Phenotypic Mutation 'stinger' (pdf version)
Allelestinger
Mutation Type missense
Chromosome4
Coordinate149,657,319 bp (GRCm38)
Base Change A ⇒ C (forward strand)
Gene Pik3cd
Gene Name phosphatidylinositol 3-kinase catalytic delta polypeptide
Synonym(s) 2410099E07Rik, p110delta, 2610208K16Rik
Chromosomal Location 149,649,168-149,702,571 bp (-)
MGI Phenotype Homozygotes for targeted null mutations exhibit impaired B and T cell antigen receptor signaling, reduced or ablated immune responses and decreased immunoglobulin levels. Mutants also develop inflammatory bowel disease.
Accession Number
Mapped Yes 
Amino Acid Change Leucine changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000136045]
SMART Domains Protein: ENSMUSP00000136045
Gene: ENSMUSG00000039936
AA Change: L390R

DomainStartEndE-ValueType
PI3K_p85B 31 108 2.24e-26 SMART
PI3K_rbd 174 281 1.3e-13 SMART
PI3K_C2 309 412 1.87e-28 SMART
PI3Ka 496 688 1.22e-82 SMART
PI3Kc 778 1044 5.65e-128 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 1.80; Specificity: 1.00)
(Using ENSMUST00000177654)
Phenotypic Category T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All alleles(16) : Gene trapped(9) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Pik3cd APN 4 149657460 missense probably damaging 1.00
IGL01536:Pik3cd APN 4 149652666 missense probably damaging 1.00
IGL01636:Pik3cd APN 4 149654315 missense probably damaging 0.99
IGL02794:Pik3cd APN 4 149654571 missense probably benign 0.00
grand_tetons UTSW 4 149652699 missense probably damaging 1.00
F5770:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
R0003:Pik3cd UTSW 4 149656379 critical splice donor site probably null
R0309:Pik3cd UTSW 4 149663220 missense probably damaging 1.00
R1246:Pik3cd UTSW 4 149659800 missense probably benign 0.16
R1259:Pik3cd UTSW 4 149650648 nonsense probably null
R1533:Pik3cd UTSW 4 149655196 missense probably damaging 1.00
R1610:Pik3cd UTSW 4 149659997 splice donor site probably benign
R1756:Pik3cd UTSW 4 149658750 missense probably benign 0.01
R1796:Pik3cd UTSW 4 149654119 missense probably benign 0.03
R1887:Pik3cd UTSW 4 149652634 missense probably damaging 1.00
R1988:Pik3cd UTSW 4 149663203 missense probably damaging 0.99
R2089:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R2091:Pik3cd UTSW 4 149652699 missense probably damaging 1.00
R4997:Pik3cd UTSW 4 149658984 missense probably damaging 1.00
R5391:Pik3cd UTSW 4 149659131 missense probably damaging 0.98
R5603:Pik3cd UTSW 4 149658855 missense probably benign
V7580:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7581:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7582:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
V7583:Pik3cd UTSW 4 149657319 missense probably damaging 1.00
X0023:Pik3cd UTSW 4 149660034 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm
MMRRC Submission 037532-MU
Last Updated 12/09/2016 11:56 AM by Katherine Timer
Record Created 01/17/2011 7:47 AM by Carrie N. Arnold
Record Posted 09/16/2014
Other Mutations in This Stock Stock #: V7580 Run Code: HSQ01016
Coding Region Coverage: 10x: 97.8% 20x: 96.0%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
4930458L03Rik C to A 13: 64,921,648 P537T probably benign Het
Abcb5 T to A 12: 118,886,179 M950L probably benign Het
Atp6v1h A to G 1: 5,124,443 T282A possibly damaging Het
Camk2g T to C 14: 20,739,312 probably benign Het
Casp8ap2 C to T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT to ACTGT 5: 17,820,528 probably null Het
Cfi T to A 3: 129,854,992 I175K possibly damaging Het
D630003M21Rik T to C 2: 158,201,011 T870A probably benign Het
Dnah12 T to A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T to A 15: 99,101,482 Y183N probably damaging Het
Erv3 T to C 2: 131,855,926 H171R possibly damaging Het
Fam221b T to C 4: 43,665,865 T249A probably benign Het
Gm10770 T to A 2: 150,179,484 K38* probably null Het
Gm4787 G to A 12: 81,377,567 Q606* probably null Het
Heatr5a A to G 12: 51,881,278 probably benign Het
Izumo4 A to T 10: 80,703,891 T155S probably benign Het
Kcnb2 A to G 1: 15,710,091 I396V probably benign Het
Klc1 A to T 12: 111,774,572 I161F probably benign Het
Lpar5 C to A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C to T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T to G 11: 103,455,512 N3176T possibly damaging Het
Mctp2 T to A 7: 72,121,751 probably benign Het
Med20 G to A 17: 47,618,832 V65M probably damaging Het
Mylk G to T 16: 34,995,204 probably null Het
Numbl T to C 7: 27,279,602 S379P probably benign Het
Olfr1406 G to T 1: 173,183,964 L157I probably benign Het
Olfr1440 G to A 19: 12,394,550 V96I probably benign Het
Otop3 T to A 11: 115,344,838 L451Q probably damaging Het
Papln C to T 12: 83,778,834 R630C probably benign Het
Pelp1 T to A 11: 70,398,150 T257S probably damaging Het
Pigx T to C 16: 32,087,422 D131G probably damaging Het
Pik3cd A to C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T to C 7: 100,654,618 T112A probably benign Het
Ppwd1 A to G 13: 104,220,237 Y257H probably damaging Het
Rabep1 T to C 11: 70,937,516 probably benign Het
Ralgapa1 G to A 12: 55,795,653 probably benign Het
Rasa1 A to G 13: 85,226,945 probably benign Het
Recql4 T to C 15: 76,706,169 D705G probably benign Het
Ror1 A to G 4: 100,440,933 Q501R probably damaging Het
Slc30a4 T to A 2: 122,689,538 M185L probably benign Het
Spaca1 T to C 4: 34,039,311 E192G probably damaging Het
Sptbn2 C to T 19: 4,750,632 R2292C probably damaging Het
Tnrc6c G to A 11: 117,723,326 R930H probably damaging Het
Trps1 T to C 15: 50,831,577 K437E probably damaging Het
Tspyl3 A to G 2: 153,225,060 V86A probably benign Het
Ttc23 T to C 7: 67,709,315 probably benign Het
Tubb3 C to T 8: 123,411,675 probably benign Het
Zfp292 C to T 4: 34,806,783 C2092Y possibly damaging Het
Zfp606 T to G 7: 12,481,196 probably benign Het
Zmynd8 G to A 2: 165,812,394 R733* probably null Het

