyl cyclase (AC). AC catalyzes the production of cAMP, activating the CREB family of transcription factors to upregulate genes such as MITF, which in turn regulates pigmentation genes tyrosinase, Tyrp1, and Dct. (Middle) ASP antagonizes Mc1r signaling, binding to the receptor and the accessory protein Atrn. This interaction requires Mgrn1 and inhibits Gα activation and AC signaling. (Right) Canine β-defensin is another Mc1r agonist that can inhibit ASP by directly binding to Mc1r. (B) Biochemical pathway leading to the synthesis of melanins.

Mc1r ligands: α-MSH and ASP

The activity of Mc1r is primarily regulated by the opposing effects of α-melanocyte signaling hormone (α-MSH) (derived from the Pomc gene product) and agouti signaling protein (ASP) (encoded by nonagouti, a) (Figure 5A).  α-MSH, produced by melanocytes and keratinocytes of the skin (46;54;55) and by the pituitary gland (53;56), acts as an agonist of Mc1r, resulting in Gαs and adenylyl cyclase activation and a consequent increase in the levels of cAMP.  cAMP elevation activates protein kinase A (PKA) and the transcription factor CREB, leading to upregulation of micropthalmia-associated transcription factor (MITF) (57;58), which controls the expression of many genes required for melanogenesis, such as Tyr, Tyrp1, and Dct (59-62), as well as genes for melansome biogenesis and transport (Rab27a) (63).  α-MSH also stimulates an increase in Mc1r protein expression that results from both increased transcription (mentioned above) and from increased translation of Mc1r in melanocytes (64;65).  This feed forward loop promotes the responsiveness of melanocytes to α-MSH.

ASP, produced by cells of the dermal papilla, counteracts Mc1r signaling.  ASP functions as a competitive antagonist that blocks the effects of α-MSH by competing with it for binding to Mc1r (66;67).  ASP also acts as an inverse agonist of Mc1r, reducing by unknown mechanisms adenylyl cyclase-mediated intrinsic signaling from the receptor (68-71).  This includes blocking the transcription of genes normally induced by α-MSH (59).  Possibly through inhibition of MITF expression, ASP downregulates MC1R gene expression in human melanocytes (72).  However, ASP does not significantly affect mouse Mc1r transcript levels, and instead represses Mc1r translation (65).

Control of pigment type switching by ASP requires the accessory proteins attractin (Atrn) (73;74) and mahogunin ring finger 1 (Mgrn1) (75), identified through positional cloning of the spontaneous mutations mahogany and mahoganoid [reviewed in (39)].  Homozygosity for either of these loss of function mutations caused dark fur in mice, even in the presence of ubiquitous ASP expression on the Agouti lethal yellow background (76).  In contrast, the extension mutation of Mc1r suppressed the effects of mahogany and mahoganoid (76).  Atrn is a type I single-pass transmembrane protein first identified on T cells and shown to mediate the spreading of monocytes that become the focus for the clustering of nonproliferating T lymphocytes (77).  Mgrn1 is an E3 ubiquitin ligase reported to ubiquitinate tumor susceptibility gene 101 product (TSG101) (78), a component of the ESCRT-1 complex that sorts monoubiqutinated transmembrane proteins to lysosomes for degradation.  The mechanisms by which Atrn and Mgrn1 regulate ASP signaling remain unknown, but current hypotheses favor their direct interaction with Mc1r.  In addition to their effect on pigmentation, mutations of Atrn and Mgrn1 cause spongiform neurodegeneration in mice (79;80).

Modulation of inflammation and pain sensing by Mc1r

Numerous reports have documented an anti-inflammatory role for melanocortin signaling [reviewed in (81)].  Injection of α-MSH into specific tissues (82-84) or application to cultured cells (85;86) followed by observation of a subsequent reduction in disease severity or inflammatory cytokine production formed the basis for this conclusion.  In studies of a human monocytic cell line in vitro, α-MSH inhibited tumor necrosis factor-, lipopolysaccharide-, or okadaic acid-induced NF-κB activation by preventing IκB degradation in a cAMP-dependent manner (87).  The specific melanocortin receptors responsible for signaling the anti-inflammatory effects of α-MSH in most instances remain under investigation.  In the case of intestinal inflammation, it has been shown that relative to wild type C57BL/6J mice, mice homozygous for the extension mutation of Mc1r are highly susceptible to DSS-induced colitis in a manner dependent on non-hematopoietic cells (88).

