Phenotypic Mutation 'clover' (pdf version)
List |< first << previous [record 73 of 511] next >> last >|
Alleleclover
Mutation Type critical splice donor site (2 bp from exon)
Chromosome16
Coordinate15,702,157 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Prkdc
Gene Name protein kinase, DNA activated, catalytic polypeptide
Synonym(s) slip, DOXNPH, DNA-PKcs, XRCC7, dxnph, DNA-PK, DNAPDcs
Chromosomal Location 15,637,866-15,842,235 bp (+)
MGI Phenotype Mutations at this locus effect genome stability, radiation sensitivity and DNA repair. Nonsense (scid) and null homozygotes have severe combined immunodeficiency. A BALB/c variant allele reduces enzyme activity and predisposes to breast cancer.
Accession Number

Ncbi Refseq: NM_011159.2 ; P97313 ; ENSMUST00000023352; MGI:104779

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
UniProt: P97313 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 125 138 N/A INTRINSIC
low complexity region 1253 1263 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:NUC194 1810 2206 N/A PFAM
SCOP:d1gw5a_ 2210 2493 3e-3 SMART
low complexity region 2669 2681 N/A INTRINSIC
low complexity region 2841 2855 N/A INTRINSIC
Pfam:FAT 3024 3470 N/A PFAM
PI3Kc 3749 4068 N/A SMART
Pfam:FATC 4096 4128 1.4e-6 PFAM
Phenotypic Category T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All alleles(26) : Targeted(4) Gene trapped(16) Transgenic(1) Spontaneous(2) Chemically induced(2) QTL(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Prkdc APN 16 15697226 missense possibly damaging 0.94
IGL00225:Prkdc APN 16 15809644 missense probably benign 0.35
IGL00481:Prkdc APN 16 15790466 missense probably benign 0.10
IGL00488:Prkdc APN 16 15775847 splice acceptor site probably null 0.00
IGL00489:Prkdc APN 16 15799926 missense probably benign 0.06
IGL00579:Prkdc APN 16 15664239 missense probably damaging 1.00
IGL00587:Prkdc APN 16 15652358 splice donor site probably benign 0.00
IGL00666:Prkdc APN 16 15736835 missense probably damaging 1.00
IGL00675:Prkdc APN 16 15787158 missense probably benign 0.09
IGL00708:Prkdc APN 16 15779426 missense probably benign 0.06
IGL00725:Prkdc APN 16 15816639 missense probably benign 0.04
IGL00818:Prkdc APN 16 15759754 missense probably benign 0.36
IGL00917:Prkdc APN 16 15739564 missense possibly damaging 0.90
IGL00990:Prkdc APN 16 15702115 missense probably benign 0.00
IGL01126:Prkdc APN 16 15669321 missense probably benign 0.00
IGL01141:Prkdc APN 16 15726704 missense probably benign 0.27
IGL01306:Prkdc APN 16 15667731 missense possibly damaging 0.67
IGL01326:Prkdc APN 16 15829692 missense probably benign 0.00
IGL01335:Prkdc APN 16 15816896 critical splice donor site probably null 0.00
IGL01419:Prkdc APN 16 15835166 missense possibly damaging 0.94
IGL01434:Prkdc APN 16 15713587 missense probably benign 0.04
IGL01554:Prkdc APN 16 15652302 missense probably benign 0.00
IGL01671:Prkdc APN 16 15667745 missense possibly damaging 0.51
IGL01871:Prkdc APN 16 15783087 missense probably benign 0.00
IGL01874:Prkdc APN 16 15734994 missense probably benign 0.09
IGL01930:Prkdc APN 16 15698887 missense probably damaging 0.99
IGL01984:Prkdc APN 16 15708779 missense probably benign 0.00
IGL02121:Prkdc APN 16 15717184 missense probably benign 0.02
IGL02152:Prkdc APN 16 15669285 missense probably damaging 0.97
IGL02172:Prkdc APN 16 15809759 missense probably benign 0.00
IGL02336:Prkdc APN 16 15785978 missense probably benign 0.00
IGL02336:Prkdc APN 16 15785979 missense probably benign 0.00
IGL02393:Prkdc APN 16 15816758 missense probably benign 0.22
IGL02406:Prkdc APN 16 15670535 missense probably benign 0.02
IGL02500:Prkdc APN 16 15714282 splice site 0.00
IGL02568:Prkdc APN 16 15726542 missense probably damaging 0.98
IGL02579:Prkdc APN 16 15670601 missense probably benign 0.42
IGL02652:Prkdc APN 16 15783087 missense probably benign 0.00
IGL02661:Prkdc APN 16 15769825 missense probably benign 0.04
IGL02685:Prkdc APN 16 15836043 missense probably benign 0.09
IGL02741:Prkdc APN 16 15752726 splice site 0.00
IGL02803:Prkdc APN 16 15833666 splice site 0.00
IGL02866:Prkdc APN 16 15831327 missense probably damaging 1.00
IGL02882:Prkdc APN 16 15651519 nonsense probably null 0.00
IGL02989:Prkdc APN 16 15800016 missense probably benign 0.17
IGL03053:Prkdc APN 16 15834166 missense probably benign 0.00
IGL03071:Prkdc APN 16 15799984 missense probably benign 0.00
IGL03091:Prkdc APN 16 15705310 splice site 0.00
IGL03100:Prkdc APN 16 15713635 missense probably benign 0.00
IGL03128:Prkdc APN 16 15700744 splice site 0.00
IGL03168:Prkdc APN 16 15834166 missense probably benign 0.00
IGL03204:Prkdc APN 16 15769801 missense probably benign 0.00
IGL03390:Prkdc APN 16 15670626 nonsense probably null 0.00
screamer UTSW 16 15831282 nonsense probably null
Screamer10 UTSW 16 15768025 missense probably damaging 0.98
screamer2 UTSW 16 15652552 critical splice donor site probably null
screamer3 UTSW 16 15740332 critical splice donor site probably null
screamer4 UTSW 16 15783079 missense probably benign 0.00
screamer5 UTSW 16 15687404 missense probably benign 0.00
screamer6 UTSW 16 15759605 missense probably damaging 1.00
Screamer7 UTSW 16 15654817 splice acceptor site probably null
Screamer8 UTSW 16 15719433 missense probably benign 0.00
Screamer9 UTSW 16 15734922 missense probably benign 0.01
ANU23:Prkdc UTSW 16 15667731 missense possibly damaging 0.67
R0008:Prkdc UTSW 16 15708701 splice acceptor site probably benign
R0018:Prkdc UTSW 16 15726542 missense probably benign 0.03
R0018:Prkdc UTSW 16 15726542 missense probably benign 0.03
R0069:Prkdc UTSW 16 15726504 missense probably benign 0.03
R0125:Prkdc UTSW 16 15699007 missense probably damaging 0.98
R0131:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0132:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0137:Prkdc UTSW 16 15740332 critical splice donor site probably null
R0325:Prkdc UTSW 16 15810702 splice acceptor site probably benign
R0334:Prkdc UTSW 16 15736799 missense probably benign 0.00
R0373:Prkdc UTSW 16 15791927 missense probably damaging 1.00
R0383:Prkdc UTSW 16 15795146 splice donor site probably benign
R0408:Prkdc UTSW 16 15684255 splice donor site probably benign
R0485:Prkdc UTSW 16 15833740 missense probably damaging 0.97
R0511:Prkdc UTSW 16 15831282 nonsense probably null
R0538:Prkdc UTSW 16 15833788 missense probably damaging 1.00
R0595:Prkdc UTSW 16 15808088 missense probably damaging 1.00
R0607:Prkdc UTSW 16 15772057 missense probably damaging 0.98
R0616:Prkdc UTSW 16 15690407 missense probably damaging 1.00
R0630:Prkdc UTSW 16 15810801 missense probably damaging 1.00
R0694:Prkdc UTSW 16 15768637 missense probably damaging 1.00
R0702:Prkdc UTSW 16 15785971 missense possibly damaging 0.95
R0919:Prkdc UTSW 16 15667575 splice acceptor site probably benign
R0965:Prkdc UTSW 16 15829716 missense probably benign 0.00