Stock #: V7581 Run Code: HSQ01027
Coding Region Coverage: 10x: 95.7% 20x: 90.5%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
4930458L03Rik C to A 13: 64,921,648 P537T probably benign Het
9530002B09Rik A to T 4: 122,701,257 H102L possibly damaging Het
Abcb10 GGCCATCG to GG 8: 123,969,761 unknown Het
Atp6v1h A to G 1: 5,124,443 T282A possibly damaging Het
Camk2g T to C 14: 20,739,312 probably benign Het
Clasp1 G to A 1: 118,581,348 R1319Q probably damaging Het
D630003M21Rik T to C 2: 158,201,011 T870A probably benign Het
Dnah12 T to A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T to A 15: 99,101,482 Y183N probably damaging Het
Dpyd C to T 3: 118,897,126 Q295* probably null Het
Erv3 T to C 2: 131,855,926 H171R possibly damaging Het
Fam221b T to C 4: 43,665,865 T249A probably benign Het
Fcgr1 T to C 3: 96,284,276 *405W probably null Het
Gdap1l1 C to T 2: 163,447,486 probably benign Het
Glrx3 A to G 7: 137,459,153 H172R probably benign Het
Gm10770 T to A 2: 150,179,484 K38* probably null Het
Gm4787 G to A 12: 81,377,567 Q606* probably null Het
Got1 T to A 19: 43,500,561 probably benign Het
Hira G to A 16: 18,894,821 A29T probably damaging Het
Hnrnpab A to T 11: 51,602,624 N252K probably benign Het
Izumo4 A to T 10: 80,703,891 T155S probably benign Het
Kcnb2 A to G 1: 15,710,091 I396V probably benign Het
Klc1 A to T 12: 111,774,572 I161F probably benign Het
Lpar5 C to A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C to T 2: 91,488,518 S900L possibly damaging Het
Muc6 T to G 7: 141,647,613 E808A probably benign Het
Olfr1406 G to T 1: 173,183,964 L157I probably benign Het
Olfr480 G to T 7: 108,066,678 T40K probably benign Het
Otop3 T to A 11: 115,344,838 L451Q probably damaging Het
Papln C to T 12: 83,778,834 R630C probably benign Het
Pelp1 T to A 11: 70,398,150 T257S probably damaging Het
Pik3cd A to C 4: 149,657,319 L390R probably damaging Het
Ppwd1 A to G 13: 104,220,237 Y257H probably damaging Het
Prkcb G to T 7: 122,528,476 W274C probably damaging Het
Rabep1 T to C 11: 70,937,516 probably benign Het
Ralgapa1 G to A 12: 55,795,653 probably benign Het
Rasa1 A to G 13: 85,226,945 probably benign Het
Rbbp8nl T to A 2: 180,278,208 T558S probably benign Het
Recql4 T to C 15: 76,706,169 D705G probably benign Het
Slc30a4 T to A 2: 122,689,538 M185L probably benign Het
Slc5a6 C to T 5: 31,042,613 R141Q probably damaging Het
Spaca1 T to C 4: 34,039,311 E192G probably damaging Het
Tmc3 T to C 7: 83,622,505 V984A probably benign Het
Tnrc6c G to A 11: 117,723,326 R930H probably damaging Het
Toe1 A to T 4: 116,806,111 N122K probably damaging Het
Tprkb A to G 6: 85,928,782 K150E probably damaging Het
Trps1 T to C 15: 50,831,577 K437E probably damaging Het
Tspyl3 A to G 2: 153,225,060 V86A probably benign Het
Tubb3 C to T 8: 123,411,675 probably benign Het
Vmn2r68 C to T 7: 85,221,880 V732I probably benign Het
Wdr60 A to C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C to T 4: 34,806,783 C2092Y possibly damaging Het
Zfp933 G to A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G to A 2: 165,812,394 R733* probably null Het

Stock #: V7582 Run Code: HSQ01027
Coding Region Coverage: 10x: 95.7% 20x: 90.3%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
9530002B09Rik A to T 4: 122,701,257 H102L possibly damaging Het
Ahcy G to A 2: 155,064,921 R151* probably null Het
Atp6v1h A to G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C to T 12: 111,296,391 G1501S probably benign Het
Dnajc22 T to A 15: 99,101,482 Y183N probably damaging Het
Dpyd C to T 3: 118,897,126 Q295* probably null Het
Erv3 T to C 2: 131,855,926 H171R possibly damaging Het
Fam221b T to C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C to T 5: 110,379,426 A292T probably benign Het
Fcgr1 T to C 3: 96,284,276 *405W probably null Het
Gm4787 G to A 12: 81,377,567 Q606* probably null Het
Got1 T to A 19: 43,500,561 probably benign Het
Heatr5a A to G 12: 51,881,278 probably benign Het
Hira G to A 16: 18,894,821 A29T probably damaging Het
Izumo4 A to T 10: 80,703,891 T155S probably benign Het
Kcnb2 A to G 1: 15,710,091 I396V probably benign Het
Lpar5 C to A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C to T 2: 91,488,518 S900L possibly damaging Het
Mctp2 T to A 7: 72,121,751 probably benign Het
Med20 G to A 17: 47,618,832 V65M probably damaging Het
Myrfl T to C 10: 116,861,530 T30A probably damaging Het
Olfr1406 G to T 1: 173,183,964 L157I probably benign Het
Otop3 T to A 11: 115,344,838 L451Q probably damaging Het
Papln C to T 12: 83,778,834 R630C probably benign Het
Pelp1 T to A 11: 70,398,150 T257S probably damaging Het
Pik3cd A to C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T to C 7: 100,654,618 T112A probably benign Het
Rabep1 T to C 11: 70,937,516 probably benign Het
Ralgapa1 G to A 12: 55,795,653 probably benign Het
Rbbp8nl T to A 2: 180,278,208 T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC to TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 unknown Het
Slc30a4 T to A 2: 122,689,538 M185L probably benign Het
Spaca1 T to C 4: 34,039,311 E192G probably damaging Het
Thbd A to T 2: 148,407,190 Y253N probably benign Het
Tiam1 C to T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G to A 11: 117,723,326 R930H probably damaging Het
Toe1 A to T 4: 116,806,111 N122K probably damaging Het
Tprkb A to G 6: 85,928,782 K150E probably damaging Het
Ttc23 T to C 7: 67,709,315 probably benign Het
Ttc36 A to T 9: 44,801,797 probably benign Het
Wdr60 A to C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C to T 4: 34,806,783 C2092Y possibly damaging Het
Zfp933 G to A 4: 147,826,470 A223V probably damaging Het