Melanocortin signaling has in multiple cases altered the perception of pain stimuli by rats and mice (89).  However, the effect of melanocortin signaling on nociception remains a matter of debate because of the opposite effects on pain sensing observed in various studies upon injection of α-MSH into the ventricles of the cerebral cortex of rats or mice (90;91).  Some evidence exists suggesting that α-MSH attenuates morphine-induced analgesia (92) and inhibits morphine tolerance and addiction (93;94), although the mechanisms leading to these effects are not known.  Several melanocortin receptors are expressed in the nervous system, including Mc1r (95), and Mc3r and Mc4r, which are known to regulate energy homeostasis (see Southbeach) (96).  The expression of Mc1r in the brain is restricted to a small number of cells in the periaqueductal gray matter (PAG) of rats and humans, a region known to modulate the processing of pain and anxiety.  Interestingly, the increased effectiveness of κ-opioids in inducing analgesia in human females relative to males (97) was attributed to variations in MC1R associated with red hair and fair skin (98).  On the other hand, reduced sensitivity to general and cutaneous local anesthesia and increased sensitivity to thermal pain has also been attributed to such MC1R variants (99;100), and has been suggested to contribute to the significantly increased dental care-related anxiety reported for red-haired patients relative to dark-haired patients (101).  These findings are in conflict with others demonstrating that homozygous Mc1r^extension mouse mutants, or humans with variant MC1R genes and red hair, displayed reduced sensitivity to thermal, mechanical, and inflammatory pain (mice) or pain induced by electrical current (humans) and increased analgesic responsiveness to a μ-opioid (102;103).  Thus, the role of Mc1r in nociception remains unclear.

Putative Mechanism

The deer mutation is a tyrosine to cysteine substitution of residue 150 of Mc1r, located in the second intracellular loop.  Many loss of function mutations causing red hair in humans have been identified in this loop, possibly because they interfere with interactions between the receptor and Gs, and/or prevent proper trafficking to the cell surface.  Tyr150 exists within a consensus phosphorylation site for cAMP-dependent protein kinase (PKA) (29).  Mutation of the corresponding residue in human MC1R (Tyr152) has been documented in red haired South African individuals of European descent (104), supporting the idea that the mutation causes a loss of function of the protein.

Primers

Primers cannot be located by automatic search.

Genotyping

Deer genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

Primers

deer (F): 5’- ACCGCTTCCTACTTCCTGACAAGAC -3’

deer (R): 5’-TCCTGGCTGCGGAAAGCATAGATG -3’

PCR program

1) 95°C             2:00

2) 95°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7)  4°C              ∞

Primers for sequencing

deer_seq(F): 5’- GTATGTGTCCATCCCAGATGGC -3’

deer_seq(R): 5’- TGAAGTTCTTGAAGATGCAGC -3’

The following sequence of 931 nucleotides (from Genbank genomic region NC_000074.5 for linear genomic sequence of Mc1r, sense strand) is amplified:

   accgcttc ctacttcctg

421  acaagactat gtccactcag gagccccaga agagtcttct gggttctctc aactccaatg

481  ccacctctca ccttggactg gccaccaacc agtcagagcc ttggtgcctg tatgtgtcca

541  tcccagatgg cctcttcctc agcctagggc tggtgagtct ggtggagaat gtgctggttg

601  tgatagccat caccaaaaac cgcaacctgc actcgcccat gtattacttc atctgctgcc

661  tggccctgtc tgacctgatg gtaagtgtca gcatcgtgct ggagactact atcatcctgc

721  tgctggaggc gggcatcctg gtggccagag tggctttggt gcagcagctg gacaacctca

781  ttgacgtgct catctgtggc tccatggtgt ccagtctctg cttcctgggc atcattgcta

841  tagaccgcta catctccatc ttctatgcgc tgcgttatca cagcatcgtg acgctgccca

901  gagcacgacg ggctgtcgtg ggcatctgga tggtcagcat cgtctccagc accctcttta

961  tcacctacta caagcacaca gccgttctgc tctgcctcgt cactttcttt ctagccatgc

1021 tggcactcat ggcgattctg tatgcccaca tgttcacgag agcgtgccag cacgctcagg

1081 gcattgccca gctccacaaa aggcggcggt ccatccgcca aggcttctgc ctcaagggtg

1141 ctgccaccct tactatcctt ctggggattt tcttcctgtg ctggggcccc ttcttcctgc

1201 atctcttgct catcgtcctc tgccctcagc accccacctg cagctgcatc ttcaagaact

1261 tcaacctctt cctcctcctc atcgtcctca gctccactgt tgaccccctc atctatgctt

1321 tccgcagcca gga

Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated A is indicated in red. 

References

  1. Wettschureck, N., and Offermanns, S. (2005) Mammalian G Proteins and their Cell Type Specific Functions. Physiol. Rev.. 85, 1159-1204.

  2. Gether, U. (2000) Uncovering Molecular Mechanisms Involved in Activation of G Protein-Coupled Receptors. Endocr. Rev.. 21, 90-113.

  3. Joost, P., and Methner, A. (2002) Phylogenetic Analysis of 277 Human G-Protein-Coupled Receptors as a Tool for the Prediction of Orphan Receptor Ligands. Genome Biol.. 3, RESEARCH0063.