R1027:Prkdc UTSW 16 15650712 missense possibly damaging 0.80
R1029:Prkdc UTSW 16 15654749 splice donor site probably benign
R1033:Prkdc UTSW 16 15767951 missense probably damaging 1.00
R1067:Prkdc UTSW 16 15752782 missense probably damaging 0.99
R1116:Prkdc UTSW 16 15783079 missense probably benign 0.00
R1187:Prkdc UTSW 16 15759746 missense probably damaging 0.98
R1226:Prkdc UTSW 16 15673997 missense possibly damaging 0.80
R1279:Prkdc UTSW 16 15690282 missense probably damaging 1.00
R1304:Prkdc UTSW 16 15759723 missense probably damaging 0.99
R1314:Prkdc UTSW 16 15664227 missense possibly damaging 0.68
R1351:Prkdc UTSW 16 15667700 missense possibly damaging 0.62
R1449:Prkdc UTSW 16 15648877 splice acceptor site probably benign
R1509:Prkdc UTSW 16 15731566 missense probably damaging 1.00
R1512:Prkdc UTSW 16 15687404 missense probably benign 0.00
R1531:Prkdc UTSW 16 15772106 missense probably benign 0.01
R1579:Prkdc UTSW 16 15675328 missense probably benign 0.00
R1616:Prkdc UTSW 16 15808028 splice acceptor site probably benign
R1669:Prkdc UTSW 16 15734058 missense probably damaging 1.00
R1682:Prkdc UTSW 16 15676989 missense probably benign 0.19
R1713:Prkdc UTSW 16 15795094 missense probably benign 0.00
R1747:Prkdc UTSW 16 15785901 splice acceptor site probably benign
R1762:Prkdc UTSW 16 15637961 missense probably benign 0.00
R1789:Prkdc UTSW 16 15739524 missense probably damaging 1.00
R1822:Prkdc UTSW 16 15759605 missense probably damaging 1.00
R1848:Prkdc UTSW 16 15808058 missense probably benign 0.01
R1887:Prkdc UTSW 16 15829635 missense probably benign 0.00
R1891:Prkdc UTSW 16 15725436 missense probably benign 0.02
R1921:Prkdc UTSW 16 15714215 missense possibly damaging 0.80
R1922:Prkdc UTSW 16 15714266 missense probably benign 0.00
R1929:Prkdc UTSW 16 15654817 splice acceptor site probably null
R1939:Prkdc UTSW 16 15835913 missense possibly damaging 0.95
R2021:Prkdc UTSW 16 15677009 missense probably benign 0.00
R2033:Prkdc UTSW 16 15687352 splice acceptor site probably benign
R2056:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2057:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2058:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2082:Prkdc UTSW 16 15715963 missense probably damaging 1.00
R2109:Prkdc UTSW 16 15687390 missense probably benign 0.01
R2124:Prkdc UTSW 16 15719433 missense probably benign 0.00
R2164:Prkdc UTSW 16 15705207 missense probably damaging 1.00
R2165:Prkdc UTSW 16 15687348 splice acceptor site probably benign
R2174:Prkdc UTSW 16 15734922 missense probably benign 0.01
R2191:Prkdc UTSW 16 15698824 missense probably damaging 1.00
R2270:Prkdc UTSW 16 15654817 splice acceptor site probably null
R2271:Prkdc UTSW 16 15654817 splice acceptor site probably null
R2272:Prkdc UTSW 16 15654817 splice acceptor site probably null
R2280:Prkdc UTSW 16 15725471 splice donor site probably benign
R2356:Prkdc UTSW 16 15684204 missense probably benign 0.00
R2852:Prkdc UTSW 16 15652552 critical splice donor site probably null
R3115:Prkdc UTSW 16 15664358 missense probably benign 0.01
R3116:Prkdc UTSW 16 15664358 missense probably benign 0.01
R3499:Prkdc UTSW 16 15768025 missense probably damaging 0.98
R3687:Prkdc UTSW 16 15799967 missense probably benign
R3834:Prkdc UTSW 16 15791946 missense probably damaging 1.00
R3835:Prkdc UTSW 16 15791946 missense probably damaging 1.00
R3961:Prkdc UTSW 16 15829611 splice site probably null
R4151:Prkdc UTSW 16 15816773 missense probably benign
R4233:Prkdc UTSW 16 15835919 missense probably benign 0.11
R4281:Prkdc UTSW 16 15806099 unclassified probably null
R4296:Prkdc UTSW 16 15737905 missense probably damaging 0.99
R4344:Prkdc UTSW 16 15768022 missense probably damaging 0.98
R4415:Prkdc UTSW 16 15648757 missense noncoding transcript
R4416:Prkdc UTSW 16 15648757 missense noncoding transcript
R4424:Prkdc UTSW 16 15773739 missense probably damaging 0.98
R4424:Prkdc UTSW 16 15836082 missense probably damaging 1.00
R4497:Prkdc UTSW 16 15700653 missense probably benign 0.43
R4594:Prkdc UTSW 16 15767966 missense possibly damaging 0.64
R4603:Prkdc UTSW 16 15810824 missense probably damaging 0.98
R4615:Prkdc UTSW 16 15663074 missense probably damaging 0.99
R4648:Prkdc UTSW 16 15816774 missense probably benign 0.05
R4662:Prkdc UTSW 16 15734052 missense probably damaging 1.00
R4680:Prkdc UTSW 16 15772030 missense probably benign 0.00
R4700:Prkdc UTSW 16 15702112 missense probably damaging 1.00
R4716:Prkdc UTSW 16 15810837 missense probably benign 0.32
R4720:Prkdc UTSW 16 15667715 nonsense probably null
R4785:Prkdc UTSW 16 15648976 missense probably benign 0.21
R4822:Prkdc UTSW 16 15650712 missense possibly damaging 0.80
R4829:Prkdc UTSW 16 15702075 missense possibly damaging 0.80
R4981:Prkdc UTSW 16 15678309 missense probably damaging 1.00
R4989:Prkdc UTSW 16 15673997 missense possibly damaging 0.80
R5012:Prkdc UTSW 16 15654731 missense noncoding transcript
R5059:Prkdc UTSW 16 15838018 missense probably damaging 1.00
R5074:Prkdc UTSW 16 15772048 missense probably damaging 1.00
R5115:Prkdc UTSW 16 15790580 missense probably benign
R5151:Prkdc UTSW 16 15716035 missense probably damaging 1.00
R5165:Prkdc UTSW 16 15678272 missense probably damaging 1.00
R5215:Prkdc UTSW 16 15772121 missense possibly damaging 0.64
R5270:Prkdc UTSW 16 15734955 missense probably damaging 1.00
R5278:Prkdc UTSW 16 15714974 missense probably damaging 1.00
R5351:Prkdc UTSW 16 15831312 missense probably benign 0.03
R5416:Prkdc UTSW 16 15805950 missense probably damaging 1.00
R5418:Prkdc UTSW 16 15795097 missense probably benign 0.20
R5437:Prkdc UTSW 16 15769875 missense possibly damaging 0.46
R5452:Prkdc UTSW 16 15768637 missense possibly damaging 0.96
R5518:Prkdc UTSW 16 15678308 missense probably damaging 1.00
R5538:Prkdc UTSW 16 15651469 missense probably damaging 1.00
R5589:Prkdc UTSW 16 15706791 missense probably benign 0.02
R5618:Prkdc UTSW 16 15809612 missense probably damaging 1.00
R5640:Prkdc UTSW 16 15829769 missense possibly damaging 0.86
R5661:Prkdc UTSW 16 15810770 missense possibly damaging 0.81
R5771:Prkdc UTSW 16 15664233 missense probably damaging 1.00
R5772:Prkdc UTSW 16 15779388 missense possibly damaging 0.49
R5783:Prkdc UTSW 16 15717801 missense probably damaging 1.00
R5797:Prkdc UTSW 16 15737834 nonsense probably null
R5826:Prkdc UTSW 16 15734098 missense probably benign
R5883:Prkdc UTSW 16 15715914 missense probably benign
R5895:Prkdc UTSW 16 15752829 nonsense probably null
R5998:Prkdc UTSW 16 15783157 missense probably damaging 1.00
R6000:Prkdc UTSW 16 15829697 missense possibly damaging 0.86
X0023:Prkdc UTSW 16 15740278 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm
MMRRC Submission 036486-MU
Last Updated 01/05/2017 2:57 PM by Katherine Timer
Record Created 02/08/2011 5:40 PM by Carrie N. Arnold
Record Posted 06/25/2012
Phenotypic Description