Stock #: V7583 Run Code: HSQ01027
Coding Region Coverage: 10x: 97.4% 20x: 95.7%
Validation Efficiency: 0/0

GeneSubstitutionChr/LocMutationPredicted EffectZygosity
4930458L03Rik C to A 13: 64,921,648 P537T probably benign Het
9530002B09Rik A to T 4: 122,701,257 H102L possibly damaging Het
Atp6v1h A to G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C to T 12: 111,296,391 G1501S probably benign Het
D630003M21Rik T to C 2: 158,201,011 T870A probably benign Het
Dcaf4 C to A 12: 83,537,701 probably benign Het
Dnajc22 T to A 15: 99,101,482 Y183N probably damaging Het
Dpyd C to T 3: 118,897,126 Q295* probably null Het
Erv3 T to C 2: 131,855,926 H171R possibly damaging Het
Fam221b T to C 4: 43,665,865 T249A probably benign Het
Fcgr1 T to C 3: 96,284,276 *405W probably null Het
Gm10770 T to A 2: 150,179,484 K38* probably null Het
Golga4 A to G 9: 118,556,075 E755G possibly damaging Het
Got1 T to A 19: 43,500,561 probably benign Het
Hnrnpab A to T 11: 51,602,624 N252K probably benign Het
Ing1 T to C 8: 11,561,934 V218A possibly damaging Het
Izumo4 A to T 10: 80,703,891 T155S probably benign Het
Kcnb2 A to G 1: 15,710,091 I396V probably benign Het
Lrp4 C to T 2: 91,488,518 S900L possibly damaging Het
Mbd5 A to G 2: 49,316,410 D1713G probably damaging Het
Mctp2 T to A 7: 72,121,751 probably benign Het
Muc6 T to G 7: 141,647,613 E808A probably benign Het
Mylk G to T 16: 34,995,204 probably null Het
Nbeal2 A to G 9: 110,637,937 V697A possibly damaging Het
Nphp3 T to C 9: 104,035,894 probably null Het
Numbl T to C 7: 27,279,602 S379P probably benign Het
Otop3 T to A 11: 115,344,838 L451Q probably damaging Het
Pelp1 T to A 11: 70,398,150 T257S probably damaging Het
Pigx T to C 16: 32,087,422 D131G probably damaging Het
Pik3cd A to C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T to C 7: 100,654,618 T112A probably benign Het
Rabep1 T to C 11: 70,937,516 probably benign Het
Rasa1 A to G 13: 85,226,945 probably benign Het
Recql4 T to C 15: 76,706,169 D705G probably benign Het
Ror1 A to G 4: 100,440,933 Q501R probably damaging Het
Sirpb1b A to G 3: 15,503,183 V366A probably benign Het
Slc30a4 T to A 2: 122,689,538 M185L probably benign Het
Spaca1 T to C 4: 34,039,311 E192G probably damaging Het
Tnrc6c G to A 11: 117,723,326 R930H probably damaging Het
Toe1 A to T 4: 116,806,111 N122K probably damaging Het
Tprkb A to G 6: 85,928,782 K150E probably damaging Het
Trps1 T to C 15: 50,831,577 K437E probably damaging Het
Tspyl3 A to G 2: 153,225,060 V86A probably benign Het
Ttc23 T to C 7: 67,709,315 probably benign Het
Ttc36 A to T 9: 44,801,797 probably benign Het
Vps18 A to G 2: 119,297,228 Y844C probably benign Het
Wdr60 A to C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T to A 9: 74,157,270 I540N possibly damaging Het
Zfp292 C to T 4: 34,806,783 C2092Y possibly damaging Het
Zfp606 T to G 7: 12,481,196 probably benign Het
Zfp933 G to A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G to A 2: 165,812,394 R733* probably null Het
Phenotypic Description
Figure 1. Homozygous stinger mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Homozygous stinger mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The stinger phenotype was identified among ENU-mutagenized G3 mice of the pedigree F5770, some of which exhibited a diminished T-independent IgM response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll; Figure 1) and a reduced T-dependent IgG response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal; Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced T-independent IgM responses to NP-Ficoll using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 84 mutations (X-axis) identified in the G1 male of pedigree F5770.  Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 84 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Pik3cd: a T to G transversion at base pair 149,657,319 (v38) on chromosome 4, or base pair 68,648 in the GenBank genomic region NC_000070. The strongest association was found with a recessive model of linkage to the T-independent B cell response, wherein 22 affected variant homozygotes departed phenotypically from 26 homozygous reference mice and 61 heterozygous mice with a P value of 4.16 x 10-19 (Figure 3). A substantial semidominant effect was observed in the T-independent B cell response assay but the mutation is preponderantly recessive.  The mutation corresponds to residue 1,447 in the mRNA sequence NM_001029837 within exon 8 of 23 total exons.

 

1431 CCGCGCATGGCTCGACTCTGTTTTGCTCTCTAT

385  -P--R--M--A--R--L--C--F--A--L--Y- (ENSMUSP00000136045)

 

The mutated nucleotide is indicated in red. The mutation results in a leucine (L) to arginine (R) substitution at position 390 (L390R) in all of the Pik3d isoforms; see the Protein Prediction section for more information on the Pik3cd isoforms. The mutation is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction
Figure 4. Domain structure of p110δ. The stinger mutation (L390R) is shown. Abbreviations: ABD, adaptor binding domain; RBD, Ras binding domain. See the text for more details. This image is interactive; click to view other Pik3cd mutations.