  4. Garcia-Borron, J. C., Sanchez-Laorden, B. L., and Jimenez-Cervantes, C. (2005) Melanocortin-1 Receptor Structure and Functional Regulation. Pigment Cell Res.. 18, 393-410.

  5. Chhajlani, V., Xu, X., Blauw, J., and Sudarshi, S. (1996) Identification of Ligand Binding Residues in Extracellular Loops of the Melanocortin 1 Receptor. Biochem. Biophys. Res. Commun.. 219, 521-525.

  6. Frandberg, P. A., Doufexis, M., Kapas, S., and Chhajlani, V. (2001) Cysteine Residues are Involved in Structure and Function of Melanocortin 1 Receptor: Substitution of a Cysteine Residue in Transmembrane Segment Two Converts an Agonist to Antagonist. Biochem. Biophys. Res. Commun.. 281, 851-857.

  7. Holst, B., Elling, C. E., and Schwartz, T. W. (2002) Metal Ion-Mediated Agonism and Agonist Enhancement in Melanocortin MC1 and MC4 Receptors. J. Biol. Chem.. 277, 47662-47670.

  8. Tarnow, P., Schoneberg, T., Krude, H., Gruters, A., and Biebermann, H. (2003) Mutationally Induced Disulfide Bond Formation within the Third Extracellular Loop Causes Melanocortin 4 Receptor Inactivation in Patients with Obesity. J. Biol. Chem.. 278, 48666-48673.

  9. Sanchez-Laorden, B. L., Sanchez-Mas, J., Turpin, M. C., Garcia-Borron, J. C., and Jimenez-Cervantes, C. (2006) Variant Amino Acids in Different Domains of the Human Melanocortin 1 Receptor Impair Cell Surface Expression. Cell. Mol. Biol. (Noisy-le-grand). 52, 39-46.

  10. Schioth, H. B., Petersson, S., Muceniece, R., Szardenings, M., and Wikberg, J. E. (1997) Deletions of the N-Terminal Regions of the Human Melanocortin Receptors. FEBS Lett.. 410, 223-228.

  11. Sanchez-Mas, J., Guillo, L. A., Zanna, P., Jimenez-Cervantes, C., and Garcia-Borron, J. C. (2005) Role of G Protein-Coupled Receptor Kinases in the Homologous Desensitization of the Human and Mouse Melanocortin 1 Receptors. Mol. Endocrinol.. 19, 1035-1048.

  12. Wess, J. (1998) Molecular Basis of receptor/G-Protein-Coupling Selectivity. Pharmacol. Ther.. 80, 231-264.

  13. Schaffer, J. V., and Bolognia, J. L. (2001) The Melanocortin-1 Receptor: Red Hair and Beyond. Arch. Dermatol.. 137, 1477-1485.

  14. Sanchez-Laorden, B. L., Herraiz, C., Valencia, J. C., Hearing, V. J., Jimenez-Cervantes, C., and Garcia-Borron, J. C. (2009) Aberrant Trafficking of Human Melanocortin 1 Receptor Variants Associated with Red Hair and Skin Cancer: Steady-State Retention of Mutant Forms in the Proximal Golgi. J. Cell. Physiol.. 220, 640-654.

  15. Schioth, H. B., Phillips, S. R., Rudzish, R., Birch-Machin, M. A., Wikberg, J. E., and Rees, J. L. (1999) Loss of Function Mutations of the Human Melanocortin 1 Receptor are Common and are Associated with Red Hair. Biochem. Biophys. Res. Commun.. 260, 488-491.

  16. Sanchez-Mas, J., Sanchez-Laorden, B. L., Guillo, L. A., Jimenez-Cervantes, C., and Garcia-Borron, J. C. (2005) The Melanocortin-1 Receptor Carboxyl Terminal Pentapeptide is Essential for MC1R Function and Expression on the Cell Surface. Peptides. 26, 1848-1857.

  17. Resh, M. D. (2006) Palmitoylation of Ligands, Receptors, and Intracellular Signaling Molecules. Sci. STKE. 2006, re14.

  18. Luttrell, L. M., and Lefkowitz, R. J. (2002) The Role of Beta-Arrestins in the Termination and Transduction of G-Protein-Coupled Receptor Signals. J. Cell. Sci.. 115, 455-465.

  19. Haskell-Luevano, C., Sawyer, T. K., Trumpp-Kallmeyer, S., Bikker, J. A., Humblet, C., Gantz, I., and Hruby, V. J. (1996) Three-Dimensional Molecular Models of the hMC1R Melanocortin Receptor: Complexes with Melanotropin Peptide Agonists. Drug Des. Discov.. 14, 197-211.

  20. Yang, Y., Dickinson, C., Haskell-Luevano, C., and Gantz, I. (1997) Molecular Basis for the Interaction of [Nle4,D-Phe7]Melanocyte Stimulating Hormone with the Human Melanocortin-1 Receptor. J. Biol. Chem.. 272, 23000-23010.

