Phenotypic Mutation 'may'

• Allele: may
• Mutation Type: nonsense
• Chromosome: 5
• Coordinate: 140,862,250 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Card11
• Gene Name: caspase recruitment domain family, member 11
• Synonym(s): 2410011D02Rik, BIMP3, CARMA1, 0610008L17Rik
• Chromosomal Location: 140,858,745-140,986,337 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000082941; Gene: ENSMUSG00000036526; AA Change: R1016*

Domain	Start	End	E-Value	Type
Pfam:CARD	23	109	1.3e-23	PFAM
coiled coil region	176	440	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
low complexity region	535	549	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
PDZ	674	755	2.73e-1	SMART
Blast:SH3	776	838	1e-10	BLAST
low complexity region	839	850	N/A	INTRINSIC
low complexity region	920	934	N/A	INTRINSIC
SCOP:d1kjwa2	970	1149	1e-18	SMART
Blast:GuKc	973	1139	1e-102	BLAST

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Dominant
• Mode of Inheritance: Autosomal Dominant
• Local Stock: Live Mice, Sperm
• MMRRC Submission: 036966-MU
• Last Updated: 2019-04-16 7:15 PM by Diantha La Vine
• Record Created: 2011-01-30 2:13 PM by Carrie N. Arnold
• Record Posted: 2013-07-23
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek
• Authors: Carrie Arnold and Elaine Pirie

Accession Number

NCBI RefSeq: NM_175362; MGI: 1916978

Alleles Listed at MGI

All alleles(10) : Targeted(7) Gene trapped(1) Chemically induced(2)

Phenotypic Description

Figure 1. May mice mice have low T-independent IgM responses (left), but normal T-dependent IgG responses (right).

The May phenotype was identified among ENU-mutagenized G3 mice in a screen for mutations impair T-independent B cell responses. May mice mice have low T-independent IgM responses 5 days after immunization with NP-Ficoll (Figure 1, left), but normal T-dependent IgG responses 14 days after immunization with a recombinant SFV vector encoding the model antigen, β-galactosidase (βGal) (Figure 1, right). May B cells express high surface levels of IgM.

Nature of Mutation

The May strain was regenerated by intracytoplasmic sperm injection (ICSI) of cryopreserved sperm from an affected homozygote into C57BL/6J oocytes. Whole exome HiSeq sequencing of one of the resulting mice, an affected female, identified 26 mutations. Based on initial genotyping of the 26 mutation sites in one affected and three unaffected mice, five candidate genes (Ggh, 1810074P20Rik, Card11, Fanca, Rps24) were identified because they were homozygous for the reference sequence in all unaffected mice and heterozygous for the mutant allele in the affected mouse.  Subsequent analysis of nine additional affected mice and two unaffected mice provided strongest support for a Card11 mutation as causal for the May phenotype; bulk segregation analysis (BSA) also indicated that the mutation in Card11 was causative. The mutation is a C to T transition at base pair 140876495 (v38) on Chromosome 5 in the GenBank genomic region NC_000071 encoding Card11. The mutation corresponds to residue 3367 in the mRNA sequence NM_175362 within exon 23 of 25 total exons.  Phenotypic inheritance pattern suggests that the May mutation is semi-dominant or dominant.

3352 AGAGATGAGTTCCTCCGAAAGCAGAAGACAGAG 1011 -R--D--E--F--L--R--K--Q--K--T--E-

The mutated nucleotide is indicated in red.  The mutation results in an arginine (R) to premature stop codon substitution at amino acid 1016.

Protein Prediction

Figure 2. Domain structure of CARMA1. The May mutation results in an arginine to premature stop codon substitution at amino acid 1016 within the guanylate kinase (GUK) region. Four predicted α-helices are represented in pink. This image is interactive. Other mutations found in CARMA1 are noted in red. Click on each mututation for more specific information.

The May mutation is an arginine to premature stop codon subsitition at position 1016 of CARMA1, the protein encoded by Card11. The CARMA1 protein has a membrane-associated guanylate kinase (MAGUK) domain at the C-terminus. MAGUK family proteins contain 3 modular protein interaction domains, of which the hallmark is an approximately 300 amino acid region with homology to yeast guanylate kinase (GUK), but which is catalytically inactive. In addition, up to three PDZ domains and an SH3 domain are always present in tandem with the guanylate kinase domain. The May mutation is within the GUK subdomain (amino acids 954-1142) (1;2). Protein expression in the May mice has not been examined.

Please see the record for king for more information about Card11.

Putative Mechanism

The phenotype of the May mice is similar to those observed in other CARMA1 mutants (3-6). For example, homozygous unmodulated mice displayed impaired IgM and IgG3 responses to immunization with DNP-Ficoll (7).  The IgM and IgG responses to the T-dependent antigen chicken γ globulin were reduced in unmodulated mice (7); this phenotype has not been tested in May animals. Taken together, these data strongly suggest that the May mutation causes a loss of function of the CARMA1 protein. As the May mutation is a late stop codon, it is possible that the protein product is mostly intact and capable of engaging its interaction partners in the CARMA1/BCL10/MALT1 complex, but dominantly inhibits complex function. Upon T cell receptor-mediated activation of the T cell, the CARMA1/BCL10/MALT1 complex is recruited to lipid rafts of the immunological synapse and activates the IKK complex, leading to the degradation of IκB and the subsequent activation of NF-κB (2;3;8-11). The CARMA1/BCL10/MALT1 complex functions similarly in B cells to activate NF-κB in response to BCR engagement (12).

Primers

Primers cannot be located by automatic search.