Pik3cd encodes p110δ, one of four (with p110α, p110β, and p110γ) catalytic phosphatidylinositol 3-kinase (PI3K) class IA subunits; the p110δ subunit is most closely related to p110β in that they share 58% overall sequence identity (1). The p110δ PI3K subunit is highly conserved, with mouse and human p110δ sharing 94% amino acid sequence identity (2). All of the p110 PI3K catalytic subunits contain an adaptor-binding domain (ABD; amino acids 1-104), a Ras-binding domain (RBD; amino acids 189-278), a C2 domain (amino acids 324-474), a helical domain (amino acids 500-674), and a kinase domain (split into N- and C-lobes; amino acids 675-829 and 830-1044, respectively) [Figure 4; (2;3)]. The ABD domain binds the p85 PI3K regulatory subunit to form the PI3K functional heterodimer (4) and the RBD mediates an interaction with Ras in a GTP-dependent manner (1;2;5). Lys223 within the RBD is conserved in all of the p110 subunits and is essential for the association of p110 with Ras (5). p110δ has a basic-region, leucine-zipper (bZIP)-like domain (amino acids 400-439) that overlaps with the C2 domain and a Pro-rich region (amino acids 292-311) between the RBD and the C2 domains; the C2 and bZIP-like domains as well as the Pro-rich region are proposed to mediate protein-protein interactions with proteins that contain SH3 domains (1).

 

Figure 5. Crystal structure of mouse p110δ. The crystal structure of p110δ is comprised of amino acids 106-1044. The helices are blue, while the beta strands are purple. Image is interactive, click to rotate. Figure was adapted from PDB:2X38 and (3).

A crystal structure of mouse p110δ lacking the ABD domain (amino acids 106-1044) has been solved [Figure 5; PDB:2X38; (3)]. The linker between the ABD and RBD packs tightly against the helical domain and bridges the RBD and C2 domains (3). Within the N-lobe of the kinase domain, helices kα1 and kα2/kα2′ form a hairpin that sits on top of a five-stranded β-sheet formed by kβ3-kβ7 (3). Berndt et al. defined four regions within the ATP-binding pocket that are essential for inhibitor binding: an adenine pocket that forms a hinge between the N- and C-lobes of the kinase domain, a specificity pocket, an affinity pocket, and a hydrophobic region within the mouth of the active site (3)

 

p110δ is autophosphorylated in a Mn2+-dependent fashion at a serine residue within a conserved DRx3Nx12–13DFG motif in the kinase domain (1). Upon autophosphorylation, the lipid kinase activity of p110δ is down-regulated (1).

 

Most cell lines express multiple Pik3cd transcripts and leukocytes express higher numbers of unique Pik3cd transcripts than non-leukocytes. The Pik3cd gene has several untranslated exons designated as exon -1, -2a, -2b, -2c, and -2d upstream of the start codon in exon 1 (6). Exon -1 occurs together with one of four of the -2 exons (i.e., exon -2a, -2b, -2c, or -2d) in mouse cells to generate at least four unique transcripts, and with one of two -2 exons (-2a or -2b) in human cells to generate at least two unique transcripts (6). Both the human and mouse genes contain an in-frame stop codon immediately upstream of the start codon in exon 1, indicating that the upstream exons are not translated as part of the p110δ protein. PIK3CD also encodes an alternative isoform, p37δ, using an alternative splice site in intron 5 that codes a 163-bp insertion, resulting in a frame-shift and coding of a premature stop codon (7). The p37δ isoform in humans is a 102-amino acid peptide that does not contain known protein motifs. The sequence around the intron 5 splice site is conserved among mammals. In the mouse, the p37δ protein product generated from alternative splicing at this splice site is predicted to be 302-amino acids, encoding the p85 binding domain and a truncated RBD, but no catalytic domain.

 

The stinger mutation (L390R) is within the C2 domain of p110δ.

Expression/Localization

Northern blot analysis of human tissues detected highest expression of PIK3CD in peripheral blood mononuclear cells, spleen, and thymus (1;2;8). Lower expression was detected in testes, uterus, colon, and small intestine (2). No expression was detected in prostate, heart, brain, and liver (2). PIK3CD is expressed in several cancer cells including melanoma, neuroblastoma, breast, and glioma cell lines (9-11). In mouse tissues, high Pik3cd expression was detected in spleen, thymus, testis, and in granulosa cells of growing follicles in the ovary (2;12).

 

In the rat, the p110δ protein is expressed in the spleen and thymus, but not in other tissues (1). In addition, p110δ is expressed in both primary (both lymphoid and myeloid cells, but not by platelets) and transformed white blood cells of the rat, independent of differentiation stage (1). In the mouse, p110δ is highly expressed in the spleen, lymph nodes, thymus, leukocytes (1;2;13), platelets (14), oocytes, and granulosa cells (12) as well as at low levels in most other cell types including melanocytes, breast cells, neurons (15), endothelial cells (16), and lung fibroblasts (17).

 

p37δ is highly expressed in human thymus, lung, and spleen; low levels of p37δ were detected in normal colon and ovarian biopsy lysates (7). Elevated amounts (from 3-450-fold) of p37δ were detected in colorectal and ovarian tumor lysates compared to normal tissues (7).

 

p110δ expression can be regulated by several factors. PIK3CD has a TNFα (see the record for PanR1)-inducible promoter (18). Treatment of human umbilical vein endothelial cells (HUVECs), human pulmonary adenocarcinoma cells, and human synovial fibroblasts from rheumatoid arthritis (RA) patients with TNFα enhanced the expression of p110δ mRNA and protein; p110δ expression was not induced in murine primary lung or cardiac endothelial cells upon TNFα treatment (18;19). TNFα induced the expression of several PIK3CD transcripts that contained one of three exons, exons −2c, −2d or −2e, within the PIK3CD 5′-untranslated region (18). PIK3CD transcripts containing exons -2c, -2d, or -2e were expressed at low levels in unstimulated cells and were induced by TNFα in endothelial cells and synovial fibroblasts, but not in leukocytes (18). A transcription factor-binding cluster within mouse exon -2a (or immediately 5’ upstream of human exon -2a) promoted enhanced promoter activity in leukocytes compared to non-leukocytes (6;18). Four of the seven transcription factor binding sites (i.e., ETS, IRF, NFAT, and LEF) in the cluster are associated with the regulation of hematopoiesis and leukocyte-specific gene expression (6).