  21. Nygaard, R., Frimurer, T. M., Holst, B., Rosenkilde, M. M., and Schwartz, T. W. (2009) Ligand Binding and Micro-Switches in 7TM Receptor Structures. Trends Pharmacol. Sci.. 30, 249-259.

  22. Schwartz, T. W., Frimurer, T. M., Holst, B., Rosenkilde, M. M., and Elling, C. E. (2006) Molecular Mechanism of 7TM Receptor Activation--a Global Toggle Switch Model. Annu. Rev. Pharmacol. Toxicol.. 46, 481-519.

  23. Ringholm, A., Klovins, J., Rudzish, R., Phillips, S., Rees, J. L., and Schioth, H. B. (2004) Pharmacological Characterization of Loss of Function Mutations of the Human Melanocortin 1 Receptor that are Associated with Red Hair. J. Invest. Dermatol.. 123, 917-923.

  24. Holst, B., Elling, C. E., and Schwartz, T. W. (2002) Metal Ion-Mediated Agonism and Agonist Enhancement in Melanocortin MC1 and MC4 Receptors. J. Biol. Chem.. 277, 47662-47670.

  25. Prusis, P., Schioth, H. B., Muceniece, R., Herzyk, P., Afshar, M., Hubbard, R. E., and Wikberg, J. E. (1997) Modeling of the Three-Dimensional Structure of the Human Melanocortin 1 Receptor, using an Automated Method and Docking of a Rigid Cyclic Melanocyte-Stimulating Hormone Core Peptide. J. Mol. Graph. Model.. 15, 307-17, 334.

  26. Prusis, P., Frandberg, P. A., Muceniece, R., Kalvinsh, I., and Wikberg, J. E. (1995) A Three Dimensional Model for the Interaction of MSH with the Melanocortin-1 Receptor. Biochem. Biophys. Res. Commun.. 210, 205-210.

  27. Subramaniam, S., and Henderson, R. (1999) Electron Crystallography of Bacteriorhodopsin with Millisecond Time Resolution. J. Struct. Biol.. 128, 19-25.

  28. Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A., Le Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., Yamamoto, M., and Miyano, M. (2000) Crystal Structure of Rhodopsin: A G Protein-Coupled Receptor. Science. 289, 739-745.

  29. Chhajlani, V., and Wikberg, J. E. (1992) Molecular Cloning and Expression of the Human Melanocyte Stimulating Hormone Receptor cDNA. FEBS Lett.. 309, 417-420.

  30. Mountjoy, K. G., Robbins, L. S., Mortrud, M. T., and Cone, R. D. (1992) The Cloning of a Family of Genes that Encode the Melanocortin Receptors. Science. 257, 1248-1251.

  31. Luger, T. A., Scholzen, T., and Grabbe, S. (1997) The Role of Alpha-Melanocyte-Stimulating Hormone in Cutaneous Biology. J. Investig. Dermatol. Symp. Proc.. 2, 87-93.

  32. Brenner, M., and Hearing, V. J. (2008) The Protective Role of Melanin Against UV Damage in Human Skin. Photochem. Photobiol.. 84, 539-549.

  33. Ito, S., and IFPCS. (2003) The IFPCS Presidential Lecture: A Chemist's View of Melanogenesis. Pigment Cell Res.. 16, 230-236.

  34. Swift, J. A. (2009) Speculations on the Molecular Structure of Eumelanin. Int. J. Cosmet. Sci.. 31, 143-150.

  35. Meng, S., and Kaxiras, E. (2008) Theoretical Models of Eumelanin Protomolecules and their Optical Properties. Biophys. J.. 94, 2095-2105.

  36. Greco, G., Panzella, L., Verotta, L., d'Ischia, M., and Napolitano, A. (2011) Uncovering the Structure of Human Red Hair Pheomelanin: Benzothiazolylthiazinodihydroisoquinolines as Key Building Blocks. J. Nat. Prod.. 74, 675-682.

  37. Ito, S., and Wakamatsu, K. (2003) Quantitative Analysis of Eumelanin and Pheomelanin in Humans, Mice, and Other Animals: A Comparative Review. Pigment Cell Res.. 16, 523-531.

  38. Ito, S., and Wakamatsu, K. (2010) Human Hair Melanins: What we have Learned and have Not Learned from Mouse Coat Color Pigmentation. Pigment Cell. Melanoma Res.. 24, 63-74.

  39. Walker, W. P., and Gunn, T. M. (2010) Shades of Meaning: The Pigment-Type Switching System as a Tool for Discovery. Pigment Cell. Melanoma Res.. 23, 485-495.

  40. Hunt, G., Kyne, S., Wakamatsu, K., Ito, S., and Thody, A. J. (1995) Nle4DPhe7 Alpha-Melanocyte-Stimulating Hormone Increases the Eumelanin:Phaeomelanin Ratio in Cultured Human Melanocytes. J. Invest. Dermatol.. 104, 83-85.