The clover mice exhibited a reduced T-independent IgM response to NP-Ficoll, and a null T-dependent IgG response to a vector based on Semliki Forest Virus encoding β-galactosidase (Figure 1). Peripheral lymphocyte frequencies have not been assessed.

Figure 1. T-independent IgM (left) and T-dependent IgG (right) responses in clover.

 

Nature of Mutation

The clover mutation was mapped using bulk segregation analysis (BSA) of F2 backcross offspring using C57BL/10J as the mapping strain. The mutation showed strongest linkage with marker B10SNPS0225 at position 29856457 bp on Chromosome 16 (synthetic LOD = 3.6). Whole genome SOLiD sequencing of a homozygous clover mouse and validation by capillary sequencing identified a T to C transition at bp 15702250, 14.2 Mb from the marker of peak linkage, on chromosome 16 in the Genbank genomic region NC_000082. The effect of the mutation at the cDNA and protein level has not been tested.

 

      <--exon 28 <--exon 29 intron 29-->   exon 30-->

62863  AAATCCTTAG……TTGCCACA  gtaggtgata…………GGGATTTCCACCTTTGA       

1116   -K--S--L--……-L--P--Q                G--D--F--H--L--*   1124

        correct     deleted                    aberrant

 

The mutation is in intron 29, within the donor splice site, 2 nucleotides after exon 29. The mutated nucleotide is indicated in red; the splice donor sequence is shown in blue.

Protein Prediction

 

Figure 2. Domain structure of DNA-PKCS.  The DNA-PKCS protein has three tetratricopeptide repeats (TPR) that are involved in protein-protein interactions such as with the Ku70/Ku80 heterodimer to form the DNA-PK complex.  The catalytic site is within the PIKK domain at the C-terminus.  FAT domains flank the PI3K/PI4K (PIKK) domain.  The N-terminus has three HEAT repeats.  See the text for more details. The location of the clover mutation is indicated. This image is interactive; click to view other mutations in Prkdc.

Figure 3. Schematic 3D diagram of theoretical chain topology of DNA-PKcs. The 3D model was created based on crystallographic data from PDB: 3KGV, cryo-electron microscopy (Rivera-Calzada, JP, Structure,13, 2005), and UniProtKB-P78527.  The color key corresponds with the domain diagram in Figure 2. Domain residues were mapped onto the 3D model using the same scale as in Figure 2, however, correspondences of domain folds with locations of residues is only hypothetical. PDB ID: 3KGV is resolved to a 6.6 Å resolution; exact order of residues could not be determined.

Figure 4. Crystal structure of the DNA-PKcs asymmetric dimer. The molecules are represented in spherical rendering, based on PDB ID: 3KGV  (14). The probable location of the N-terminus is shown. The C-terminus is proposed to lie in the region of the head/crown. The polypeptide folds back upon itself forming an open ring. This view demonstrates the protein looking toward the open center of each ring. Please see Figure 3 for schematic diagram of protein folding. Model generated with the PyMOL Molecular Graphics System, Schrodinger, LLC.