Background

PI3Ks are highly conserved lipid signaling kinases. After cell stimulation by growth factors, hormones, cytokines, or antigens, the PI3Ks are recruited to the inner face of the plasma membrane where they phosphorylate phosphatidylinositol (PtdIns), PtdIns 4-phosphate, and/or PtdIns-4,5-bisphosphate (PtdIns(4,5)P2; PIP2) at the D3 position of the inositol ring, generating their respective D3’ phosphorylated derivatives [e.g., PIP2 phosphorylation generates the second messenger phosphatidylinositol-3,4,5-trisphosphate (PtdIns(3,4,5)P3; PIP3); (1;14); reviewed in (20;21); Figure 6].  PIP3 recruits downstream signaling proteins to the plasma membrane including the serine-threonine kinases Akt (alternatively, protein kinase B [PKB]) and phosphoinositide-dependent kinase 1 (PDK1) as well as Tec family tyrosine kinases and exchange factors that regulate heterotrimeric guanosine triphosphate (GTP)-binding proteins such as Vav, PLCγ1, and PLCγ2 (see the record for queen) [(14); reviewed in (20;21)]. Subsequently, activation of downstream targets (e.g., Rac1, p21-activated kinase 1 [PAK1], MEK, ERK1, and ERK2) mediates several cellular processes including growth, proliferation, differentiation, survival, apoptosis, adhesion, and migration [(13); reviewed in (20)]. PI3K-associated signaling can be antagonized by PTEN (phosphatase and tensin homologue deleted on chromosome 10) and SHIP (SH2-containing inositol phosphatase), lipid phosphatases that dephosphorylate PIP3 on the D3 and D5 positions, respectively [reviewed in (22)]. For more information on the PI3K pathway, please see sothe.

 

The PI3Ks are divided into class I, II, or III based on their molecular structure, regulation, and in vivo substrate specificities [reviewed in (20;21)]. Class I PI3Ks include class IA and class IB PI3K subclasses; class IA PI3Ks are typically activated downstream of tyrosine kinase-linked receptors, while class IB PI3Ks are activated downstream of G protein-coupled receptors (14); reviewed in (21)]. To form a functional class I PI3K, a p110 catalytic subunit forms a heterodimer with a p85 regulatory subunit [(2;14;23); reviewed in (20)]. In activated cells, the p85 subunit recruits the p110 subunit to the plasma membrane and activates it (24-26). Conversely, the p85 subunit also inhibits the enzymatic activity of the p110 subunit in quiescent cells (7). The p85 subunits also mediate the interactions of the PI3Ks with the cytoplasmic domains of receptors as well as with adaptor proteins such GAB2 (GRB2-associated binding protein 2) (21). There are three class IA p110 subunits (p110α, p110β, and p110δ) encoded by Pik3ca, Pik3cb, and Pik3cd, respectively, and one class IB p110 subunit, p110γ (encoded by Pik3cg).  Five class IA regulatory subunits are encoded by three distinct genes (Pik3r1 (p85α, p55α, p50α), Pik3r2 (p85β) and Pik3r3 (p55γ); p85α, p55α, and p50α are splice variants of Pik3r1 (24;27).

 

Figure 6. PI3Kδ mediates several cell functions. After stimulation, PI3Kδ is recruited to the inner face of the plasmaplasma membrane, where it generates phosphatidylinositol-3,4,5-trisphosphate (PtdIns(3,4,5)P3) by direct phosphorylation of phosphatidylinositol-4,5-bisphosphate (PtdIns(4,5)P2). PI3Kδ binds directly or indirectly to receptors through an interaction of the regulatory subunit (p85) with tyrosine-phosphorylated recognition motifs on the receptor cytoplasmic domains or soluble adaptor proteins such as GAB2 (GRB2-associated binding protein 2). Activation of PI3Kδ leads to the generation of PtdIns(3,4,5)P3, which serves as a docking platform for downstream proteins such as AKT. Subsequently, phosphorylating events and protein–protein interactions of downstream targets controls multiple biological processes. PTK, protein tyrosine kinase. Figure adapted from (20). See the text as well as Figure 6 for more details about the function of PI3Kδ.

Known functions of PI3Kδ

PI3Kδ, comprised of p110δ and a p85 subunit, has several known functions (Figure 6). Several of these functions are highlighted below.

 

Immune cells

Active p110δ is required for naïve CD4+ T cell proliferation and efficient IFNγ production in response to antigen (28-30). While T cell development in the thymus was normal in mice that express a kinase-inactive form of p110δ (Pik3cdD910A/D910A; MGI:2385596; alternatively, Pik3cdtm1.1Bvan), the Pik3cdD910A/D910A mice exhibited reduced numbers of both CD4+ and CD8+ T cells in the spleen and lymph nodes [(29); reviewed in (22)]. The CD4+:CD8+ T cell ratio was normal, but CD44 expression was reduced in the Pik3cdD910A/D910A mice, indicating that p110δ functions in the differentiation or survival of effector and/or memory T cells (29). T cells from the Pik3cdD910A/D910A mice exhibited reduced TCR-dependent proliferation and migration as well as mislocalization of memory T cells in antigenic tissue; anti-CD3/CD28-stimulated proliferation was normal (29;31). PI3K-associated signaling in T cells from Pik3cdD910A/D910A mice was impaired, but ERK phosphorylation and NF-κB nuclear translocation were unaffected after CD28 stimulation (30).

 

PI3Kδ is essential for the differentiation and expansion of T helper 1 (TH1) and TH2 cells (30) as well as for the development, differentiation, and function of CD4+CD25+FOXP3+ regulatory T (Treg)-cells (32). Pik3cdD910A/D910A mice exhibited increased Treg development in the thymus, but Treg proportions in the spleen, lymph nodes, and peripheral organs were reduced (33). Comparison of the Pik3cdD910A/D910A Treg transcriptome to that of wild-type mice determined that expression of CD38, a cyclic ADP ribose hydrolase, was reduced in the mutant mice indicating that p110δ regulates CD38 expression to modulate Treg development in the thymus (33). In the colon, Pik3cdD910A/D910A Treg cells could not efficiently suppress responder CD4+ T cell proliferation (33). As a result, Pik3cdD910A/D910A mice developed spontaneous colitis (34). In an experimental model of colitis, the Treg cells of the Pik3cdD910A/D910A colon secreted negligible levels of IL-10 compared to wild-type cells and did not suppress inflammation of the colon (32;35). The Pik3cdD910A/D910A mice also exhibited defective Treg expansion, recruitment, effector function, and impaired memory responses with a concomitant decrease in IFNγ and TNF production in response to Leishmania major infection (36). L. major-reactive T cells from healed Pik3cdD910A/D910A mice contained lower numbers of CD62L(lo) and CD62(hi) T cells than those from wild-type mice (36). The CD62L(hi) T cells failed to downregulate CD62L expression in response to L. major and the ability of the CD62L(lo) cells to exit the lymphoid organs and emigrate to sites of infection were impaired (37). The resistance to L. major observed in the Pik3cdD910A/D910A mice was lost when enriched Treg cells from wild-type mice were transferred to the mutant mice (37).