  41. Robbins, L. S., Nadeau, J. H., Johnson, K. R., Kelly, M. A., Roselli-Rehfuss, L., Baack, E., Mountjoy, K. G., and Cone, R. D. (1993) Pigmentation Phenotypes of Variant Extension Locus Alleles Result from Point Mutations that Alter MSH Receptor Function. Cell. 72, 827-834.

  42. Beaumont, K. A., Shekar, S. N., Cook, A. L., Duffy, D. L., and Sturm, R. A. (2008) Red Hair is the Null Phenotype of MC1R. Hum. Mutat.. 29, E88-94.

  43. Meyle, K. D., and Guldberg, P. (2009) Genetic Risk Factors for Melanoma. Hum. Genet.. 126, 499-510.

  44. Abdel-Malek, Z., Scott, M. C., Suzuki, I., Tada, A., Im, S., Lamoreux, L., Ito, S., Barsh, G., and Hearing, V. J. (2000) The Melanocortin-1 Receptor is a Key Regulator of Human Cutaneous Pigmentation. Pigment Cell Res.. 13 Suppl 8, 156-162.

  45. Suzuki, I., Cone, R. D., Im, S., Nordlund, J., and Abdel-Malek, Z. A. (1996) Binding of Melanotropic Hormones to the Melanocortin Receptor MC1R on Human Melanocytes Stimulates Proliferation and Melanogenesis. Endocrinology. 137, 1627-1633.

  46. Chakraborty, A. K., Funasaka, Y., Slominski, A., Ermak, G., Hwang, J., Pawelek, J. M., and Ichihashi, M. (1996) Production and Release of Proopiomelanocortin (POMC) Derived Peptides by Human Melanocytes and Keratinocytes in Culture: Regulation by Ultraviolet B. Biochim. Biophys. Acta. 1313, 130-138.

  47. Funasaka, Y., Chakraborty, A. K., Hayashi, Y., Komoto, M., Ohashi, A., Nagahama, M., Inoue, Y., Pawelek, J., and Ichihashi, M. (1998) Modulation of Melanocyte-Stimulating Hormone Receptor Expression on Normal Human Melanocytes: Evidence for a Regulatory Role of Ultraviolet B, Interleukin-1alpha, Interleukin-1beta, Endothelin-1 and Tumour Necrosis Factor-Alpha. Br. J. Dermatol.. 139, 216-224.

  48. Tada, A., Suzuki, I., Im, S., Davis, M. B., Cornelius, J., Babcock, G., Nordlund, J. J., and Abdel-Malek, Z. A. (1998) Endothelin-1 is a Paracrine Growth Factor that Modulates Melanogenesis of Human Melanocytes and Participates in their Responses to Ultraviolet Radiation. Cell Growth Differ.. 9, 575-584.

  49. Imokawa, G., Yada, Y., and Miyagishi, M. (1992) Endothelins Secreted from Human Keratinocytes are Intrinsic Mitogens for Human Melanocytes. J. Biol. Chem.. 267, 24675-24680.

  50. Sanchez-Mas, J., Hahmann, C., Gerritsen, I., Garcia-Borron, J. C., and Jimenez-Cervantes, C. (2004) Agonist-Independent, High Constitutive Activity of the Human Melanocortin 1 Receptor. Pigment Cell Res.. 17, 386-395.

  51. Slominski, A., Plonka, P. M., Pisarchik, A., Smart, J. L., Tolle, V., Wortsman, J., and Low, M. J. (2005) Preservation of Eumelanin Hair Pigmentation in Proopiomelanocortin-Deficient Mice on a Nonagouti (a/a) Genetic Background. Endocrinology. 146, 1245-1253.

  52. Yaswen, L., Diehl, N., Brennan, M. B., and Hochgeschwender, U. (1999) Obesity in the Mouse Model of Pro-Opiomelanocortin Deficiency Responds to Peripheral Melanocortin. Nat. Med.. 5, 1066-1070.

  53. Krude, H., Biebermann, H., Luck, W., Horn, R., Brabant, G., and Gruters, A. (1998) Severe Early-Onset Obesity, Adrenal Insufficiency and Red Hair Pigmentation Caused by POMC Mutations in Humans. Nat. Genet.. 19, 155-157.

  54. Rousseau, K., Kauser, S., Pritchard, L. E., Warhurst, A., Oliver, R. L., Slominski, A., Wei, E. T., Thody, A. J., Tobin, D. J., and White, A. (2007) Proopiomelanocortin (POMC), the ACTH/melanocortin Precursor, is Secreted by Human Epidermal Keratinocytes and Melanocytes and Stimulates Melanogenesis. FASEB J.. 21, 1844-1856.

  55. Schauer, E., Trautinger, F., Kock, A., Schwarz, A., Bhardwaj, R., Simon, M., Ansel, J. C., Schwarz, T., and Luger, T. A. (1994) Proopiomelanocortin-Derived Peptides are Synthesized and Released by Human Keratinocytes. J. Clin. Invest.. 93, 2258-2262.