Figure 5. Crystal structure of DNA-PKcs (14). In this view of PDB ID: 3KGV the DNA-PKcs molecules are shown from the side, demonstrating the cradle-like form of the kinase. The DNA-binding area is shown in violet. Model generated with the PyMOL Molecular Graphics System, Schrodinger, LLC.

The 12,674 base pair Prkdc transcript encodes the 4,128 amino acid, 471 kDa catalytic subunit of the DNA-PK complex, DNA-PKCS (Figure 2 & 3). DNA-PKCS is a serine/threonine kinase and member of the phosphatidylinositol 3-kinase-like kinases (PIKK) family (see worker) [reviewed in (1)]. The PIKK family is similar to the PI3K family, with the exception that PIKK family members do not phosphorylate lipids [reviewed in (2)], but rather hundreds of proteins involved in the regulation of cell cycle progression, DNA repair, apoptosis, and cellular senescence (3). The PIKK family members ATM (ataxia telangiectasia mutated) and ATR (ATM and Rad3-related), along with DNA-PKCS, are involved in DNA repair [(4); reviewed in (5)]. In particular, DNA-PKCS is required for repair of DNA double strand breaks (DSB) during the process of nonhomologous end joining (NHEJ), and during the assembly of immune receptor genes in developing lymphocytes [V(D)J recombination]. Additional members of the PIKK family are SMG1 homolog (SMG1), mammalian target of rapamycin (mTOR), and transformation/transcription domain-associated protein (TRRAP), which are involved in nonsense-mediated decay of mRNA, regulation of nutrient-dependent signaling, and regulation of chromatin during transcription, respectively (3).

 

DNA-PKCS has several domains that are essential for its function (Figure 2 & 3). A leucine rich region (LRR, aa 1501-1536) mediates the association of DNA-PKCS with C1D, a DNA-binding nuclear matrix-associated factor that may be involved in gene regulation (1;6), and which is involved in NHEJ and homologous recombination in yeast (7). The LRR facilitates the intrinsic binding of DNA-PKCS to DNA (6), which occurs at low (nonphysiologic) salt concentrations and activates kinase activity (8); point mutations in the LRR reduce the ability of DNA-PKCS to rescue defective V(D)J recombination and radiosensitivity in DNA-PKCS-deficient cells (6). Association with C1D may contribute to the weak intrinsic DNA binding activity of DNA-PKCS. The DNA-PKCS protein also contains three tetratricopeptide repeats (TPR) (aa 1720-1753, 2921-2954, 2956-2983) that are proposed to assist in protein-protein interactions.  TPR2 and TPR3 exist within a larger region that mediates binding of DNA-PKCS to the Ku heterodimer (Ku70 and Ku80), which is required to target DNA-PKCS to broken DNA ends in vivo. TPR1 forms part of a region shown to interact with Lyn tyrosine kinase (9).

 

A 380 amino acid region at the C terminus constitutes the catalytic domain, designated the PIKK domain, of DNA-PKCS (aa 3747-4015) (1;10). The PIKK domain is flanked by the FAT domain (named for its homology to FRAP, ATM and TRRAP, aa 2884-3539) and a FATC domain (FAT at the extreme C-terminus, aa 4096-4128) (10). The FAT and FATC domains occur in combination in all PIKK family members, suggesting a possible role in maintaining a structural conformation essential for the activation of the catalytic site (1;2). It has been shown the C-terminal region containing the FATC domain is essential for the kinase activity of DNA-PKCS (11-13). The N-terminal portion of the protein up to the FAT domain consists of HEAT (Huntingtin, Elongation factor 3, A subunit of protein phosphatase 2A and TOR1) repeats (14). HEAT repeats are helical structural repeats that mediate protein-protein interactions (15). In DNA-PKCS they are believed to contain recruitment sites for DNA repair proteins (16), and to hold the DNA in place while it is being repaired.

 

Autophosphorylation occurs on multiple sites across the length of DNA-PKCS and is essential for its function (16-19). Two major clusters of serine/threonine autophosphorylation sites near the center of the protein reciprocally regulate the activity of DNA-PKCS  [(20-22); reviewed in (2;23)]. The ABCDE cluster contains six sites spanning resides 2609-2647 and their autophosphorylation is thought to induce a structural change in the protein that facilitates its release from the Ku dimer and the DNA as well as the inactivation of DNA-PKCS kinase activity (1;2;14;23). The result is DNA end processing by repair proteins that are presumably granted access to the broken DNA ends (20;21). The PQR cluster contains five sites spanning residues 2023-2056; phosphorylation of these sites inhibits DNA end processing (24). Site-directed mutational analysis demonstrated that phosphorylation of one or two sites within each cluster is functionally sufficient; only when all five or six sites were mutated was NHEJ impaired. Whether autophosphorylation of DNA-PKCS occurs in cis or in trans remains unknown (25;26); however, the interaction of two DNA-PKCS molecules on adjacent sides of a DSB to form a ‘synaptic complex’ is believed necessary prior to DNA end processing. DNA-PKCS also undergoes autophosphorylation within the kinase activation loop (22). Autophosphorylation of additional sites outside of the activation loop and ABCDE and PQR clusters may also be necessary for dissociation of DNA-PKCS from Ku and DNA ends (26).

 

DNA-PKCS has two caspase cleavage sites (Asp2712-Asn2713 and Asp2982-Gly2983) (27;28). Cleavage of the protein, which separates the FAT/PIKK/FATC module from the DNA-binding HEAT repeats and results in loss of DNA-PK activity, was observed following treatment of cultured cells with apoptotic agents. This mechanism may favor DNA fragmentation and nuclear disassembly necessary for apoptosis, and confine DNA-PK activity to viable cells.

 

Several cryo-electron microscopy studies (10;29-33), and recent solution and crystal structures obtained by X-ray scattering (34) and X-ray crystallography (PDB: 3KGV) [Figure 4 & 5(14)] identified three major structural domains in DNA-PKcs termed the head, arms, and palm [reviewed in (35)] (Figure 3). The head structure, comprised of the PIKK domain and the FAT and FATC domains, resides on top of the ring-shaped palm region, which is composed of two arms that form a circular structure around a central opening that presumably holds the double stranded DNA. The arms consist of the N-terminal two-thirds of the protein and contain ~66 helices arranged as HEAT repeats in a ring structure; when viewed from the side this structure forms a concave shape. The N terminus of the protein lies in the right arm, while the LRR is in the left arm as shown in Figure 3. A gap at the bottom of the ring is predicted to widen upon autophosphorylation of either the ABCDE or PQR clusters, releasing the DNA after ligation. The cryo-EM studies also indicated the existence of additional openings not observed in the crystal structure, possibly between the head and palm regions, which were postulated to bind single stranded DNA.