 

PI3Kδ controls both the perforin-granzyme and death receptor cytotoxicity pathways in cytotoxic T lymphocytes (CTLs) (38). In Pik3cd knockout (Pik3cd-/-) mice, CTLs were inactive, quiescent, and phenotypically mimicked naïve T cells (CD69lowCD62Lhigh) (38). As a result, cytotoxicity was diminished towards CTL target cells and the Pik3cd-/- CTLs expressed low levels of genes associated with the cytotoxic machinery including Prf1 (see the record for Prime), GrzmA, GrzmB, FasL (see the record for riogrande), and Trail compared to wild-type CTLs (38). CTL-mediated tumor surveillance was also impaired upon the loss of Pik3cd expression and the Pik3cd-/- mice developed significantly larger tumors than wild-type mice when challenged with MC38 colon adenocarcinoma cells (38).

 

PI3Kδ is required for IFNγ, TNFα, and GM-CSF secretion by natural killer (NK) cells as well as for NK cell development, differentiation, and cytotoxicity (39;40). Pik3cdD910A/D910A mice exhibited decreased NK cellularity, defective Ly49C and Ly49I NK subset maturation, and decreased CD27(high) NK numbers (41). PI3Kδ and PI3Kγ are both required for NK cell chemotaxis in response to CXCL12 and CCL3 as well as for NK cell migration during early pregnancy to the inflamed peritoneum and uterus (42). PI3Kδ alone is required for chemotaxis in response to S1P and CXCL10 as well as for steady-state NK cell distribution in lymphoid and nonlymphoid tissues (42). In the Pik3cdD910A/D910A mice, NKG2D, Ly49D, and NK1.1 receptor-mediated cytokine and chemokine production were reduced in response to viral infection due to defective activation and phosphorylation of the JNK pathway (41).

 

Figure 7. Pre-BCR and BCR signaling. Pre-BCR engagement results in the activation of SYK (spleen tyrosine kinase), which together with Src-family kinases (LYN, FYN, BLK), phosphorylates many substrates and triggering signaling pathways that are involved in both proliferation and differentiation of pre-B cells. These include activation of phosphoinositide 3 kinase (PI3K) by phosphorylating the coreceptor CD19 and/or the adaptor protein B-cell PI3K adaptor (BCAP). PI3K activation results in the generation of phosphatidylinosital-3,4,5-triphosphate (PIP3), which recruits plekstrin-homology domain signaling molecules to the membrane including the serine threonine protein kinase B (PKB) and its activating kinase 3- phosphoinositide-dependent protein kinase 1 (PDK1). Signaling through this pathway pathway suppresses recombination-activating gene 1 (RAG1) and RAG2 expression, blocks Igk (the k chain of the immunoglobin light chain) gene recombination, and induces cell proliferation. SYK also phosphorylates SH2-domain containing leukocyte protein of SLP65, resulting in the organization of a molecular complex that includes Bruton’s tyrosine kinase (BTK) and phospholipase Cγ2 (PLCγ2). This complex controls downregulation of l-5, a component of the surrogate light chain (SLC), and upregulates the expression of RAG proteins and the interferon-regulatory factor 4 (IRF4). IRF4 positively regulates Igk recombination. SLP65 also modulates PKB activity either directly or by altering the activity of SYK, CD19, or PI3K. Alternatively, SLP65 may regulate PKB activity by activating lipid phosphatases such as SH2-domain containing inositol-5 phosphate (SHIP) and altering PIP3 levels. Multiple downstream signaling pathways are activated by BCR stimulation and lead to a multitude of cellular responses. Following aggregation and localization of BCR molecules, the tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn) and by SYK . These phosphotyrosines then act as docking sites for the SH2 domains of SYK, resulting in SYK phosphorylation and activation. SYK phosphorylates a number of downstream targets including BLNK, PLC-g2 and protein kinase C β (PKCβ). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of 3′-phosphorylated phosphoinositides. One of these lipids, phosphatidylinositol-3,4,5-triphosphate (PIP3), binds selectively to the pleckstrin homology (PH) domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-g2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1 or CARD11), which are involved in NF-κB activation along with PKCβ. Image is interactive. Click to view mutations.

PI3Kδ has several B cell-related functions, several of which are listed below. PI3Kδ is required for T cell-dependent and T cell-independent antibody production after antigen stimulation, IgM-specific antibody-induced B cell proliferation, B cell receptor (BCR)-induced DNA synthesis and proliferation, and B cell survival after LPS treatment [Figure 7;(13;29;43-47)]. PI3Kδ is required for IL-6 and IL-10 production in B cells in response to TLR4 (see the record for lps3) and TLR9 (see the record for CpG1) ligands (48). PI3Kδ is required for BAFF-induced B cell growth, long-term survival, and proliferation as well as for the upregulation of the BAFF receptor after BCR crosslinking (49). PI3Kδ regulates the IgE isotype switch from IgG1 through transcriptional regulation at the epsilon locus and regulation of activation-induced cytidine deaminase expression (50). PI3Kδ is required for light chain allelic/isotype exclusion and for effective silencing of RAG expression (51). PI3Kδ is also required for IgM and IgG production as well as protein kinase B, IκB (inhibitor of nuclear factor κB; see the record for panr2), and c-Jun N-terminal kinase activation in response to LPS (52). PI3Kδ is not required for early B cell development in the bone marrow and mature B cell survival in the spleen (53). In addition, PI3Kδ is not required for TLR4- and TLR9-mediated B cell differentiation into plasma cells or Ig isotype switch (48). PI3Kδ transcriptionally regulates cyclin D2 expression and subsequent cell cycle entry in B cells upon BCR cross-linking (24). A fraction of Pik3cd-/- B cells stimulated with anti-IgM were able to enter G1 phase, but did not proceed into S and G2/M phases (24). Pik3cd-/- mice exhibited a loss of function of the BCR complex; cytokine receptor-associated signaling was not affected (40;46). The total number of cells in the bone marrow from the Pik3cd-/- mice was comparable to wild-type mice. However, the percentage of bone marrow B cells was decreased in the Pik3cd-/- mice by ~25% compared to wild-type mice. The percentages of pro-B (CD43+ B220+) cells were normal in the Pik3cd-/- mice, but the percentage of total B220+ lymphocytes was reduced compared to wild-type levels in both the spleen and lymph nodes (29). CD5+ B1 cells were not detected among the peritoneal lymphocytes in the Pik3cd-/- mice (45). The levels B1 and B2 B cells in the peritoneal cavity and CD21hi CD23lo MZ B cells of the spleen were reduced (45). The sizes of the lymph nodes and spleens from the Pik3cd-/- mice were reduced compared to those in wild-type mice.