  56. Pears, J. S., Jung, R. T., Bartlett, W., Browning, M. C., Kenicer, K., and Thody, A. J. (1992) A Case of Skin Hyperpigmentation due to Alpha-MSH Hypersecretion. Br. J. Dermatol.. 126, 286-289.

  57. Garcia-Borron, J. C., Sanchez-Laorden, B. L., and Jimenez-Cervantes, C. (2005) Melanocortin-1 Receptor Structure and Functional Regulation. Pigment Cell Res.. 18, 393-410.

  58. Busca, R., and Ballotti, R. (2000) Cyclic AMP a Key Messenger in the Regulation of Skin Pigmentation. Pigment Cell Res.. 13, 60-69.

  59. Le Pape, E., Passeron, T., Giubellino, A., Valencia, J. C., Wolber, R., and Hearing, V. J. (2009) Microarray Analysis Sheds Light on the Dedifferentiating Role of Agouti Signal Protein in Murine Melanocytes Via the Mc1r. Proc. Natl. Acad. Sci. U. S. A.. 106, 1802-1807.

  60. Levy, C., Khaled, M., and Fisher, D. E. (2006) MITF: Master Regulator of Melanocyte Development and Melanoma Oncogene. Trends Mol. Med.. 12, 406-414.

  61. Bertolotto, C., Abbe, P., Hemesath, T. J., Bille, K., Fisher, D. E., Ortonne, J. P., and Ballotti, R. (1998) Microphthalmia Gene Product as a Signal Transducer in cAMP-Induced Differentiation of Melanocytes. J. Cell Biol.. 142, 827-835.

  62. Aberdam, E., Bertolotto, C., Sviderskaya, E. V., de Thillot, V., Hemesath, T. J., Fisher, D. E., Bennett, D. C., Ortonne, J. P., and Ballotti, R. (1998) Involvement of Microphthalmia in the Inhibition of Melanocyte Lineage Differentiation and of Melanogenesis by Agouti Signal Protein. J. Biol. Chem.. 273, 19560-19565.

  63. Chiaverini, C., Beuret, L., Flori, E., Busca, R., Abbe, P., Bille, K., Bahadoran, P., Ortonne, J. P., Bertolotto, C., and Ballotti, R. (2008) Microphthalmia-Associated Transcription Factor Regulates RAB27A Gene Expression and Controls Melanosome Transport. J. Biol. Chem.. 283, 12635-12642.

  64. Rouzaud, F., and Hearing, V. J. (2005) Regulatory Elements of the Melanocortin 1 Receptor. Peptides. 26, 1858-1870.

  65. Rouzaud, F., Annereau, J. P., Valencia, J. C., Costin, G. E., and Hearing, V. J. (2003) Regulation of Melanocortin 1 Receptor Expression at the mRNA and Protein Levels by its Natural Agonist and Antagonist. FASEB J.. 17, 2154-2156.

  66. Blanchard, S. G., Harris, C. O., Ittoop, O. R., Nichols, J. S., Parks, D. J., Truesdale, A. T., and Wilkison, W. O. (1995) Agouti Antagonism of Melanocortin Binding and Action in the B16F10 Murine Melanoma Cell Line. Biochemistry. 34, 10406-10411.

  67. Lu, D., Willard, D., Patel, I. R., Kadwell, S., Overton, L., Kost, T., Luther, M., Chen, W., Woychik, R. P., and Wilkison, W. O. (1994) Agouti Protein is an Antagonist of the Melanocyte-Stimulating-Hormone Receptor. Nature. 371, 799-802.

  68. Ollmann, M. M., Lamoreux, M. L., Wilson, B. D., and Barsh, G. S. (1998) Interaction of Agouti Protein with the Melanocortin 1 Receptor in Vitro and in Vivo. Genes Dev.. 12, 316-330.

  69. Graham, A., Wakamatsu, K., Hunt, G., Ito, S., and Thody, A. J. (1997) Agouti Protein Inhibits the Production of Eumelanin and Phaeomelanin in the Presence and Absence of Alpha-Melanocyte Stimulating Hormone. Pigment Cell Res.. 10, 298-303.

  70. Sakai, C., Ollmann, M., Kobayashi, T., Abdel-Malek, Z., Muller, J., Vieira, W. D., Imokawa, G., Barsh, G. S., and Hearing, V. J. (1997) Modulation of Murine Melanocyte Function in Vitro by Agouti Signal Protein. EMBO J.. 16, 3544-3552.

  71. Siegrist, W., Drozdz, R., Cotti, R., Willard, D. H., Wilkison, W. O., and Eberle, A. N. (1997) Interactions of Alpha-Melanotropin and Agouti on B16 Melanoma Cells: Evidence for Inverse Agonism of Agouti. J. Recept. Signal Transduct. Res.. 17, 75-98.