 

The clover mutation affects the splice donor site within intron 29, and is predicted to cause skipping of exon 29.  A transcript lacking exon 29 would encode the wild type sequence up to amino acid 1119, followed by four aberrant amino acids and a premature stop.  This transcript would likely be subject to nonsense-mediated decay.

Expression/Localization

DNA-PKCS has been detected at mammalian telomeres in all cells (1;36). DNA-PK kinase activity appears to be cell cycle- and phosphorylation-dependent (e.g. it is reduced in S phase (compared to G1)) (37). DNA-PKCS has only been detected in higher eukaryotes (38). Interestingly, primate cells express 50 times more DNA-PK activity than rodent cells (23;39). Based on the interaction of DNA-PKCS with C1D, it has been suggested that DNA-PKCS may be sequestered in particular nuclear compartments (16).

Background

DNA DSBs can occur as a result of exposure to external factors including ionizing radiation (IR) (e.g. medical x-rays and radon gas decay in the soil) (40), radiomimetic drugs (e.g. the antibiotic, bleomycin) (41), toxins (e.g. asbestos, silica, and titanium dioxide) (42), and topoisomerase inhibitors (e.g. camptothecin, which traps enzyme-DNA intermediates and inhibits the re-ligation of DNA) (43).  Cellular processes such as the generation of reactive oxygen species as a byproduct of oxidative metabolism, the collapse of DNA replication forks (upon recognition of single-stranded breaks by the replication machinery) (44), and, in the case of B and T lymphocytes, immune receptor gene arrangement, also cause DSBs (16;38;45;46). Repair of DSBs is required to prevent chromosomal abnormalities and chromosome loss, and thereby maintain genomic stability. If left unrepaired, cell cycle arrest typically occurs, leading to cell death (45;47;48). In addition, instances of cancer can occur after a tumor suppressor gene is inactivated or deleted by a DSB, or when an oncogene is activated or translocated (49;50)

 

Figure 6. Schematic overview of HR and NHEJ DNA DSB repair.    Column A shows key steps in HR of DSBs: (1) PARP senses DSBs, competes with Ku binding to DNA to promote HR, and mediates the recruitment of the MRE11-RAD50-NBS1 (MRN) complex.  MRN-dependent activation of protein kinases results in the recruitment of processing factors that generate 3’ ssDNA overhangs (not shown). (2) The formation of 3’-ssDNA ends leads to the accumulation of the RPA complex, which stabilizes the ssDNA regions, protects the DNA against degradation, and prevents the formation of secondary structures.   (3) The RPA is displaced from the 3’-ssDNA ends; BRCA2-mediated assembly of RAD51 filaments leads to strand invasion into the homologous DNA sequence. (4) Mediators such as RAD51C and XRCC3 allow for the formation of RAD51 filaments, while strand invasion is stabilized by RAD54.  RAD51 and RAD54 catalyze the formation of a displacement loop (D-loop), in which the invading strand primes DNA synthesis. D-loop formation is a branch point to different HR subpathways including break-induced replication (not shown), double Holliday junction formation (not shown), and synthesis-dependent strand annealing (SDSA); all of the subpathways result in the repair of DSB breaks. (5) Fill-in synthesis at the site of the DSB. (6) The results of SDSA is shown. Column B demonstrates selected steps in nonhomologous end joining (NEHJ) repair (see the text for details): (1) Ku associates to DSBs to promote NHEJ and (2) the recruitment of DNA-PKcs to (3) form the catalytically active DNA-PK complex that protects the DNA ends needed for ligation. (4) Autophosphorylation of DNA-PKcs allows for ARTEMIS and DNA pol x family members to access the DNA termini.  ARTEMIS and DNA-PKcs form a complex that cleaves 5’ and 3’ overhangs during NHEJ. DNA pol x family members fill in the gaps with several nucleotides, if necessary, prior to relegation. Nucleases can remove base nucleotides, if necessary (not shown). (5) XRCC4/LIG4 is recruited to the site and the broken ends are religated with the help of XLF.  (6) Repair resolution of the DSB following NHEJ.  Abbreviations: HR, homologous recombination; NHEJ, nonhomologous end joining; DSB, double strand break; PARP; poly(ADP)ribose polymerase; MRN, MRE11-RAD50-NBS1; MRE11, meiotic recombination 11, NBS1, Nibrin or Nijmega breakage syndrome protein 1; ssDNA, single-stranded DNA; BRCA1, breast cancer 1, early onset; RPA, replication protein A; XRCC3, X-ray repair complementing defective repair in Chinese hamster cells 3; SDSA, synthesis-dependent strand annealing; XRCC4, X-ray repair cross-complementing 4; LIG4, DNA ligase IV; XLF, XRCC4-like factor. Figure modified from images found in Ciccia and Elledge. Mol Cell. (2010) 40:179-204, Heyer et al. Annu. Rev. Genet. (2010) 44:113-139, and Neal and Meek. Mutat. Res. (2011) 711:73-86

DSB repair pathways

There are three DNA DSB repair pathways: single-strand annealing (SSA), homologous recombination (HR), and nonhomologous end-joining (NHEJ) (51). In SSA, which requires homologous sequences to flank the break site, the nonhomologous DNA ends are removed, leaving overhangs that are aligned and annealed (45). After annealing, DNA synthesis and ligation occur. SSA results in deletion of the region between homologous sequences. In contrast, HR is a relatively error-free mechanism for DSB repair that relies on the homologous region on the sister chromatid as a template for DNA synthesis (Figure 6A(1;16). HR is limited to replicating cells (including early embryonic developmental stages) and can be observed only after DNA replication in the S and G2 phases (52. Finally, NHEJ is a rapid repair mechanism that simply ligates broken DNA ends after minimal or no processing (Figure 6B). NHEJ occurs in all phases of the cell cycle and is thought to be the primary DNA repair pathway in mammalian cells (53;54). NHEJ is prone to generating mutations at the point of ligation, and may result in inversions or translocations if the joined strands were not originally contiguous.