 

In mast cells, PI3Kδ is required for SCF- and IL3-induced proliferation, adhesion, migration, and degranulation as well as for TNF and IL-6 release in response to antigen (54).

 

PI3Kδ mediates neutrophil accumulation in inflamed tissues by preventing chemoattractant-directed migration as well as the adhesive interactions between neutrophils and the endothelium (16;55). Pharmacological inhibition of PI3Kδ blocked TNF1α-stimulated elastase (see the record for Ruo) exocytosis from neutrophils in a mouse model of inflammation, but did not result in changes in neutrophil bactericidal activity and FcγR-stimulated superoxide generation (56).

 

PI3Kδ mediates CSF-1-regulated spreading and invasion of macrophages by controlling actin reorganization (8;57). In addition, PI3Kδ functions at the trans-Golgi network in macrophages as part of the membrane fission machinery that mediates the trafficking and secretion of TNF upon induction by LPS (58).

 

PI3Kδ is required for efficient bone marrow-derived eosinophil rolling, migration, and adhesion to VCAM-1 and ICAM-1 as well as activation-induced cytoskeletal and morphological changes (59). In an experimentally induced model of allergic airway inflammation, treatment with a p110δ inhibitor resulted in inhibited airway eosinophil recruitment, reduced mucus secretion, and the expression of proinflammatory molecules (59). Pik3cd-/- mice with ovalbumin-induced allergic asthma exhibit blocked airway eosinophil activity (60).

 

PI3Kδ induces the internalization of TLR4 as well as the plasma membrane dissociation and subsequent degradation of TIRAP upon LPS-induced activation of dendritic cells (61). Inactivation of p110δ resulted in prolonged TIRAP (see the record for torpid)-mediated signaling via NF-κB (see the record for finlay) and p38 and subsequent increased proinflammatory cytokine production as well as a concomitant decrease in TRAM (see the record for Branch)-dependent IRF3 signaling that generates anti-inflammatory cytokines including IL-10 and IFN-β (61). In Pik3cd-/- mice, changes in TLR4-associated signaling resulted in increased endotoxin-induced death of the mice compared to wild-type mice (61).

 

Platelets

PI3Kδ functions in GPVI/FcRγ chain-, αIIbβ3-, and possibly GPIb-IX-V-associated signaling to regulate platelet spreading on fibrinogen and to mediate platelet activation (14). Pik3cdD910A/D910A and Pik3cd-/- mice did not exhibit an overt bleeding disorder and had normal platelet counts (14). Platelets from both models exhibited normal aggregation in response to the GPCR agonist adenosine diphosphate and to phorbol ester, which activates PKC (14). However, platelets from either the Pik3cdD910A/D910A and Pik3cd-/- mice exhibited a slower shape change as well as a reduced rate and amplitude of aggregation in response to the GPVI-specific agonist collagen-related peptide (14).

 

Ovaries

PI3Kδ is essential for follicle stimulating hormone (FSH) and estradiol (E2)-stimulated follicle growth in ovarian granulosa cells as well as granulosa cell proliferation in preantral follicles; it is not required for primordial follicle activation and oocyte development (12). Pik3cd-/- female mice are subfertile and produce reduced litter sizes (by ~50%) compared to Pik3cd heterozygous and wild-type mice due to fewer growing follicles and more atretic antral follicles in the ovary (12). The follicle growth defect was determined to be intrinsic to the ovary (12).

 

Nervous system

PI3Kδ is required for efficient axonal elongation during development and regeneration of the nervous system after injury (15). Neuronal development in Pik3cd-/- mice was normal, but dorsal root ganglia neurons were susceptible to growth cone collapse and the mice often exhibited decreased axonal extension (15). Loss of p110δ activity led to reduced Akt kinase activity with a concomitant increase in RhoA activity (15).

 

Human Conditions

PIK3CD mutations have been linked to cancer (43;62), rheumatoid arthritis (20), and asthma (63). Patients with heterozygous gain-of-function mutations in PIK3CD (e.g., Glu1021Lys) exhibit lymphadenopathy, CD4 lymphopenia, reduced class-switched memory B cells, increased serum IgM, reduced serum IgG2 levels, nodular lymphoid hyperplasia, sinopulmonary infections, viremia after cytomegalovirus and/or Epstein-Barr virus (EBV) infection, non-EBV-associated malignancies, impaired memory T and B cell development, and deficiency in naïve CD8+ T cells with concomitant high levels of senescent effector T cells (64-66). In addition, Akt phosphorylation, mTOR activation, glucose uptake, and terminal effector differentiation were all increased in T cells from the PIK3CD patients. The amounts of naïve T cells were corrected upon treatment with rapamycin to inhibit mTOR activity (64).

 

PI3Kδ is required for cell proliferation in acute myeloid leukemia (AML); AML blast cells exhibit a variable enhanced level of PIK3CD compared to normal hematopoietic progenitor cells (43). PI3Kδ also mediates the growth and survival of neuroblastoma cells through the activation of the mTOR/S6K pathway and the regulating the expression levels of antiapoptotic Bcl-2 proteins (9). In glioma cells, p110δ regulates cell movement and may contribute to the invasive phenotype of gliomblastoma multiforme, an aggressive primary brain tumor (10).