  72. Scott, M. C., Suzuki, I., and Abdel-Malek, Z. A. (2002) Regulation of the Human Melanocortin 1 Receptor Expression in Epidermal Melanocytes by Paracrine and Endocrine Factors and by Ultraviolet Radiation. Pigment Cell Res.. 15, 433-439.

  73. Gunn, T. M., Miller, K. A., He, L., Hyman, R. W., Davis, R. W., Azarani, A., Schlossman, S. F., Duke-Cohan, J. S., and Barsh, G. S. (1999) The Mouse Mahogany Locus Encodes a Transmembrane Form of Human Attractin. Nature. 398, 152-156.

  74. Nagle, D. L., McGrail, S. H., Vitale, J., Woolf, E. A., Dussault, B. J.,Jr, DiRocco, L., Holmgren, L., Montagno, J., Bork, P., Huszar, D., Fairchild-Huntress, V., Ge, P., Keilty, J., Ebeling, C., Baldini, L., Gilchrist, J., Burn, P., Carlson, G. A., and Moore, K. J. (1999) The Mahogany Protein is a Receptor Involved in Suppression of Obesity. Nature. 398, 148-152.

  75. Phan, L. K., Lin, F., LeDuc, C. A., Chung, W. K., and Leibel, R. L. (2002) The Mouse Mahoganoid Coat Color Mutation Disrupts a Novel C3HC4 RING Domain Protein. J. Clin. Invest.. 110, 1449-1459.

  76. Miller, K. A., Gunn, T. M., Carrasquillo, M. M., Lamoreux, M. L., Galbraith, D. B., and Barsh, G. S. (1997) Genetic Studies of the Mouse Mutations Mahogany and Mahoganoid. Genetics. 146, 1407-1415.

  77. Duke-Cohan, J. S., Gu, J., McLaughlin, D. F., Xu, Y., Freeman, G. J., and Schlossman, S. F. (1998) Attractin (DPPT-L), a Member of the CUB Family of Cell Adhesion and Guidance Proteins, is Secreted by Activated Human T Lymphocytes and Modulates Immune Cell Interactions. Proc. Natl. Acad. Sci. U. S. A.. 95, 11336-11341.

  78. Kim, B. Y., Olzmann, J. A., Barsh, G. S., Chin, L. S., and Li, L. (2007) Spongiform Neurodegeneration-Associated E3 Ligase Mahogunin Ubiquitylates TSG101 and Regulates Endosomal Trafficking. Mol. Biol. Cell. 18, 1129-1142.

  79. He, L., Lu, X. Y., Jolly, A. F., Eldridge, A. G., Watson, S. J., Jackson, P. K., Barsh, G. S., and Gunn, T. M. (2003) Spongiform Degeneration in Mahoganoid Mutant Mice. Science. 299, 710-712.

  80. Bronson, R. T., Donahue, L. R., Samples, R., Kim, J. H., and Naggert, J. K. (2001) Mice with Mutations in the Mahogany Gene Atrn have Cerebral Spongiform Changes. J. Neuropathol. Exp. Neurol.. 60, 724-730.

  81. Catania, A., Lonati, C., Sordi, A., Carlin, A., Leonardi, P., and Gatti, S. (2010) The Melanocortin System in Control of Inflammation. ScientificWorldJournal. 10, 1840-1853.

  82. Oktar, B. K., Ercan, F., Yegen, B. C., and Alican, I. (2000) The Effect of Alpha-Melanocyte Stimulating Hormone on Colonic Inflammation in the Rat. Peptides. 21, 1271-1277.

  83. Lipton, J. M., and Catania, A. (1997) Anti-Inflammatory Actions of the Neuroimmunomodulator Alpha-MSH. Immunol. Today. 18, 140-145.

  84. Ceriani, G., Diaz, J., Murphree, S., Catania, A., and Lipton, J. M. (1994) The Neuropeptide Alpha-Melanocyte-Stimulating Hormone Inhibits Experimental Arthritis in Rats. Neuroimmunomodulation. 1, 28-32.

  85. Galimberti, D., Baron, P., Meda, L., Prat, E., Scarpini, E., Delgado, R., Catania, A., Lipton, J. M., and Scarlato, G. (1999) Alpha-MSH Peptides Inhibit Production of Nitric Oxide and Tumor Necrosis Factor-Alpha by Microglial Cells Activated with Beta-Amyloid and Interferon Gamma. Biochem. Biophys. Res. Commun.. 263, 251-256.

  86. Delgado, R., Carlin, A., Airaghi, L., Demitri, M. T., Meda, L., Galimberti, D., Baron, P., Lipton, J. M., and Catania, A. (1998) Melanocortin Peptides Inhibit Production of Proinflammatory Cytokines and Nitric Oxide by Activated Microglia. J. Leukoc. Biol.. 63, 740-745.