 

Nonhomologous end-joining (NHEJ)

Seven factors are necessary for NHEJ: Ku70, Ku80, DNA-PKCS, XRCC4 (X-ray repair cross-complementing 4), DNA ligase IV, Artemis, and XLF (XRCC4-like factor; also known as Cernunnos) (1;16;55). During a DSB repair, the break is recognized by the Ku heterodimer composed of Ku70 and Ku80, which encircles the DNA and cups the DNA termini into an accessible binding pocket (56). The Ku dimer can recognize blunt ends, hairpin ends, and 5’ or 3’ overhangs; two in vitro studies using purified oligonucleotides containing hairpin ends found that the Ku heterodimer (and DNA-PKCS) can bind hairpin ends but the kinase could not be activated (48;57). The Ku heterodimer recruits and activates DNA-PKCS, forming the Ku/DNA-PKCS complex known as DNA-PK. The Ku/DNA-PKCS interaction not only assists in localizing the complex to the DNA ends, it also protects DNA ends from nuclease digestion prior to re-ligation (45;58). Following recruitment of DNA-PKCS to the Ku-DNA complex, Ku translocates inward ~10 bp from the DNA ends, allowing DNA-PKCS to bind to the DNA termini (38). Two adjacent DNA-PKCS molecules interact across the DSB, holding the DNA ends in close proximity within a synaptic complex. Crystallographic studies have shown that the synaptic complex in NHEJ consists of two DNA ends, two Ku heterodimers, and two DNA-PKCS proteins (33;58). The formation of a synaptic complex is essential for the activation of DNA-PKCS (58).

 

Nucleases (e.g. 5’: FEN1, EXO1, and Sep1 (59-61); 3’: MRE11 (62)) and polymerases (e.g. polβ, polε, and polδ) are often required to remove several nucleotides or to fill in gaps of several nucleotides, respectively, to facilitate the proper conformation for ligation (53). The colocalization of DNA polymerase X family members (e.g. terminal deoxynucleotidyl transferase (TdT), pol μ, pol λ, and polβ) with DNA-PKCS as well as the interactions of DNA pol X with both Ku and the DNA ligase IV-XRCC4 complex suggest that the DNA polymerase X family participates in the filling in of short gaps prior to re-ligation (1;23). To protect the DNA termini of a DSB from degradation or premature and incorrect ligation, DNA-PKCS is positioned as a “cap” on the DNA ends (18;63). Before re-ligation of the DNA ends and finalization of the DSB repair, the DNA-PKCS cap must be removed or altered. Autophosphorylation of DNA-PKCS results in release of the cap and accessibility of the termini to enzymes and ligases needed to complete the repair (e.g. Artemis, DNA polymerase X family members and the DNA ligase IV-XRCC4 dimer) (1;16;58). Artemis and DNA-PKCS form a complex with endonuclease activity that cleaves 5’ and 3’ overhangs during NHEJ, and opens hairpins generated by the RAG complex during V(D)J recombination [(64); reviewed in (16)]. In order to activate its nuclease activity, Artemis is phosphorylated by DNA-PKCS (65). The DNA ligase IV-XRCC4 dimer rejoins the DNA ends, with XRCC4 both interacting with and catalytically stimulating DNA ligase IV (16).  XLF functions to stimulate the ability of XRCC4-DNA ligase IV to ligate in the presence of Mg2+ (66)

 

In general, mutations in genes required for DNA damage repair can lead to radiosensitivity, immunodeficiency, cancer predisposition, and premature aging (38). More specifically, mutations in components of the DSB repair pathway cause a number of conditions including: LIG4 syndrome, radiosensitive severe combined immunodeficiency (RS-SCID), ataxia-telangiectasia (AT), AT-like disorder (ATLD), and Nijmegen breakage syndrome (NBS) (38). In LIG4 syndrome (OMIM #606593), there are developmental defects and growth retardation, immunodeficiency, and a predisposition to cancer due to mutations in Ligase IV (67-69). SCID (OMIM #602450) can be caused by a mutation in the gene encoding Artemis [DCLRE1C, (70)] as well as mutations in the genes encoding DNA-PKCS [PRKDC, (71)], and DNA ligase IV [LIG4, (72)]; mutations in recombination-activating gene 1 [RAG1] (Rag1, see maladaptive and huckle) and RAG2 lead to B cell-negative SCID (see OMIM #601457 for more details) (73). RS-SCID patients suffer from immunodeficiency and have a predisposition to cancer. In AT (OMIM #208900) and ATLD (OMIM #604391), patients have cerebellar ataxia and immunodeficiency as well as a predisposition to cancer due to mutations in the ATM and MRE11A genes, respectively (74;75). NBS (OMIM #251260) is due to a mutation in the gene encoding NBS1, another protein essential for DNA damage detection and response. NBS patients suffer from cancer predisposition as well as mental and growth retardation (76;77). Interestingly, cells deficient in DNA-PKCS or Artemis are sensitive to ionizing radiation, but do not have cellular growth defects (65).

 

DNA-PK

DNA-PKCS was initially identified in HeLa cell extracts as a kinase activated by double stranded DNA and was subsequently designated a member of the PIKK family (78;79). DNA-PKCS activity is regulated by several different factors (Table 1).

 

Table 1: Regulation of DNA-PK (adapted from (45))

Regulating protein

Function

Reference

C1D

Activates DNA-PK without the need for DNA termini; speculated to change chromatin structure to aid in DNA-PK localization to damage site

(80)

c-Abl

Phosphorylates DNA-PK which inhibits the interaction of DNA-PK with DNA in vitro

(81;82)

Caspase 3

Cleaves DNA-PKCS, resulting in inhibition of DNA-PKCS kinase activity during apoptosis

(27;28;83)

Chk1

Stimulates DNA-PK kinase activity towards p53; increases DNA-PK-dependent NHEJ in vitro

(84)

DNA-PKCS

Phosphorylates itself on multiple sites, which is necessary for NHEJ; autophosphorylation of the ABCDE cluster induces a conformational change that releases DNA-PKCS from the Ku-bound DNA and thereby decreases kinase activity

(16)

Heat shock transcription factor 1 (HSF1)

Stimulates DNA-PK kinase activity in vitro possibly by stabilizing DNA-PK/DNA interaction; may regulate DNA-PK after heat stress

(85-87)

High mobility group proteins 1 and 2 (HMG1 and 2)

Stimulate DNA-PK kinase activity in vitro possibly by promoting DNA-PK/DNA association

(88;89)

Ku70, Ku80

Stimulates DNA-PK activity; recruits DNA-PKCS to DNA

(90-92)

Ku80 auto-antigen-related protein (KARP-1)

Downregulates DNA-PK activity leading to IR sensitivity

(93)

Lyn tyrosine kinase

Binds to DNA-PKCS and prevents its association with Ku, resulting in inhibition of DNA-PKCS kinase activity

(9)

MDC1

Binds the DNA-PK complex; regulates DNA-PK autophosphorylation

(94)

Nuclear clusterin

Binds to Ku after IR-induced DNA damage and promotes cell cycle arrest and death

(95;96)