Genotyping

May genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

PCR Primers

May(F): 5’- TGCATGGTCTGGCAGAGCAATC -3’

May(R): 5’- ATGACCCAGTGCCTCACAGAGATG -3’

Sequencing Primer

May_seq(F): 5’- GCCTCACAGAGATGGTTGG -3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 404 nucleotides (from Genbank genomic region NC_000071 for linear DNA sequence of Card11) is amplified:

123864                          tgcatgg tctggcagag caatcatgaa cttgacccca

123901 ctcccaggga gcttccctat ctagtagaga agatgatgtt ccatttaacc aaagtgggaa

123961 agaaccagat gaatatcaaa ttatgtggca cttaggaggg acagataggg cctggaagag

124021 acaacccacc acaaatagca cttgccaccc tgggcactaa ctcccctctc ttcagatatt

124081 gtcacaagag atgagttcct ccgaaagcag aagacagaga ccatcatcta ctcccgggaa

124141 aagaacccca acacctttga atgcatcgtc cctgccaaca ttgaggctgt ggcagccaag

124201 gtgagagacc ctgggtactg gccagactaa ggccctaccc aaccatctct gtgaggcact

124261 gggtcat

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated C is shown in red text.

References

  1. Bertin, J., Wang, L., Guo, Y., Jacobson, M. D., Poyet, J. L., Srinivasula, S. M., Merriam, S., DiStefano, P. S., and Alnemri, E. S. (2001) CARD11 and CARD14 are Novel Caspase Recruitment Domain (CARD)/membrane-Associated Guanylate Kinase (MAGUK) Family Members that Interact with BCL10 and Activate NF-Kappa B. J Biol Chem. 276, 11877-11882.

  2. Gaide, O., Martinon, F., Micheau, O., Bonnet, D., Thome, M., and Tschopp, J. (2001) Carma1, a CARD-Containing Binding Partner of Bcl10, Induces Bcl10 Phosphorylation and NF-kappaB Activation. FEBS Lett. 496, 121-127.

  3. Egawa, T., Albrecht, B., Favier, B., Sunshine, M. J., Mirchandani, K., O'Brien, W., Thome, M., and Littman, D. R. (2003) Requirement for CARMA1 in Antigen Receptor-Induced NF-Kappa B Activation and Lymphocyte Proliferation. Curr Biol. 13, 1252-1258.

  4. Hara, H., Wada, T., Bakal, C., Kozieradzki, I., Suzuki, S., Suzuki, N., Nghiem, M., Griffiths, E. K., Krawczyk, C., Bauer, B., D'Acquisto, F., Ghosh, S., Yeh, W. C., Baier, G., Rottapel, R., and Penninger, J. M. (2003) The MAGUK Family Protein CARD11 is Essential for Lymphocyte Activation. Immunity. 18, 763-775.

  5. Barnes, M. J., Krebs, P., Harris, N., Eidenschenk, C., Gonzalez-Quintial, R., Arnold, C. N., Crozat, K., Sovath, S., Moresco, E. M., Theofilopoulos, A. N., Beutler, B., and Hoebe, K. (2009) Commitment to the Regulatory T Cell Lineage Requires CARMA1 in the Thymus but Not in the Periphery. PLoS Biol. 7, e51.

  6. Newton, K., and Dixit, V. M. (2003) Mice Lacking the CARD of CARMA1 Exhibit Defective B Lymphocyte Development and Impaired Proliferation of their B and T Lymphocytes. Curr Biol. 13, 1247-1251.

  7. Jun, J. E., Wilson, L. E., Vinuesa, C. G., Lesage, S., Blery, M., Miosge, L. A., Cook, M. C., Kucharska, E. M., Hara, H., Penninger, J. M., Domashenz, H., Hong, N. A., Glynne, R. J., Nelms, K. A., and Goodnow, C. C. (2003) Identifying the MAGUK Protein Carma-1 as a Central Regulator of Humoral Immune Responses and Atopy by Genome-Wide Mouse Mutagenesis. Immunity. 18, 751-762.

  8. Gaide, O., Favier, B., Legler, D. F., Bonnet, D., Brissoni, B., Valitutti, S., Bron, C., Tschopp, J., and Thome, M. (2002) CARMA1 is a Critical Lipid Raft-Associated Regulator of TCR-Induced NF-Kappa B Activation. Nat Immunol. 3, 836-843.

  9. Che, T., You, Y., Wang, D., Tanner, M. J., Dixit, V. M., and Lin, X. (2004) MALT1/paracaspase is a Signaling Component Downstream of CARMA1 and Mediates T Cell Receptor-Induced NF-kappaB Activation. J Biol Chem. 279, 15870-15876.

  10. Wang, D., You, Y., Case, S. M., McAllister-Lucas, L. M., Wang, L., DiStefano, P. S., Nunez, G., Bertin, J., and Lin, X. (2002) A Requirement for CARMA1 in TCR-Induced NF-Kappa B Activation. Nat Immunol. 3, 830-835.

  11. Pomerantz, J. L., Denny, E. M., and Baltimore, D. (2002) CARD11 Mediates Factor-Specific Activation of NF-kappaB by the T Cell Receptor Complex. EMBO J. 21, 5184-5194.

  12. Sommer, K., Guo, B., Pomerantz, J. L., Bandaranayake, A. D., Moreno-Garcia, M. E., Ovechkina, Y. L., and Rawlings, D. J. (2005) Phosphorylation of the CARMA1 Linker Controls NF-kappaB Activation. Immunity. 23, 561-574.