  87. Manna, S. K., and Aggarwal, B. B. (1998) Alpha-Melanocyte-Stimulating Hormone Inhibits the Nuclear Transcription Factor NF-Kappa B Activation Induced by various Inflammatory Agents. J. Immunol.. 161, 2873-2880.

  88. Maaser, C., Kannengiesser, K., Specht, C., Lugering, A., Brzoska, T., Luger, T. A., Domschke, W., and Kucharzik, T. (2006) Crucial Role of the Melanocortin Receptor MC1R in Experimental Colitis. Gut. 55, 1415-1422.

  89. Starowicz, K., and Przewlocka, B. (2003) The Role of Melanocortins and their Receptors in Inflammatory Processes, Nerve Regeneration and Nociception. Life Sci.. 73, 823-847.

  90. Ohkubo, T., Shibata, M., Takahashi, H., and Naruse, S. (1985) Naloxone Prevents the Analgesic Action of Alpha-MSH in Mice. Experientia. 41, 627-628.

  91. Sandman, C. A., and Kastin, A. J. (1981) Intraventricular Administration of MSH Induces Hyperalgesia in Rats. Peptides. 2, 231-233.

  92. Contreras, P. C., and Takemori, A. E. (1984) Antagonism of Morphine-Induced Analgesia, Tolerance and Dependence by Alpha-Melanocyte-Stimulating Hormone. J. Pharmacol. Exp. Ther.. 229, 21-26.

  93. Szekely, J. I., Miglecz, E., Dunai-Kovacs, Z., Tarnawa, I., Ronai, A. Z., Graf, L., and Bajusz, S. (1979) Attenuation of Morphine Tolerance and Dependence by Alpha-Melanocyte Stimulating Hormone(Alpha-MSH). Life Sci.. 24, 1931-1938.

  94. Alvaro, J. D., Tatro, J. B., and Duman, R. S. (1997) Melanocortins and Opiate Addiction. Life Sci.. 61, 1-9.

  95. Xia, Y., Wikberg, J. E., and Chhajlani, V. (1995) Expression of Melanocortin 1 Receptor in Periaqueductal Gray Matter. Neuroreport. 6, 2193-2196.

  96. Butler, A. A. (2006) The Melanocortin System and Energy Balance. Peptides. 27, 281-290.

  97. Gear, R. W., Miaskowski, C., Gordon, N. C., Paul, S. M., Heller, P. H., and Levine, J. D. (1996) Kappa-Opioids Produce significantly Greater Analgesia in Women than in Men. Nat. Med.. 2, 1248-1250.

  98. Mogil, J. S., Wilson, S. G., Chesler, E. J., Rankin, A. L., Nemmani, K. V., Lariviere, W. R., Groce, M. K., Wallace, M. R., Kaplan, L., Staud, R., Ness, T. J., Glover, T. L., Stankova, M., Mayorov, A., Hruby, V. J., Grisel, J. E., and Fillingim, R. B. (2003) The Melanocortin-1 Receptor Gene Mediates Female-Specific Mechanisms of Analgesia in Mice and Humans. Proc. Natl. Acad. Sci. U. S. A.. 100, 4867-4872.

  99. Liem, E. B., Joiner, T. V., Tsueda, K., and Sessler, D. I. (2005) Increased Sensitivity to Thermal Pain and Reduced Subcutaneous Lidocaine Efficacy in Redheads. Anesthesiology. 102, 509-514.

  100. Liem, E. B., Lin, C. M., Suleman, M. I., Doufas, A. G., Gregg, R. G., Veauthier, J. M., Loyd, G., and Sessler, D. I. (2004) Anesthetic Requirement is Increased in Redheads. Anesthesiology. 101, 279-283.

  101. Binkley, C. J., Beacham, A., Neace, W., Gregg, R. G., Liem, E. B., and Sessler, D. I. (2009) Genetic Variations Associated with Red Hair Color and Fear of Dental Pain, Anxiety regarding Dental Care and Avoidance of Dental Care. J. Am. Dent. Assoc.. 140, 896-905.

  102. Delaney, A., Keighren, M., Fleetwood-Walker, S. M., and Jackson, I. J. (2010) Involvement of the Melanocortin-1 Receptor in Acute Pain and Pain of Inflammatory but Not Neuropathic Origin. PLoS One. 5, e12498.

  103. Mogil, J. S., Ritchie, J., Smith, S. B., Strasburg, K., Kaplan, L., Wallace, M. R., Romberg, R. R., Bijl, H., Sarton, E. Y., Fillingim, R. B., and Dahan, A. (2005) Melanocortin-1 Receptor Gene Variants Affect Pain and Mu-Opioid Analgesia in Mice and Humans. J. Med. Genet.. 42, 583-587.

  104. John, P. R., and Ramsay, M. (2002) Four Novel Variants in MC1R in Red-Haired South African Individuals of European Descent: S83P, Y152X, A171D, P256S. Hum. Mutat.. 19, 461-462.