Poly (ADP-ribose) polymerase (PARP-1)

PARP-mediated ADP-ribosylation stimulates DNA-PK kinase activity

(97-99)

Protein kinase Cδ

Phosphorylates DNA-PKCS; inhibits DNA binding and DNA-PKCS-mediated phosphorylation of p53; may promote apoptosis

(100)

Protein phosphatase 1 and 2A

Dephosphorylates DNA-PKCS, reactivating the kinase activity of DNA-PK

(101)

Protein phosphatase 5

Dephosphorylates DNA-PKCS, regulating its sensitivity to radiation

(102)

XRCC4 and ligase IV

Promotes association of DNA-PKCS with Ku

(103)

 

In addition to its role in NHEJ (described above), DNA-PK functions in a variety of cellular processes that involve DNA regulation:

Figure 7.  Schematic overview of V(D)J Recombination.  The two DNA coding segments to be joined are shown as blue and red DNA strands.  (1) The RAG1/2 complex (see maladaptive and huckle) binds to a recombination signal sequence (RSS) that flanks each variable (V), diversity (D), and joining (J) encoding gene segment.  Binding of RAG1/2 and nicking of a single RSS as well as the formation of a paired complex (not shown). (2) The RAG1/2 introduce DNA DSB within the synaptic complex between the gene segments and the RSSs. (3) Cleavage by the RAG complex results in a hairpin-sealed coding end and a blunt signaling end.  (4a) Formation of the signal joint occurs after blunt end ligation of signal ends by the XRCC4-ligase IV (Lig IV) complex.  (4b-7b) Formation of the coding joint.  (4b) The NEHJ factors arrive at the hairpin and the hairpin structures on the coding ends are nicked by DNA-PKcs and Artemis.  (5b)  Addition of non-templated nucleotides by terminal deoxynucleotidyl transfers (TdT) occurs during coding end processing.  (6b) Joining of the coding end occurs upon ligation by the XRCC4-ligase IV (Lig IV) complex to (7b) form a coding joint.   Figure adapted from Schatz and Swanson. Annu. Rev. Genet. 2011. 45:167-202 and Schatz and Ji. Nat. Reviews Immunology. 2011. 11:251-263.

  

  1. Regulation of DSB repair pathway choice. Cells deficient in DNA-PKCS display elevated levels of HR likely due to a lack of NHEJ, supporting the idea that the NHEJ and HR pathways compete for substrates during DSB repair (104). However, chemical inhibition of DNA-PKCS resulted in inhibition of both NHEJ and HR (105).  It has been proposed that chemical inhibition of DNA-PKCS generates a mutant protein that is unable to dissociate from the DNA ends, blocking both NHEJ and HR repair factors from accessing the DNA ends [(105); reviewed in (46)].
  2. V(D)J recombination. During lymphoid cell development, the process of V(D)J recombination generates a variable region exon to which is subsequently joined a constant region gene, together encoding either an immunoglobulin or T cell receptor chain (Figure 7). In V(D)J recombination, a trans-esterification reaction mediated by RAG1/RAG2 produces an excised DNA fragment with blunt signal ends and two covalently closed hairpins at each end of the coding regions that must be joined (1;45). Artemis is essential to opening hairpins for V(D)J recombination following phosphorylation by DNA-PKCS.  To process the DNA ends and ligate coding regions, the cell uses the NHEJ pathway. In cells lacking DNA-PKCS, V(D)J recombination intermediates cannot be completely processed and ligated, leading to an accumulation of hairpin intermediates (106). This indicates that DNA-PKCS may be necessary for cleavage of hairpin intermediates as well as for the final end joining step (1).
  3. Telomere maintenance and elongation. Telomeres consist of short repetitive DNA sequences at the ends of eukaryotic chromosomes (107). They protect coding regions near chromosome ends from shortening during DNA replication and also distinguish chromosome ends from damaged DNA in the form of DSBs. The maintenance of functional telomeres is essential for genomic stability; telomere dysfunction can often lead to chromosomal rearrangements and cellular senescence (108;109).  DNA-PKCS , together with Ku70 and Ku80, acts as a telomere cap that protects and distinguishes telomeric DNA from broken DNA ends. DNA-PKCS is localized to the end of chromosomes (45) and knockout of DNA-PKCS, Ku70, or Ku80 results in end-to-end fusions of chromosomes and chromosomal instability (110;111).  These end-to-end fusions appear to result from the chromosome ends being recognized as DSB ends that need to be repaired (108), and not from loss of telomeric DNA. Mouse and human cells treated with a kinase inhibitor that is highly specific for DNA-PKCS  had a high frequency of telomeric fusion (109).   This study found that the kinase activity of DNA-PKCS is required to protect the ends of chromosomes and the processing of the leading-strand telomere after replication (109)
  4. Transcription control [reviewed in (2)]. In addition to the other roles of DNA-PKCS, it has also been implicated in transcription initiation.  The DNA-PK complex can control transcription by inhibiting RNA-polymerase I (RNA-Pol I) via phosphorylation (112).  DNA-PK also phosphorylates RNA-Pol II (90)In vitro, DNA-PKCS can phosphorylate several transcription factors (e.g. p53, Oct-1, c-Jun) (113).  DNA-PK-mediated phosphorylation of heterogeneous nuclear ribonucleoprotein U (hnRNP-U) stabilizes specific mRNAs, promoting gene expression (114). indicating that this protein has a role in controlling transcription.
  5. Regulation of p53-mediated apoptosis [reviewed in (2)]. DNA-PKCS phosphorylates p53 at serine 15 and 37 (115), and possibly serine 46 (116).  Cells that are DNA-PKCS defective are hypersensitive to p53-mediated apoptosis induced by IR (2;117;118). Under apoptotic conditions, p53 and DNA-PK form a protein complex (119) that may detect disruption of DNA replication (caused by nucleoside analog incorporation) and eventually signal for apoptosis (2).
Putative Mechanism

 

Figure 8.  Putative mechanism: the clover mutation leads to severe combined immune deficiency (SCID).  Note: DNA-PKcs-mediated V(D)J recombination occurs in the rearrangement of both B- and T-cell receptor genes during B and T cell development, respectively; only the function of DNA-PKcs in B cell development is shown.  DNA-PKcs-mediated V(D)J recombination occurs in the maturation of both B and T cells; only the function of DNA-PKcs in B cell receptor development is shown.  (top panel) Within the pro-B cells of the bone marrow, normal DNA-PKcs function allows for V(D)J recombination.  V(D)J recombination and BCR assembly allows for maturation of pro-B cells to pre-B cells (not shown), which will subsequently mature to the mature B cell stage (shown).  (bottom panel) SCID is a condition in which B and T cells are unable to undergo correct V(D)J recombination during maturation.  In the clover mouse, the loss of DNA-PKcs leads to an accumulation of coding segment hairpin intermediates after cleavage with RAG1/2 (see Figure 7). An inability to complete V(D)J rearrangement prevents the maturation of B (and T) cells and immunodeficiency.