 

PI3Kδ activity is increased in peripheral blood T cells from systemic lupus erythematous (SLE) compared to that in unaffected patients (67). In SLE, PI3Kδ activity regulates activation-induced cell death of T cells and mediates enhanced SLE memory T cell survival (66;67).

 

Examination of synovium from rheumatoid arthritis (RA) and osteoarthritis patients determined that p110δ is expressed at higher levels in patients with RA (19). PI3Kδ regulates the growth and survival of fibroblast-like synoviocytes (FLS) that mediate cartilage destruction in RA (19). In addition, PI3Kδ regulates actin cytoskeleton organization and the formation of lamellipodium after platelet-derived growth factor (PDGF) stimulation (19). Small interfering RNA-mediated knockdown of PIK3CD decreased PDGF-mediated migration and invasion of FLS (68). Synovial inflammation as well as bone and cartilage erosion was reduced in paws from Pik3cd-/- (Pik3cdtm1Tnr) mice after arthritogenic serum administration (69). These results indicate that a reduction in p110δ impairs the onset and progression of arthritis (69).

 

PIK3CD maps to the IBD7 susceptibility locus on chromosome 1p36 (70;71) and intestinal samples from patients with Crohn’s disease expressed significantly less PIK3CD compared to non-inflammatory bowel disease controls (35). In 27 samples of colorectal tumors, p37δ mRNA was increased 11-fold compared to adjacent normal tissue (7). In addition, p37δ mRNA expression was significantly higher in the tumor-adjacent tissue compared with healthy control colon (7). Overexpression of p37δ in HEK-293 cells resulted in elevated amounts of RAS, high levels of phosph-ERK1/2, and increased proliferation (7). Taken together, p37δ stabilizes RAS proteins, stimulating the phosphorylation of ERK1/2 (7). Long-term stimulation of p37δ cells resulted in higher basal levels of pAKT T308 and slightly lower levels of pAKT S473 compared to control cells. Fransson et al. proposed that both the PI3K-Akt and RAS pathways are affected by the overexpression of p37δ (7). The p37δ isoform is proposed to degrade or sequester free p85, removing the positive regulation of PTEN, subsequently resulting in increased Akt phosphorylation (7). The p37δ isoform is also proposed to stabilize total RAS levels, resulting in increased ERK phosphorylation.

Putative Mechanism

Two Pik3cd-/- mouse models (Pik3cdtm1Jni, MGI:2446574; Pik3cdtm1Tnr; MGI:2388047) exhibited reduced levels of serum IgM and IgG1 levels compared to wild-type mice (45;46). The Pik3cdtm1Jni mice exhibited reduced TNP-specific IgM and IgG1 T-independent humoral responses compared to wild-type mice after injection with TNP-LPS; the levels of TNP-specific IgG2a, IgG2b, and IgG3 were comparable to those in wild-type mice (46). After immunization with TNP-Ficoll, the TNP-specific levels of IgM, IgG1, IgG2b, IgG3, and IgG2a were reduced in the Pik3cd-/- mice compared to wild-type mice (46). The Pik3cdtm1Tnr mice exhibited reduced T cell-independent IgM and IgG3 responses to DNP-Ficoll compared to wild-type mice (45). The Pik3cdtm1Jni mice did not exhibit a T-dependent response to TNP-KLH (46). The Pik3cdtm1Tnr mice produced significantly less T cell-dependent DNP-specific IgM, IgG1 IgG2a, IgG2b, and IgG3 antibodies seven days after DNP-KLH injection (45). NP-KLH immunization of mice with T cell-specific deletion of Pik3cd (T p110δfl/fl) resulted in reduced numbers of CD95+B220+ germinal center (GC) B cells and reduced ratio of GCs per B cell follicle compared to p110δfl/fl (CD4cre-) controls; NP-specific IgG1 in the T p110δfl/fl mice were only slightly decreased, but the high-affinity NP-specific IgG1 response was impaired (72). In a B cell-specific Pik3cd knockout (B p110δfl/fl) mouse, IgM and high affinity NP-specific IgG1 titers were similar between B p110δfl/fl and p110δfl/fl mice after NP-CGG immunization, but antigen-specific IgE levels were increased 30-fold after immunization (72).

 

Characterization of the stinger mice determined that, similar to the Pik3cd mutant mouse models described above, the stinger mice are unable to mount either a T-dependent or a T cell-independent B cell response. Similarity between stinger and Pik3cd-deficient phenotypes is consistent with a strongly hypomorphic or null effect of the Leu390Arg mutation in stinger.

Primers
Genotyping

Stinger genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

PCR Primers

Stinger (F): 5’- AGGGAGCTGCCTACAAAAGCCTAC-3’

Stinger (R): 5’- TGCCTTGGGCTATCAATGCACTG-3’

 

Sequencing Primer

Stinger_seq(F): 5’- TCACAGGCTATCCCTAGAGTGAG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 673 nucleotides is amplified (Chr.4: 149657036- 149657708, GRCm38):

 

agggagctgc ctacaaaagc ctactggcct acaggtctag agcagatagc ccaagcaggc         

cgttcacagg ctatccctag agtgagtagg gatccaagat ggtggagaag cttggggttt      

agggtccccc aggacccctg tcctcaacct gcccgcctgc ctgtggcttg gggcactgaa      

gggaggccct cccagccagc caatactcac cgccttctta gacttcttct ttgtggagcg      

tgccttctta gccttctcca cgacggcata gagagcaaaa cagagtcgag ccatgcgcgg      

gaggtcacag acgctgatat cgaactccag tcgctgcttc cacacgggct ctgagcatac      

attcacctcc gagcttgaca cagtcttgca cagcatctca ttgccatgga agagcccggc      

ctgaacaacc agctgggggt cggggtggat taatgggagg agaggcccct ggctccatcc      

cttctctctt ctcaccaggc tactcacaac aattttctcc tcaagtgtcc taattcttaa      

atgggtctga atctactttc tcgtgatgtg tgtgtgtgtg tgtgtgtgtg tttcttagag      

ggaaagccac tagtcaagta ggacaagaag ccatggggca ggggaggcca cagtgcattg      

atagcccaag gca

 

FASTA sequence

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (T>G, Chr. (+) strand; A>C, sense strand).

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsCarrie Arnold and Elaine Pirie