There are several Prkdc-deficient model systems that have been characterized. For example, in DNA-PKCS-deficient cell lines, transfection of DNA-PKCS constructs with mutations within the kinase domain were unable to participate in NHEJ and V(D)J recombination (16). In addition, there are several animal models of SCID (e.g. mouse (120)Arabian horses (121), and Jack Russell terriers (122)) with mutations in Prkdc (123). Animals with SCID present with several features including: lymphopenia, hypogammaglobulinemia, premature aging (e.g. shortened telomeres), a large number of telomeric fusions, and impaired T and B cell-mediated functions (e.g. defective V(D)J recombination and reduced numbers of peripheral lymphocytes) (45;65;123). Mutations in Prkdc also lead to hypersensitivity to IR and radiomimetic chemicals (124). In horses with mutations in DNA-PKCS, decreased numbers of B and T lymphocytes were documented, although natural killer cell activity was normal (125). The decreased T and B cell functions were due to an inability of the lymphocytes to properly mature due to defective V(D)J recombination. In a spontaneous mouse model of SCID, a DNA-PKCS point mutation resulting in the loss of 83 C-terminal amino acids, a reduction in protein expression, and a block in lymphocyte development has been identified (126). Although a variety of mutations in Prkdc cause SCID in the aforementioned animal models, only one case of human SCID has been attributed to mutation of PRKDC (127). In that patient, two homozygous changes were verified: deletion of a glycine at 2113 and a missense mutation (L3062R) that was shown to be the disease-causing mutation . It was speculated that due to the differences in expression levels across species, a deficiency of DNA-PKCS in humans is incompatible with life (23).

The clover mutation causes a similar phenotype to other Prkdc mutations: decreased T and B cell function likely due to a disruption in V(D)J recombination (Figure 8).

Primers Primers cannot be located by automatic search.
Genotyping

Clover genotyping is performed by amplifying the region containing the mutation using PCR followed by sequencing of the amplified region to detect the nucleotide change.  The following primers were used for PCR amplification:

 

Primers for PCR amplification

Clover (F): 5'- TGAGGCTGTTGGTCATGGACTTTCTA -3'

Clover (R): 5'- TGTGACACTCAGTCCTTATACTGCAAAATT -3'

 

Primers for Sequencing

Clover_seq (F): 5'- CCAGCATGGTGGCTCTAAATC -3'

Clover_seq (R): 5'- CATCTTCAGCATTCATCAGATGGA -3'

 

PCR program

1) 94° C      2:00

2) 94° C      0:30

3) 57° C      0:30

4) 72° C      1:00

5) repeat steps (2-4) 29x

6) 72° C      7:00

7) 4° C        

 

The following sequence of 1698 nucleotides (from Genbank genomic region: NC_000082 of the linear genomic sequence of Prkdc) is amplified:

 

63301                                               tgaggctg ttggtcatgg    

63361 actttctatt tggatgtgat actccttttg ggtgtatgta tataatagat atgtgttgca    

63421 gtaggcaatt aacctacact caaatcgccc tgacgtggca atgagagttc cttgctaccc    

63481 acctcaatgt tctggattcc cgaatgaaag acacacacac agccctgtat ttaatatgcc    

63541 ttaatcagct caatggttgg gccactacca aacctccacg tggctaacac ctcccttctg    

63601 atactcctga attattactt actaaaatct atattccatc tttgttgccc tagacccagt    

63661 ggggtctctg gctcccgatt gctgtgcatt cttttctgca cctctcatat ctggacctta    

63721 ttgctttccc agcatggtgg ctctaaatca tgcttcctct cttggccccc ttgcccgtga    

63781 atcttcgagt tccacctttg tctccctgcc agccattggc cgccaacaac tttattgact    

63841 aatcagaacc aactgggggc aggaaccctc agcatctcac atatggattc tagaggaatt    

63901 ttgggaaccc agttaacatc atacaagcat tagaccaaat tcaaattcaa attcacaaca    

63961 tacatgcatg ttgtcatgcc ttctttcagt catgagtttg ggtttagttt aggatttgaa    

64021 atgtaagtca tttattttaa tttcatattt tgagatgtag aaatactaaa tctatagtaa    

64081 aattaccttg gtattcacaa aattcggtca gcagatttat aatattactg tgttaatgac    

64141 aatctgattt gttttctatg atatatttct gtactggcca cacattcagg cacagttcag    

64201 cagtgctgtg atgccatcga tcacctaaga cgcatcattg aaaagaagca tgtctcttta    

64261 aacaaagcaa aaaagcgacg tttgccacag taggtgatac tgtttttctt cttttcttta    

64321 acccaacaca aagctaattt ccatctgatg aatgctgaag atgaatatgt agaatataaa    

64381 gaattatctt tgtaaggaag aaatgtgtag aagggtggta tgagttttct tttctttttt    

64441 tttttcattt tttaaaatta gatactttat ttacagttca aattttatcc ccttccctcg    

64501 tttccactcc aaaaaccctc ctatcccatc ccccctgccc cctgctcact aacccaccca    

64561 ctctcgtttc cctgtcctgg cattcctcta cactggggca tcgagccttc acaaggccaa    

64621 gggcctctcc tctcattgat gtcccacgag gccatcctct gctacatatg cagctgaagc     

64681 cttgagtccc tccttgtgta ctctttggtt ggtggtttag ttcctgggag atcagggggt    

64741 actggttggt tcatattgtt gttcctccta tggggctgca aaccccttca gctccttggg    

64801 ttctttctct agctttattg gggagcagtc atttttctag caaaatttaa aacttttaag    

64861 tttgaaagta catggtttca ggatgataat atttgattat ggtttggata ggtatccata    

64921 ttgacagtaa gttttgaaca ttgtatttta cctgttacaa gttttgtaag tcattattta    

64981 attagaatat ttatgaactg ttacacaata aattttgcag tataaggact gagtgtcaca   

 

PCR primer binding sites are underlined; Sequencing primer binding sites are highlighted; the mutated T is highlighted in red.

References
Science Writers Anne Murray
Illustrators Victoria Webster, Katherine Timer
AuthorsCarrie Arnold and Elaine Pirie
List |< first << previous [record 73 of 511] next >> last >|